Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive

Size: px
Start display at page:

Download "Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive"

Transcription

1 Online Data Supplement: Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive asthma Dan Cheng, Zheng Xue, Lingling Yi, Huimin Shi, Kan Zhang, Xiaorong Huo, Luke R. Bonser, Jianping Zhao, Yongjian Xu, David J. Erle, and Guohua Zhen Supplementary Methods Biopsy Technique We brushed 10 sites within the subsegmental bronchi of right middle and lower lobes (10 gentle upward and downward strokes per site). We used forceps to biopsy left lower lobe carinae and fixed samples in polyoxymethylene. Histology and immunohistochemistry We stained 2 μm sections with hematoxylin and eosin (HE) or polyclonal rabbit anti-human IL-25 antibody (Abgent Biotech, China). Observers who were blinded to the clinical status of the subjects counted numbers of eosinophils/mm 2 submucosa and IL-25 positive cells/mm 2 epithelium, and calculated basement membrane thickness (BMT). We used the mean of 50 measurements taken over a distance of at least 1 mm to calculate BMT as previously described (1). Dual Immunofluorescent Staining Sections of bronchial biopsy were deparaffinized with xylene, followed by rehydration by immersing in 90, 70, and 50% ethanol, water, PBS. The sections were

2 permeabilized in PBS with 0.3% Triton X100. The sections were then incubated with mouse monoclonal antibody against MUC5AC at 1:150 dilution (45M1 clone; Sigma, USA) and rabbit polyclonal antibody against MUC5B at 1:150 dilution (H-300 clone; Santa Cruz, USA) at 4 C overnight. These sections were washed with PBST, and then incubated with Alexa Fluor 488 goat anti-mouse IgG for MUC5AC and Alexa Fluor 568 goat anti-rabbit IgG for MUC5B (Life Techonologies, USA) at 1:200 dilution in PBST for 2 h at room temperature. After incubation with secondary antibodies, the sections were washed again, stained with DNA stain 4', 6-diamidino-2-phenylindole (DAPI) (Vector Laboratories, USA) at 1:300 dilution at room temperature and mounted. Dual immunofluorescent staining was examined using an Olympus BX-51 fluorescent microscope with appropriate filters (Olympus, Japan). Gene expression analysis We isolated total RNA from bronchial epithelial brushings and biopsies using TRIzol (Invitrogen, USA) and the RNeasy Micro Kit (Qiagen, USA), respectively and synthesized first-strand cdna using the PrimeScript RT reagent kit (Takara, Japan). We measured human IL-25, IL-33, TSLP, MUC5AC, MUC5B, CLCA1, POSTN, SERPINB10 in bronchial brushings and IL-17RB in biopsies using the Takara Perfect Real Time PCR kit, Takara SYBR Premix ExTaq polymerase, and an ABI Prism 7500 PCR System. The primers used are listed in Table E1. The cycle threshold (Ct) of each gene transcript was normalized to the mean Ct of β-actin and GAPDH. Fold differences were determined by the 2 - ΔΔ Ct method (2). Standardized IL-25 expression value was generated after -ΔΔCt of IL-25 were centered and scaled as previously E2

3 described (3). We measured plasma IL-25 by ELISA (NeoBioscience, China). E3

4 Supplementary References 1. Benayoun L, Druilhe A, Dombret MC, Aubier M, Pretolani M. Airway structural alterations selectively associated with severe asthma. Am J Respir Crit Care Med 2003; 167: Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001; 25: Bhakta NR, Solberg OD, Nguyen CP, Nguyen CN, Arron JR, Fahy JV, Woodruff PG. A qpcr-based metric of Th2 airway inflammation in asthma. Clin Transl Allergy 2013; 3: 24. E4

5 Supplementary Figure Legends Figure E1. Bronchial expression of IL-17RB is increased in subjects with asthma. (A) IL-17RB staining in bronchial biopsies from healthy control subjects (n = 13) and subjects with asthma (n = 27) (original magnification 400). (B) Quantitation of IL-17RB stained cells in the epithelium. (C) Correlation between the numbers of IL-17RB stained cells and IL-25 stained cells in airway epithelium for healthy controls and subjects with asthma. Some subjects were not included in the analyses of IL-17RB staining because bronchial biopsies from those subjects were not adequate for immunohistochemistry due to limitations in the amount of intact tissue seen in the sections. Figure E2. Percentage of IL-25-low and IL-25-high subjects with positive skin prick tests to specific allergens. Figure E3. Bronchial epithelial POSTN transcript levels are increased in subjects with high epithelial IL-25 expression. Levels of transcripts for POSTN in bronchial brushings were determined by quantitative PCR. Values are relative to the median value for healthy controls. Figure E4. MUC5AC and MUC5B proteins in healthy controls and subjects with IL-25 low and IL-25 high asthma. Representative images of immunofluorescent staining for MUC5AC (green), MUC5B (red) and DAPI nuclear staining (blue) in E5

6 bronchial biopsies (original magnification 200). Figure E5. Sensitivity and specificity of biomarkers for ICS responsiveness. Receiver operating characteristic curve analysis of the sensitivity and specificity of plasma IL-25, blood eosinophil numbers, sputum eosinophil percentage and biopsy eosinophil numbers for ICS responsiveness. Responsive to ICS was defined as > 7.5% improvement in FEV 1 after 8 weeks of ICS treatment. AUC, area under the curve. Figure E6. Plasma IL-25 levels are decreased after ICS treatment in subjects with IL-25-high asthma. Plasma IL-25 levels in subjects with IL-25-low asthma (A) and IL-25-high asthma (B) before and after ICS treatment for 4 weeks. E6

7 Supplementary Table E1 ALLERGENS USED IN SKIN PRICK TEST Allergen Cockroach Bombyx mori silk Dermatophagoides farinae Dermatophagoides pteronyssinus Cat hair Dog hair Poplar pollen Platanus hispanica pollen Mugwort pollen Ragweed pollen Alternaria Cladosponium Aspergillus Penicillum

8 Supplementary Table E2. PRIMERS FOR QUANTITATIVE PCR Gene Type Sequence IL-25 Forward GGCCTGTCAGTCAGTGCCCC Reverse CACAGGGGCCAAGCATCTGG IL-33 Forward GTGACGGTGTTGATGGTAAGAT Reverse AGCTCCACAGAGTGTTCCTTG TSLP Forward ATGTTCGCCATGAAAACTAAGGC Reverse GCGACGCCACAATCCTTGTA IL-17RB Forward CAGAGTGGATGCTACAACATGAT Reverse CGGAGTACCCAGCTTACATTCA MUC5AC Forward CAGCACAACCCCTGTTTCAAA Reverse GCGCACAGAGGATGACAGT MUC5B Forward GCCTACGAGGACTTCAACGTC Reverse CCTTGATGACAACACGGGTGA CLCA1 Forward ATGGCTATGAAGGCATTGTCG Reverse TGGCACATTGGGGTCGATTG POSTN Forward GACCGTGTGCTTACACAAATTG Reverse AAGTGACCGTCTCTTCCAAGG SERPINB2 Forward AGCCCAACGATGACTACTTACT Reverse ACCCAAGAGTTGATGTCCTTTCT β-actin Forward GCAAGCAGGACTATGACGAG Reverse CAAATAAAGCCATGCCAATC GAPDH Forward AAGGTGAAGGTCGGAGTCAAC Reverse GGGGTCATTGATGGCAACAATA

9 Supplementary Table E3. THE PERCENTAGE OF IL-25-LOW AND IL-25-HIGH ASTHMA PREDICTED BY DIFFERENT PLASMA IL-25 CUTOFFS Plasma IL-25 (pg/ml) IL-25-low (%) Plasma IL-25 (pg/ml) IL-25-high (%) 50 11/22 (50.0%) >50 19/21 (90.5%) 55 16/22 (72.7%) >55 17/21 (80.9%) 60 17/22 (77.3%) >60 12/21 (57.1%)

10 Figure E1

11 Figure E2

12 Figure E3

13 Figure E4

14 Figure E5

15 Figure E6

Supplementary Information

Supplementary Information Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1

More information

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.

More information

Grass pollen immunotherapy induces Foxp3 expressing CD4 + CD25 + cells. in the nasal mucosa. Suzana Radulovic MD, Mikila R Jacobson PhD,

Grass pollen immunotherapy induces Foxp3 expressing CD4 + CD25 + cells. in the nasal mucosa. Suzana Radulovic MD, Mikila R Jacobson PhD, Radulovic 1 1 2 3 Grass pollen immunotherapy induces Foxp3 expressing CD4 + CD25 + cells in the nasal mucosa 4 5 6 7 Suzana Radulovic MD, Mikila R Jacobson PhD, Stephen R Durham MD, Kayhan T Nouri-Aria

More information

IL-13 Augments Compressive Stress-induced Tissue Factor Expression in Human Airway Epithelial Cells

IL-13 Augments Compressive Stress-induced Tissue Factor Expression in Human Airway Epithelial Cells IL-13 Augments Compressive Stress-induced Tissue Factor Expression in Human Airway Epithelial Cells Jennifer A. Mitchel, Silvio Antoniak, Joo-Hyeon Lee, Sae-Hoon Kim, Maureen McGill, David I. Kasahara,

More information

The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells

The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells 1 SUPPLEMENTARY INFORMATION The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells Karin Loser 1,2,6, Thomas Vogl 2,3, Maik Voskort 1, Aloys

More information

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

Downregulation of angiotensin type 1 receptor and nuclear factor-κb. by sirtuin 1 contributes to renoprotection in unilateral ureteral

Downregulation of angiotensin type 1 receptor and nuclear factor-κb. by sirtuin 1 contributes to renoprotection in unilateral ureteral Supplementary Information Downregulation of angiotensin type 1 receptor and nuclear factor-κb by sirtuin 1 contributes to renoprotection in unilateral ureteral obstruction Shao-Yu Yang 1,2, Shuei-Liong

More information

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen,

Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen, Cell Stem Cell, Volume 7 Supplemental Information Adult SVZ Lineage Cells Home to and Leave the Vascular Niche via Differential Responses to SDF1/CXCR4 Signaling Erzsebet Kokovay, Susan Goderie, Yue Wang,

More information

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES

More information

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2

Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

Pair-fed % inkt cells 0.5. EtOH 0.0

Pair-fed % inkt cells 0.5. EtOH 0.0 MATERIALS AND METHODS Histopathological analysis Liver tissue was collected 9 h post-gavage, and the tissue samples were fixed in 1% formalin and paraffin-embedded following a standard procedure. The embedded

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian

More information

PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human

PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human Anti-CD19-CAR transduced T-cell preparation PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human AB serum (Gemini) and 300 international units/ml IL-2 (Novartis). T cell proliferation

More information

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please

More information

Cells and viruses. Human isolates (A/Kawasaki/173/01 [H1N1], A/Yokohama/2057/03 [H3N2],

Cells and viruses. Human isolates (A/Kawasaki/173/01 [H1N1], A/Yokohama/2057/03 [H3N2], Supplementary information Methods Cells and viruses. Human isolates (A/Kawasaki/173/01 [H1N1], A/Yokohama/2057/03 [H3N2], and A/Hong Kong/213/03 [H5N1]) were grown in Madin-Darby canine kidney (MDCK) cells

More information

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA

More information

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi

More information

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, 1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed

More information

Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival

Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Supplementary Information for Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Tatsuro Kawamura 1, Makoto Kawatani 1, Makoto Muroi, Yasumitsu Kondoh,

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding

More information

Name Animal source Vendor Cat # Dilutions

Name Animal source Vendor Cat # Dilutions Supplementary data Table S1. Primary and Secondary antibody sources Devi et al, TXNIP in mitophagy A. Primary Antibodies Name Animal source Vendor Cat # Dilutions 1. TXNIP mouse MBL KO205-2 1:2000 (WB)

More information

Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and

Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.

More information

Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic

Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic Reticulum Stress Lokesh Makhija, BE, Veda Krishnan, MSc, Rakhshinda Rehman, MTech, Samarpana Chakraborty, MSc, Shuvadeep Maity,

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway

Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Control Pancreatitis Supplementary Figure 2 A Panc Liver SI Spleen H 2 O B EZH2 fl/fl C EZH2 fl/fl 37bp EZH2 ERK2 D E 5 EZH2 fl/fl Fasting Glucose (mg/dl) 2 18 16 14 12 1 8 6 4 2

More information

Prevalence and characterization of somatic mutations in Chinese aldosterone-producing adenoma. patients. Supplemental data. First author: Baojun Wang

Prevalence and characterization of somatic mutations in Chinese aldosterone-producing adenoma. patients. Supplemental data. First author: Baojun Wang Prevalence and characterization of somatic mutations in Chinese aldosterone-producing adenoma patients Supplemental data First author: Baojun Wang Patients and tumor samples A total of 87 patients with

More information

COPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic

COPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic COPD lungs show an attached stratified mucus layer that separate bacteria from the epithelial cells resembling the protective colonic mucus SUPPLEMENTARY TABLES AND FIGURES Tables S1 S8, page 1 and separate

More information

SUPPLEMENTARY MATERIAL. Sample preparation for light microscopy

SUPPLEMENTARY MATERIAL. Sample preparation for light microscopy SUPPLEMENTARY MATERIAL Sample preparation for light microscopy To characterize the granulocytes and melanomacrophage centers, cross sections were prepared for light microscopy, as described in Material

More information

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,

More information

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

ImmunoCAP. Specific IgE blood test

ImmunoCAP. Specific IgE blood test Allergy- Specific IgE blood test provides clinicians with an accurate and convenient method of helping to rule in or rule out allergy in patients with allergy-like symptoms. Allergy- Positive About Allergy-

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

SREBP-2 promotes stem cell-like properties and metastasis by transcriptional activation of c-myc in prostate cancer

SREBP-2 promotes stem cell-like properties and metastasis by transcriptional activation of c-myc in prostate cancer SREBP-2 promotes stem cell-like properties and metastasis by transcriptional activation of c-myc in prostate cancer Supplementary Material Supplementary Methods Supplementary References Supplementary Figure

More information

Development Supplementary information

Development Supplementary information Supplemental Materials and Methods Mosaic clonal analysis GSC and SP clones were induced with the FLP/FRT-mediated mitotic recombination technique (Xu and Rubin, 1993) in files with following genotypes:

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/366/ra25/dc1 Supplementary Materials for Viral entry route determines how human plasmacytoid dendritic cells produce type I interferons Daniela Bruni, Maxime

More information

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12. Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.

More information

Asthma and Its Many Unmet Needs: Directions for Novel Therapeutic Approaches

Asthma and Its Many Unmet Needs: Directions for Novel Therapeutic Approaches Asthma and Its Many Unmet Needs: Directions for Novel Therapeutic Approaches William W. Busse,, M.D. University of Wisconsin School of Medicine and Public Health Madison, WI, USA Disclosure Slide Employment

More information

Supplementary Methods: Omalizumab Trial This double-blind, randomized, placebo-controlled trial was conducted at the University of Utah Hospital and

Supplementary Methods: Omalizumab Trial This double-blind, randomized, placebo-controlled trial was conducted at the University of Utah Hospital and Supplementary Methods: Omalizumab Trial This double-blind, randomized, placebo-controlled trial was conducted at the University of Utah Hospital and Primary Children s Hospital, Salt Lake City, UT, both

More information

Human Allergen Specific IgE ELISA Kits

Human Allergen Specific IgE ELISA Kits Intended Use Human Allergen Specific IgE ELISA Kits These kits are in vitro assays for the qualitative or quantitative detection of allergen-specific IgE antibodies in human serum. They are intended for

More information

Immunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on

Immunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on Supplemental Methods Immunohistochemical Analyses Immunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on prostatectomy sections obtained post-study. Briefly,

More information

Mouse Anti-HDM IgG Antibody Assay Kit

Mouse Anti-HDM IgG Antibody Assay Kit Mouse Anti-HDM IgG Antibody Assay Kit Catalog # 3030 For Research Use Only - Not Human or Therapeutic Use INTRODUCTION Asthma is a common chronic inflammatory disease that affects 300 million people of

More information

Supporting Information

Supporting Information Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)

More information

Decreased Circulating Interleukin-35 Levels Are Related to Interleukin-4-Producing CD8 + T Cells in Patients with Allergic Asthma

Decreased Circulating Interleukin-35 Levels Are Related to Interleukin-4-Producing CD8 + T Cells in Patients with Allergic Asthma ORIGINAL ARTICLE Iran J Allergy Asthma Immunol August 2015; 14(4):379-385. Decreased Circulating Interleukin-35 Levels Are Related to Interleukin-4-Producing CD8 + T Cells in Patients with Allergic Asthma

More information

Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC-

Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC- Supplemental material and methods Reagents. Hydralazine was purchased from Sigma-Aldrich. Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC- 133, human thyroid medullary

More information

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

More information

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

Supplementary Materials for

Supplementary Materials for immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef

More information

Soluble ADAM33 initiates airway remodeling to promote susceptibility for. Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David I Wilson,

Soluble ADAM33 initiates airway remodeling to promote susceptibility for. Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David I Wilson, Revised Suppl. Data: Soluble ADAM33 1 Soluble ADAM33 initiates airway remodeling to promote susceptibility for allergic asthma in early life Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Yatsenko AN, Georgiadis AP, Röpke A, et al. X-linked TEX11

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with

More information

Supplemental figures and figure legends (90517-INS-RG-RV-2) Supplemental Figure 1.

Supplemental figures and figure legends (90517-INS-RG-RV-2) Supplemental Figure 1. Supplemental figures and figure legends (957-INS-RG-RV-) Supplemental Figure. A B.5.5 Interaction p=.89 Model p

More information

SUPPORTING MATREALS. Methods and Materials

SUPPORTING MATREALS. Methods and Materials SUPPORTING MATREALS Methods and Materials Cell Culture MC3T3-E1 (subclone 4) cells were maintained in -MEM with 10% FBS, 1% Pen/Strep at 37ºC in a humidified incubator with 5% CO2. MC3T3 cell differentiation

More information

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze

More information

Supporting Information

Supporting Information Supporting Information Fujishita et al. 10.1073/pnas.0800041105 SI Text Polyp Scoring. Intestinal polyps were counted as described (1). Briefly, the small and large intestines were excised, washed with

More information

IKKα Causes Chromatin Modification on Pro-Inflammatory Genes by Cigarette Smoke in Mouse Lung

IKKα Causes Chromatin Modification on Pro-Inflammatory Genes by Cigarette Smoke in Mouse Lung IKKα Causes Chromatin Modification on Pro-Inflammatory Genes by Cigarette Smoke in Mouse Lung Se-Ran Yang, Samantha Valvo, Hongwei Yao, Aruna Kode, Saravanan Rajendrasozhan, Indika Edirisinghe, Samuel

More information

Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/-

Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- Supplemental Material Results. Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- and Slc2a7 -/- mice. The expression of AE1 in the kidney was examined in Slc26a7 KO mice.

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Hepatocyte toxicity assay. Freshly isolated hepatocytes were incubated for overnight with varying concentrations (-25 µm) of sodium glycochenodeoxycholate (GCDC) or

More information

Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.

Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Tetsuya Homma, Atsushi Kato, Bharat Bhushan, James E. Norton, Lydia A. Suh, Roderick G. Carter, Dave S. Gupta,

More information

Airway Inflammation in Asthma Chih-Yung Chiu 1,2, Kin-Sun Wong 2 1 Department of Pediatrics, Chang Gung Memorial Hospital, Keelung, Taiwan.

Airway Inflammation in Asthma Chih-Yung Chiu 1,2, Kin-Sun Wong 2 1 Department of Pediatrics, Chang Gung Memorial Hospital, Keelung, Taiwan. REVIEW ARTICLE Chih-Yung Chiu 1,2, Kin-Sun Wong 2 1 Department of Pediatrics, Chang Gung Memorial Hospital, Keelung, Taiwan. 2 Division of Pediatric Pulmonology, Department of Pediatrics, Chang Gung Memorial

More information

Functional Effects of TGF-beta1 on Mesenchymal Stem Cell Mobilization in Cockroach Allergen Induced Asthma

Functional Effects of TGF-beta1 on Mesenchymal Stem Cell Mobilization in Cockroach Allergen Induced Asthma Functional Effects of TGF-beta1 on Mesenchymal Stem Cell Mobilization in Cockroach Allergen Induced Asthma Pei-Song Gao, MD, PhD Division of Allergy & Clinical Immunology Johns Hopkins University School

More information

Oligo Sequence* bp %GC Tm Hair Hm Ht Position Size Ref. HIVrt-F 5 -CTA-gAA-CTT-TRA-ATg-CAT-ggg-TAA-AAg-TA

Oligo Sequence* bp %GC Tm Hair Hm Ht Position Size Ref. HIVrt-F 5 -CTA-gAA-CTT-TRA-ATg-CAT-ggg-TAA-AAg-TA Human immunodeficiency virus (HIV) detection & quantitation by qrt-pcr (Taqman). Created on: Oct 26, 2010; Last modified by: Jul 17, 2017; Version: 3.0 This protocol describes the qrt-pcr taqman based

More information

Comparison of Young and Old Cardiac Telocytes Using Atomic Force Microscopy

Comparison of Young and Old Cardiac Telocytes Using Atomic Force Microscopy Comparison of Young and Old Cardiac Telocytes Using Atomic Force Microscopy Jiali Luo 1, 2, 3, 4, a, Shanshan Feng 1, 2, 3, 4, b 1Key Laboratory of Regenerative Medicine, Ministry of Education, Jinan University,

More information

ab LDL Uptake Assay Kit (Cell-Based)

ab LDL Uptake Assay Kit (Cell-Based) ab133127 LDL Uptake Assay Kit (Cell-Based) Instructions for Use For the detection of LDL uptake into cultured cells. This product is for research use only and is not intended for diagnostic use. Version

More information

Pretargeting and Bioorthogonal Click Chemistry-Mediated Endogenous Stem Cell Homing for Heart Repair

Pretargeting and Bioorthogonal Click Chemistry-Mediated Endogenous Stem Cell Homing for Heart Repair Pretargeting and Bioorthogonal Click Chemistry-Mediated Endogenous Stem Cell Homing for Heart Repair Mouse Model of Myocardial Infarction (MI) All animal work was compliant with the Institutional Animal

More information

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details

More information

Expressional Changes In Growth And Inflammatory Mediators During Achilles Tendon Repair In Diabetic Rats.

Expressional Changes In Growth And Inflammatory Mediators During Achilles Tendon Repair In Diabetic Rats. Expressional Changes In Growth And Inflammatory Mediators During Achilles Tendon Repair In Diabetic Rats. Paul W. Ackermann, MD, PhD 1, Aisha Ahmed, PhD 1, Nicos Schizas, MD 1, Jian Li, MD, PhD 1, Mahmood

More information

Neutrophils contribute to fracture healing by synthesizing fibronectin+ extracellular matrix rapidly after injury

Neutrophils contribute to fracture healing by synthesizing fibronectin+ extracellular matrix rapidly after injury Neutrophils contribute to fracture healing by synthesizing fibronectin+ extracellular matrix rapidly after injury Bastian OW, Koenderman L, Alblas J, Leenen LPH, Blokhuis TJ. Neutrophils contribute to

More information

Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow

Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)

More information

Airway epithelial gene expression in the diagnostic evaluation of smokers with suspect lung cancer

Airway epithelial gene expression in the diagnostic evaluation of smokers with suspect lung cancer Airway epithelial gene expression in the diagnostic evaluation of smokers with suspect lung cancer Avrum Spira, Jennifer E Beane, Vishal Shah, Katrina Steiling, Gang Liu, Frank Schembri, Sean Gilman, Yves-Martine

More information

Identifying Biologic Targets to Attenuate or Eliminate Asthma Exacerbations

Identifying Biologic Targets to Attenuate or Eliminate Asthma Exacerbations Identifying Biologic Targets to Attenuate or Eliminate Exacerbations exacerbations are a major cause of disease morbidity and costs. For both children and adults, viral respiratory infections are the major

More information

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplementary data Supplementary Figure 1 Supplementary Figure 2 Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna

More information

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.)

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.) Table of Contents Fluor TM Labeling Dyes Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum....1 Fluor TM 405 Dye, an Excellent Alternative to Alexa Fluor 405 & DyLight 405....2 Fluor

More information

Allergy. pp. 4 5 pp. 6 7 pp BAT Allergens Antibodies

Allergy. pp. 4 5 pp. 6 7 pp BAT Allergens Antibodies Allergy pp. 4 5 pp. 6 7 pp. 8 10 BAT Allergens Antibodies Our portfolio Flow cytometry validated antibodies for a broad range of research applications (immunology, hematology, cancer research, etc.) available

More information

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong

More information

Detection of Circulating Tumor Cells Harboring a Unique ALK-Rearrangement in ALK- Positive Non-Small-Cell Lung Cancer.

Detection of Circulating Tumor Cells Harboring a Unique ALK-Rearrangement in ALK- Positive Non-Small-Cell Lung Cancer. Detection of Circulating Tumor Cells Harboring a Unique ALK-Rearrangement in ALK- Positive Non-Small-Cell Lung Cancer Pailler, et al Data Supplement Table S1. Numbers and Percentages of ALK-Rearranged

More information

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl

More information

Mesenchymal Stem Cells Reshape and Provoke Proliferation of Articular. State Key Laboratory of Bioreactor Engineering, East China University of

Mesenchymal Stem Cells Reshape and Provoke Proliferation of Articular. State Key Laboratory of Bioreactor Engineering, East China University of Mesenchymal Stem Cells Reshape and Provoke Proliferation of Articular Chondrocytes by Paracrine Secretion Lei Xu, Yuxi Wu, Zhimiao Xiong, Yan Zhou, Zhaoyang Ye *, Wen-Song Tan * State Key Laboratory of

More information

LDL Uptake Cell-Based Assay Kit

LDL Uptake Cell-Based Assay Kit LDL Uptake Cell-Based Assay Kit Catalog Number KA1327 100 assays Version: 07 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...

More information

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used

More information

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

SUPPLEMENTAL MATERIAL. Supplementary Methods

SUPPLEMENTAL MATERIAL. Supplementary Methods SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was

More information

Supplementary Data Table of Contents:

Supplementary Data Table of Contents: Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary

More information

Effective Targeting of Quiescent Chronic Myelogenous

Effective Targeting of Quiescent Chronic Myelogenous Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,

More information

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2 Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji

More information

Evaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers

Evaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers Evaluation of directed and random motility in microslides Motility experiments in IBIDI microslides, image acquisition and processing were performed as described. PMN, which ended up in an angle < 180

More information