Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive"

Transcription

1 Online Data Supplement: Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive asthma Dan Cheng, Zheng Xue, Lingling Yi, Huimin Shi, Kan Zhang, Xiaorong Huo, Luke R. Bonser, Jianping Zhao, Yongjian Xu, David J. Erle, and Guohua Zhen Supplementary Methods Biopsy Technique We brushed 10 sites within the subsegmental bronchi of right middle and lower lobes (10 gentle upward and downward strokes per site). We used forceps to biopsy left lower lobe carinae and fixed samples in polyoxymethylene. Histology and immunohistochemistry We stained 2 μm sections with hematoxylin and eosin (HE) or polyclonal rabbit anti-human IL-25 antibody (Abgent Biotech, China). Observers who were blinded to the clinical status of the subjects counted numbers of eosinophils/mm 2 submucosa and IL-25 positive cells/mm 2 epithelium, and calculated basement membrane thickness (BMT). We used the mean of 50 measurements taken over a distance of at least 1 mm to calculate BMT as previously described (1). Dual Immunofluorescent Staining Sections of bronchial biopsy were deparaffinized with xylene, followed by rehydration by immersing in 90, 70, and 50% ethanol, water, PBS. The sections were

2 permeabilized in PBS with 0.3% Triton X100. The sections were then incubated with mouse monoclonal antibody against MUC5AC at 1:150 dilution (45M1 clone; Sigma, USA) and rabbit polyclonal antibody against MUC5B at 1:150 dilution (H-300 clone; Santa Cruz, USA) at 4 C overnight. These sections were washed with PBST, and then incubated with Alexa Fluor 488 goat anti-mouse IgG for MUC5AC and Alexa Fluor 568 goat anti-rabbit IgG for MUC5B (Life Techonologies, USA) at 1:200 dilution in PBST for 2 h at room temperature. After incubation with secondary antibodies, the sections were washed again, stained with DNA stain 4', 6-diamidino-2-phenylindole (DAPI) (Vector Laboratories, USA) at 1:300 dilution at room temperature and mounted. Dual immunofluorescent staining was examined using an Olympus BX-51 fluorescent microscope with appropriate filters (Olympus, Japan). Gene expression analysis We isolated total RNA from bronchial epithelial brushings and biopsies using TRIzol (Invitrogen, USA) and the RNeasy Micro Kit (Qiagen, USA), respectively and synthesized first-strand cdna using the PrimeScript RT reagent kit (Takara, Japan). We measured human IL-25, IL-33, TSLP, MUC5AC, MUC5B, CLCA1, POSTN, SERPINB10 in bronchial brushings and IL-17RB in biopsies using the Takara Perfect Real Time PCR kit, Takara SYBR Premix ExTaq polymerase, and an ABI Prism 7500 PCR System. The primers used are listed in Table E1. The cycle threshold (Ct) of each gene transcript was normalized to the mean Ct of β-actin and GAPDH. Fold differences were determined by the 2 - ΔΔ Ct method (2). Standardized IL-25 expression value was generated after -ΔΔCt of IL-25 were centered and scaled as previously E2

3 described (3). We measured plasma IL-25 by ELISA (NeoBioscience, China). E3

4 Supplementary References 1. Benayoun L, Druilhe A, Dombret MC, Aubier M, Pretolani M. Airway structural alterations selectively associated with severe asthma. Am J Respir Crit Care Med 2003; 167: Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001; 25: Bhakta NR, Solberg OD, Nguyen CP, Nguyen CN, Arron JR, Fahy JV, Woodruff PG. A qpcr-based metric of Th2 airway inflammation in asthma. Clin Transl Allergy 2013; 3: 24. E4

5 Supplementary Figure Legends Figure E1. Bronchial expression of IL-17RB is increased in subjects with asthma. (A) IL-17RB staining in bronchial biopsies from healthy control subjects (n = 13) and subjects with asthma (n = 27) (original magnification 400). (B) Quantitation of IL-17RB stained cells in the epithelium. (C) Correlation between the numbers of IL-17RB stained cells and IL-25 stained cells in airway epithelium for healthy controls and subjects with asthma. Some subjects were not included in the analyses of IL-17RB staining because bronchial biopsies from those subjects were not adequate for immunohistochemistry due to limitations in the amount of intact tissue seen in the sections. Figure E2. Percentage of IL-25-low and IL-25-high subjects with positive skin prick tests to specific allergens. Figure E3. Bronchial epithelial POSTN transcript levels are increased in subjects with high epithelial IL-25 expression. Levels of transcripts for POSTN in bronchial brushings were determined by quantitative PCR. Values are relative to the median value for healthy controls. Figure E4. MUC5AC and MUC5B proteins in healthy controls and subjects with IL-25 low and IL-25 high asthma. Representative images of immunofluorescent staining for MUC5AC (green), MUC5B (red) and DAPI nuclear staining (blue) in E5

6 bronchial biopsies (original magnification 200). Figure E5. Sensitivity and specificity of biomarkers for ICS responsiveness. Receiver operating characteristic curve analysis of the sensitivity and specificity of plasma IL-25, blood eosinophil numbers, sputum eosinophil percentage and biopsy eosinophil numbers for ICS responsiveness. Responsive to ICS was defined as > 7.5% improvement in FEV 1 after 8 weeks of ICS treatment. AUC, area under the curve. Figure E6. Plasma IL-25 levels are decreased after ICS treatment in subjects with IL-25-high asthma. Plasma IL-25 levels in subjects with IL-25-low asthma (A) and IL-25-high asthma (B) before and after ICS treatment for 4 weeks. E6

7 Supplementary Table E1 ALLERGENS USED IN SKIN PRICK TEST Allergen Cockroach Bombyx mori silk Dermatophagoides farinae Dermatophagoides pteronyssinus Cat hair Dog hair Poplar pollen Platanus hispanica pollen Mugwort pollen Ragweed pollen Alternaria Cladosponium Aspergillus Penicillum

8 Supplementary Table E2. PRIMERS FOR QUANTITATIVE PCR Gene Type Sequence IL-25 Forward GGCCTGTCAGTCAGTGCCCC Reverse CACAGGGGCCAAGCATCTGG IL-33 Forward GTGACGGTGTTGATGGTAAGAT Reverse AGCTCCACAGAGTGTTCCTTG TSLP Forward ATGTTCGCCATGAAAACTAAGGC Reverse GCGACGCCACAATCCTTGTA IL-17RB Forward CAGAGTGGATGCTACAACATGAT Reverse CGGAGTACCCAGCTTACATTCA MUC5AC Forward CAGCACAACCCCTGTTTCAAA Reverse GCGCACAGAGGATGACAGT MUC5B Forward GCCTACGAGGACTTCAACGTC Reverse CCTTGATGACAACACGGGTGA CLCA1 Forward ATGGCTATGAAGGCATTGTCG Reverse TGGCACATTGGGGTCGATTG POSTN Forward GACCGTGTGCTTACACAAATTG Reverse AAGTGACCGTCTCTTCCAAGG SERPINB2 Forward AGCCCAACGATGACTACTTACT Reverse ACCCAAGAGTTGATGTCCTTTCT β-actin Forward GCAAGCAGGACTATGACGAG Reverse CAAATAAAGCCATGCCAATC GAPDH Forward AAGGTGAAGGTCGGAGTCAAC Reverse GGGGTCATTGATGGCAACAATA

9 Supplementary Table E3. THE PERCENTAGE OF IL-25-LOW AND IL-25-HIGH ASTHMA PREDICTED BY DIFFERENT PLASMA IL-25 CUTOFFS Plasma IL-25 (pg/ml) IL-25-low (%) Plasma IL-25 (pg/ml) IL-25-high (%) 50 11/22 (50.0%) >50 19/21 (90.5%) 55 16/22 (72.7%) >55 17/21 (80.9%) 60 17/22 (77.3%) >60 12/21 (57.1%)

10 Figure E1

11 Figure E2

12 Figure E3

13 Figure E4

14 Figure E5

15 Figure E6

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

More information

Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen,

Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen, Cell Stem Cell, Volume 7 Supplemental Information Adult SVZ Lineage Cells Home to and Leave the Vascular Niche via Differential Responses to SDF1/CXCR4 Signaling Erzsebet Kokovay, Susan Goderie, Yue Wang,

More information

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Control Pancreatitis Supplementary Figure 2 A Panc Liver SI Spleen H 2 O B EZH2 fl/fl C EZH2 fl/fl 37bp EZH2 ERK2 D E 5 EZH2 fl/fl Fasting Glucose (mg/dl) 2 18 16 14 12 1 8 6 4 2

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

Prevalence and characterization of somatic mutations in Chinese aldosterone-producing adenoma. patients. Supplemental data. First author: Baojun Wang

Prevalence and characterization of somatic mutations in Chinese aldosterone-producing adenoma. patients. Supplemental data. First author: Baojun Wang Prevalence and characterization of somatic mutations in Chinese aldosterone-producing adenoma patients Supplemental data First author: Baojun Wang Patients and tumor samples A total of 87 patients with

More information

SUPPLEMENTARY MATERIAL. Sample preparation for light microscopy

SUPPLEMENTARY MATERIAL. Sample preparation for light microscopy SUPPLEMENTARY MATERIAL Sample preparation for light microscopy To characterize the granulocytes and melanomacrophage centers, cross sections were prepared for light microscopy, as described in Material

More information

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze

More information

Supplementary Materials for

Supplementary Materials for immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef

More information

Detection of Circulating Tumor Cells Harboring a Unique ALK-Rearrangement in ALK- Positive Non-Small-Cell Lung Cancer.

Detection of Circulating Tumor Cells Harboring a Unique ALK-Rearrangement in ALK- Positive Non-Small-Cell Lung Cancer. Detection of Circulating Tumor Cells Harboring a Unique ALK-Rearrangement in ALK- Positive Non-Small-Cell Lung Cancer Pailler, et al Data Supplement Table S1. Numbers and Percentages of ALK-Rearranged

More information

ab LDL Uptake Assay Kit (Cell-Based)

ab LDL Uptake Assay Kit (Cell-Based) ab133127 LDL Uptake Assay Kit (Cell-Based) Instructions for Use For the detection of LDL uptake into cultured cells. This product is for research use only and is not intended for diagnostic use. Version

More information

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details

More information

Functional Effects of TGF-beta1 on Mesenchymal Stem Cell Mobilization in Cockroach Allergen Induced Asthma

Functional Effects of TGF-beta1 on Mesenchymal Stem Cell Mobilization in Cockroach Allergen Induced Asthma Functional Effects of TGF-beta1 on Mesenchymal Stem Cell Mobilization in Cockroach Allergen Induced Asthma Pei-Song Gao, MD, PhD Division of Allergy & Clinical Immunology Johns Hopkins University School

More information

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.)

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.) Table of Contents Fluor TM Labeling Dyes Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum....1 Fluor TM 405 Dye, an Excellent Alternative to Alexa Fluor 405 & DyLight 405....2 Fluor

More information

Elevated fibrous sheath interacting protein 1 levels are associated with poor prognosis in non-small cell lung cancer patients

Elevated fibrous sheath interacting protein 1 levels are associated with poor prognosis in non-small cell lung cancer patients /, 2017, Vol. 8, (No. 7), pp: 12186-12193 Elevated fibrous sheath interacting protein 1 levels are associated with poor prognosis in non-small cell lung cancer patients Yuqiang Mao 1, Ran Xu 1, Xiaoying

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

References. Plasma renin activity (PRA) PRA was measured by a radioimmunoassay kit (Wallac, Tokyo, Japan).

References. Plasma renin activity (PRA) PRA was measured by a radioimmunoassay kit (Wallac, Tokyo, Japan). Detailed Methods Experiment I enos / mice were purchased from Jackson Laboratory (Bar Harbor, USA). C57BL/6J mice on the same genetic background were purchased from KBT Oriental (Hamamatsu, Japan). Eleven-week-old

More information

Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness

Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness World Health Organization Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness General information Highly pathogenic avian influenza (HPAI)

More information

Explain the laboratory diagnosis of Rabies?

Explain the laboratory diagnosis of Rabies? Explain the laboratory diagnosis of Rabies? The standard test for rabies testing is dfa. This test has been thoroughly evaluated for more than 40 years, and is recognized as the most rapid and reliable

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Reagents and antibodies was purchased from iaffin GmbH & Co KG. Cisplatin (ristol-myers Squibb Co.) and etoposide (Sandoz Pharma Ltd.) were used. Antibodies recognizing

More information

Resistin expression in adipose tissues and its effect on glucose metabolism in rats with brain injury

Resistin expression in adipose tissues and its effect on glucose metabolism in rats with brain injury Resistin expression in adipose tissues and its effect on glucose metabolism in rats with brain injury R. Zhang 1, Z.Y. Wang 1, L.L. Zhu 1, F. Wu 1, D.Q. Chen 1, L.F. Sun 1 and Z.Q. Lu 2 1 Department of

More information

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly

More information

HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury

HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury J Mol Med 2015 HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury Sara Karsikas; Mikko Myllymäki; Minna Heikkilä; Raija Sormunen; Kari I Kivirikko; Johanna Myllyharju; Raisa

More information

CONTRACTING ORGANIZATION: University of Southern California Los Angeles, CA 90033

CONTRACTING ORGANIZATION: University of Southern California Los Angeles, CA 90033 AD Award Number: W81XWH-07-01-0264 TITLE: Function of Klotho and is MicroRNA in Prostate Cancer and Aging PRINCIPAL INVESTIGATOR: Shao-Yao Ying, Ph.D. CONTRACTING ORGANIZATION: University of Southern California

More information

Effective Targeting of Quiescent Chronic Myelogenous

Effective Targeting of Quiescent Chronic Myelogenous Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,

More information

Bronchoscopy with bronchial biopsies. Quantitative morphology using bronchial biopsies. P.G. Woodruff and A.L. Innes

Bronchoscopy with bronchial biopsies. Quantitative morphology using bronchial biopsies. P.G. Woodruff and A.L. Innes Eur Respir Rev 2006; 15: 101, 157 161 DOI: 10.1183/09059180.00010106 CopyrightßERSJ Ltd 2006 Quantitative morphology using bronchial biopsies P.G. Woodruff and A.L. Innes ABSTRACT: Bronchoscopy with bronchial

More information

COMPLEXITY OF MOLD ALLERGIES ACAAI Presentation # P175

COMPLEXITY OF MOLD ALLERGIES ACAAI Presentation # P175 2004 ACAAI Presentation # P175 MOLD EXTRACT COMPARABILITY, STABILITY AND COMPATIBILITY : COMPOSITIONAL AND IMMUNOCHEMICAL INVESTIGATIONS Thomas J. Grier, Ph.D. Dawn M. LeFevre, B.S. Elizabeth A. Duncan,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

Original Article Differential expression profile analysis of mirnas with HER-2 overexpression and intervention in breast cancer cells

Original Article Differential expression profile analysis of mirnas with HER-2 overexpression and intervention in breast cancer cells Int J Clin Exp Pathol 2017;10(5):5039-5062 www.ijcep.com /ISSN:1936-2625/IJCEP0052419 Original Article Differential expression profile analysis of mirnas with HER-2 overexpression and intervention in breast

More information

Fig 1 CD163. CD11b S100A9. Sirius Red. 100μm ** ** CD163. CD11b S100A9 ** Sirius Red (PL) Sirius Red SUM Mo.

Fig 1 CD163. CD11b S100A9. Sirius Red. 100μm ** ** CD163. CD11b S100A9 ** Sirius Red (PL) Sirius Red SUM Mo. T47D T47D + o SU-59 Fig SU-59 + o IHC score (-3) IHC score (-2) CD63 3 2 IHC score (-3) CD63 3 ** 2 CDb CDb * * SA9 SA9 ** * 2 IHC score (-4) αsa αsa 4 ** ** 2 Sirius Red μm IHC score (%) Sirius Red 8

More information

SUPPLEMENTARY MATERIALS. IL-4 as a Repurposed Biological Drug for Myocardial Infarction through. Augmentation of Reparative Cardiac Macrophages:

SUPPLEMENTARY MATERIALS. IL-4 as a Repurposed Biological Drug for Myocardial Infarction through. Augmentation of Reparative Cardiac Macrophages: 1 SUPPLEMENTARY MATERIALS IL-4 as a Repurposed Biological Drug for Myocardial Infarction through Augmentation of Reparative Cardiac Macrophages: Proof-of-Concept Data in Mice Yusuke Shintani MD PhD, Tomoya

More information

Supplemental Information

Supplemental Information Supplemental Information Supplemental Experimental Procedures: Tissue culture and cell lines Cell culture was conducted as described earlier (Wang et al., 2011). PA-1 and MCF7 were maintained in Eagle's

More information

DEVELOPMENTAL VALIDATION OF SPERM HY-LITER EXPRESS Jennifer Old, Chris Martersteck, Anna Kalinina, Independent Forensics, Lombard IL

DEVELOPMENTAL VALIDATION OF SPERM HY-LITER EXPRESS Jennifer Old, Chris Martersteck, Anna Kalinina, Independent Forensics, Lombard IL DEVELOPMENTAL VALIDATION OF SPERM HY-LITER EXPRESS Jennifer Old, Chris Martersteck, Anna Kalinina, Independent Forensics, Lombard IL Background and Introduction SPERM HY-LITER is the first immunofluorescent

More information

Mouse Anti-OVA IgM Antibody Assay Kit

Mouse Anti-OVA IgM Antibody Assay Kit Mouse Anti-OVA IgM Antibody Assay Kit Catalog # 3017 For Research Use Only - Not Human or Therapeutic Use INTRODUCTION Ovalbumin (OVA) is a widely used antigen for inducing allergic reactions in experimental

More information

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells

More information

Neonatal Exposure to Microbial Phosphorylcholine Modulates the Development of House Dust Mite Allergy During Adult Life

Neonatal Exposure to Microbial Phosphorylcholine Modulates the Development of House Dust Mite Allergy During Adult Life Neonatal Exposure to Microbial Phosphorylcholine Modulates the Development of House Dust Mite Allergy During Adult Life J. Sides SEM Preeyam Patel Mentor: Dr John Kearney 015 CAMBAC Research Day 9/18/15

More information

ELISA kit for Environmental Allergen

ELISA kit for Environmental Allergen ELISA kit for Environmental Allergen House dust mite allergen Der p 1, Der f 1, Der2 High-sensitivity High-reproductivity ELISA kit for biological environmental allergen Ceder pollen allergen Cry j 1,Cry

More information

ANGIOTENSIN-(1-7) PREVENTS CARDIOMYOCYTE PATHOLOGICAL. REMODELING THROUGH A NO/cGMP DEPENDENT PATHWAY.

ANGIOTENSIN-(1-7) PREVENTS CARDIOMYOCYTE PATHOLOGICAL. REMODELING THROUGH A NO/cGMP DEPENDENT PATHWAY. ONLINE SUPPLEMENT ANGIOTENSIN-(1-7) PREVENTS CARDIOMYOCYTE PATHOLOGICAL REMODELING THROUGH A NO/cGMP DEPENDENT PATHWAY. Enéas R.M. Gomes 1, Aline A. Lara 1, Pedro W.M. Almeida 1, Diogo Guimarães 1, Rodrigo

More information

Detection of let-7a MicroRNA by Real-time PCR in Colorectal Cancer: a Single-centre Experience from China

Detection of let-7a MicroRNA by Real-time PCR in Colorectal Cancer: a Single-centre Experience from China The Journal of International Medical Research 2007; 35: 716 723 Detection of let-7a MicroRNA by Real-time PCR in Colorectal Cancer: a Single-centre Experience from China W-J FANG 1, C-Z LIN 2, H-H ZHANG

More information

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG

More information

Documentation, Codebook, and Frequencies

Documentation, Codebook, and Frequencies Documentation, Codebook, and Frequencies Laboratory Component: Allergen Specific IgE(s) and Total IgE in Serum Survey Years: 2005 to 2006 SAS Export File: AL_IGE_D.XPT First Published: June 2008 Last Revised:

More information

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

Supporting Information

Supporting Information Supporting Information Rock et al. 10.1073/pnas.1117988108 Fig. S1. Heterogeneity of stromal cells in normal and fibrotic mouse lungs. Sections of normal mouse lungs (A and D) and fibrotic lungs collected

More information

NF-κB p65 (Phospho-Thr254)

NF-κB p65 (Phospho-Thr254) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 NF-κB p65 (Phospho-Thr254) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02015 Please read the provided manual

More information

A Microfluidic ExoSearch Chip for Multiplexed Exosome Detection Towards Bloodbased Ovarian Cancer Diagnosis

A Microfluidic ExoSearch Chip for Multiplexed Exosome Detection Towards Bloodbased Ovarian Cancer Diagnosis Electronic Supplementary Material (ESI) for Lab on a Chip. This journal is The Royal Society of Chemistry 2015 Supplementary Information A Microfluidic ExoSearch Chip for Multiplexed Exosome Detection

More information

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3' Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA

More information

CLARITY reveals dynamics of ovarian follicular architecture and vasculature in three-dimensions

CLARITY reveals dynamics of ovarian follicular architecture and vasculature in three-dimensions CLARITY reveals dynamics of ovarian follicular architecture and vasculature in three-dimensions Yi Feng, Peng Cui, Xiaowei Lu, Brian Hsueh, Fredrik Möller Billig, Livia Zarnescu Yanez, Raju Tomer, Derek

More information

Mouse Total IgA Antibody Detection Kit

Mouse Total IgA Antibody Detection Kit Mouse Total IgA Antibody Detection Kit Catalog # 3019 For Research Use Only - Not Human or Therapeutic Use INTRODUCTION The total IgA levels in specimens are often determined in mouse disease models involving

More information

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1

More information

AlphaScreen : A Straightforward and Powerful Alternative to ELISA. Martina Bielefeld-Sévigny Ph.D., R&D Director

AlphaScreen : A Straightforward and Powerful Alternative to ELISA. Martina Bielefeld-Sévigny Ph.D., R&D Director AlphaScreen : A Straightforward and Powerful Alternative to ELISA Martina Bielefeld-Sévigny Ph.D., R&D Director Overview AlphaScreen - an alternative to ELISA Why an alternative to ELISA? Assay principle

More information

Supporting Information

Supporting Information Supporting Information Shime et al. 1.173/pnas.11139919 SI Methods Reagents. was purchased from GE Healthcare, which was free from LPS contamination. TNF-α and IFN-β ELISA kit was purchased from eioscience

More information

MARIA TM Premixed Multiplex Array for Indoor Allergens (5-plex)

MARIA TM Premixed Multiplex Array for Indoor Allergens (5-plex) MARIA TM Premixed Multiplex Array for Indoor Allergens (5-plex) Product Code: MRA-P5B Lot Number: xxxxx www.inbio.com Indoor Biotechnologies, Inc. 1216 Harris Street, Charlottesville Virginia, 2293 United

More information

Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb /DC1

Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb /DC1 Supplemental material JCB Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb.201504035 /DC1 THE JOU RNAL OF CELL BIO LOGY Figure S1. Lamin A/C depletion generates two distinct phenotypes in

More information

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte

More information

Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry

Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41564-017-0080-8 In the format provided by the authors and unedited. Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus

More information

Effect of starvation-induced autophagy on cell cycle of tumor cells

Effect of starvation-induced autophagy on cell cycle of tumor cells [Chinese Journal of Cancer 27:8, 102-108; August 2008]; 2008 Sun Yat-Sen University Cancer Center Basic Research Paper Effect of starvation-induced autophagy on cell cycle of tumor cells Jun-Na Ge, 1 Dan

More information

qpcr-array Analysis Service

qpcr-array Analysis Service qpcr-array Analysis Service Customer Name Institute Telephone Address E-mail PO Number Service Code Report Date Service Laboratory Department Phalanx Biotech Group, Inc 6 Floor, No.6, Technology Road 5,

More information

Heterogeneity of COPD and Asthma

Heterogeneity of COPD and Asthma Heterogeneity of COPD and Asthma from Heterogeneity to Stratification Dr. Y-M Oh Asan Medical Center Seoul Congratulations & Welcome Lee,SD Ohno, Y Park, JS Seo, JB 8 th Internat nal Workshop on Pul. Functional

More information

MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function

MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function Authors: Richard Y. Wu 1,2, Majd Abdullah 1, Pekka Määttänen

More information

SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.

SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences. Supplementary Table 2. Antibodies used for Immunofluoresence. Antibody Dilution Source Goat anti-pdx1 1:100 R&D Systems Rabbit anti-hnf6 1:100 Santa Cruz Biotechnology Mouse anti-nkx6.1 1:200 Developmental

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis

More information

Subclinical phenotypes of asthma

Subclinical phenotypes of asthma 1 Subclinical phenotypes of asthma P Bradding DM FRCP*, RH Green MD FRCP* * Institute for Lung Health and Department of Respiratory Medicine, Glenfield Hospital, Leicester, UK Department of Infection,

More information

Property of Presenter

Property of Presenter Have We Missed A Role For Neutrophils In Asthma? In Steroid-Refractory Asthma? Erwin W. Gelfand, MD Chairman, Department of Pediatrics National Jewish Health Professor of Pediatrics and Immunology University

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

Supplementary Information Catapult-like release of mitochondrial DNA by eosinophils contributes to anti-bacterial defense

Supplementary Information Catapult-like release of mitochondrial DNA by eosinophils contributes to anti-bacterial defense Supplementary Information Catapult-like release of mitochondrial DNA by eosinophils contributes to anti-bacterial defense Shida Yousefi, Jeffrey A. Gold, Nicola Andina, James J. Lee, Ann M. Kelly, Evelyne

More information

Epithelial Desquamation in Asthma Artifact or Pathology?

Epithelial Desquamation in Asthma Artifact or Pathology? Epithelial Desquamation in Asthma Artifact or Pathology? CLAUDIA ORDOÑEZ, RON FERRANDO, DALLAS M. HYDE, HOFER H. WONG, and JOHN V. FAHY Departments of Pediatrics and Medicine and the Cardiovascular Research

More information

EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric)

EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric) Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Total Histone H3 Acetylation Detection Fast Kit (Colorimetric)

More information

Gladstone Institutes, University of California (UCSF), San Francisco, USA

Gladstone Institutes, University of California (UCSF), San Francisco, USA Fluorescence-linked Antigen Quantification (FLAQ) Assay for Fast Quantification of HIV-1 p24 Gag Marianne Gesner, Mekhala Maiti, Robert Grant and Marielle Cavrois * Gladstone Institutes, University of

More information

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone

More information

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor

More information

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice undergoing AD- and psoriasis-like disease. Immunofluorescence staining for Fn14 (green) and DAPI (blue) in skin of naïve

More information

Supporting Information

Supporting Information Supporting Information van der Windt et al. 10.1073/pnas.1221740110 SI Materials and Methods Mice and Reagents. C57BL/6 and major histocompatibility complex class I-restricted OVA-specific T-cell receptor

More information

ECL Plex Western Blotting Detection System

ECL Plex Western Blotting Detection System Part of GE Healthcare Data File 28-415-39 AA ECL Plex Western Blotting Detection System Multiplex protein detection based on direct fluorescent CyDye-labeled conjugates ECL Plex fluorescent Western blotting

More information

Influenza A H1N1 HA ELISA Pair Set

Influenza A H1N1 HA ELISA Pair Set Influenza A H1N1 HA ELISA Pair Set for H1N1 ( A/Puerto Rico/8/1934 ) HA Catalog Number : SEK11684 To achieve the best assay results, this manual must be read carefully before using this product and the

More information

Effect of Bronchoconstriction on Airway Remodeling in Asthma

Effect of Bronchoconstriction on Airway Remodeling in Asthma T h e n e w e ngl a nd j o u r na l o f m e dic i n e original article Effect of Bronchoconstriction on Airway Remodeling in Asthma Christopher L. Grainge, Ph.D., Laurie C.K. Lau, Ph.D., Jonathon A. Ward,

More information

Testing Profiles Available -

Testing Profiles Available - The Clontarf Clinic Allergy Centre & Laboratory (Co. Reg No. 383229) The Clontarf Clinic 63 Clontarf Road Clontarf Dublin 3 Berkeley Allergy Clinic (Wednesday) 12 Berkeley Road Dublin 7 Tel: 01 8338207

More information

Allergy IgE Allergy Test Sensitivity and Specificity 6/23/17

Allergy IgE Allergy Test Sensitivity and Specificity 6/23/17 Allergy IgE Allergy Test Sensitivity and Specificity 6/23/17 1 Sensitivity and Specificity Benchmarking Goal Test pooled human sera with known positive and negative reactivity to determine Allergy sensitivity

More information

Human Apolipoprotein A1 EIA Kit

Human Apolipoprotein A1 EIA Kit A helping hand for your research Product Manual Human Apolipoprotein A1 EIA Kit Catalog Number: 83901 96 assays 1 Table of Content Product Description 3 Assay Principle 3 Kit Components 3 Storage 4 Reagent

More information

IN SCHOOL ARTICLE Vitamin D3 Blocks NFkB Activation in an In Vitro Model of Cystic Fibrosis

IN SCHOOL ARTICLE Vitamin D3 Blocks NFkB Activation in an In Vitro Model of Cystic Fibrosis IN SCHOOL ARTICLE Vitamin D3 Blocks NFkB Activation in an In Vitro Model of Cystic Fibrosis Andrea Maria Vargas Guerra 1 * and Christine Marshall-Walker 2 Student 1, Teacher 2 : Phillips Academy, 180 Main

More information

Fungal exposure, atopy and asthma exacerbations in Puerto Rican children ONLINE DATA SUPPLEMENT

Fungal exposure, atopy and asthma exacerbations in Puerto Rican children ONLINE DATA SUPPLEMENT Fungal exposure, atopy and asthma exacerbations in Puerto Rican children ONLINE DATA SUPPLEMENT Joshua Blatter, MD 1, Erick Forno, MD, MPH 1, John Brehm, MD, MPH 1, Edna Acosta- Pérez, PhD 2, María Alvarez,

More information

Supplementary figure legends

Supplementary figure legends Supplementary figure legends Supplementary Figure 1. Exposure of CRT occurs independently from the apoptosisassociated loss of the mitochondrial membrane potential (MMP). (A) HeLa cells treated with MTX

More information

APPENDIX 1 ETHICAL CLEARANCE

APPENDIX 1 ETHICAL CLEARANCE APPENDIX 1 ETHICAL CLEARANCE 75 APPENDIX 2 76 PROCEDURE FOR PREPARING OF LIVER HISTOLOGY SLIDES Overview: Histology involves the use of a set of techniques to examine the morphology, architecture and composition

More information

Citation Acta Medica Nagasakiensia. 1992, 37

Citation Acta Medica Nagasakiensia. 1992, 37 NAOSITE: Nagasaki University's Ac Title Author(s) A Study on the Expression of EGFR a Content in the Stomach Cancer Tissu Nakazaki Takayuki Citation Acta Medica Nagasakiensia. 1992 37 Issue Date 1992-12-25

More information

Bead Based Assays for Cytokine Detection

Bead Based Assays for Cytokine Detection Bead Based Assays for Cytokine Detection September 27, 2014 6 th EFIS-EJI South East European Immunology School SEEIS 2014 Timisoara, Romania The Cells of the Immune System The Immune Reaction (Th2) (Th1)

More information

Assay Name: Transwell migration using DAPI

Assay Name: Transwell migration using DAPI Assay Name: Transwell migration using DAPI Assay ID: Celigo_04_0001 Table of Contents Experiment: Identification of cells which have migrated through the membrane of a transwell insert....2 Celigo Setup...2

More information

Effects of VEGF/VEGFR/K-ras signaling pathways on mirna21 levels in hepatocellular carcinoma tissues in rats

Effects of VEGF/VEGFR/K-ras signaling pathways on mirna21 levels in hepatocellular carcinoma tissues in rats Effects of VEGF/VEGFR/K-ras signaling pathways on mirna21 levels in hepatocellular carcinoma tissues in rats J.Z. Gao 1,2 *, Y.L. Wang 1 *, J. Li 2 and L.X. Wei 2 1 Medical College, Xinxiang Medical University,

More information

For the isolation of mitochondria from P. pastoris and other species of yeast

For the isolation of mitochondria from P. pastoris and other species of yeast ab178779 Mitochondrial Yeast Isolation Kit Instructions for Use For the isolation of mitochondria from P. pastoris and other species of yeast This product is for research use only and is not intended for

More information

Characterization and significance of MUC1 and c-myc expression in elderly patients with papillary thyroid carcinoma

Characterization and significance of MUC1 and c-myc expression in elderly patients with papillary thyroid carcinoma Characterization and significance of MUC1 and c-myc expression in elderly patients with papillary thyroid carcinoma Y.-J. Hu 1, X.-Y. Luo 2, Y. Yang 3, C.-Y. Chen 1, Z.-Y. Zhang 4 and X. Guo 1 1 Department

More information

Differences in Airway Cytokine Profile in Severe Asthma Compared to Moderate Asthma*

Differences in Airway Cytokine Profile in Severe Asthma Compared to Moderate Asthma* Original Research ASTHMA Differences in Airway Cytokine Profile in Severe Compared to Moderate * Joanne Shannon, MD; Pierre Ernst, MD; Yasuhiro Yamauchi, MD; Ronald Olivenstein, MD; Catherine Lemiere,

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

MAST CELLS IN AIRWAY SMOOTH MUSCLE IN ASTHMA MAST-CELL INFILTRATION OF AIRWAY SMOOTH MUSCLE IN ASTHMA. Study Subjects

MAST CELLS IN AIRWAY SMOOTH MUSCLE IN ASTHMA MAST-CELL INFILTRATION OF AIRWAY SMOOTH MUSCLE IN ASTHMA. Study Subjects MAST-CELL INFILTRATION OF AIRWAY SMOOTH MUSCLE IN ASTHMA CHRISTOPHER E. BRIGHTLING, M.B., B.S., PETER BRADDING, D.M., FIONA A. SYMON, PH.D., STEPHEN T. HOLGATE, M.D., D.SC., ANDREW J. WARDLAW, PH.D., AND

More information

Chronic cough is defined as a cough persisting for. Airway Inflammation as an Assessment of Chronic Nonproductive Cough*

Chronic cough is defined as a cough persisting for. Airway Inflammation as an Assessment of Chronic Nonproductive Cough* Airway Inflammation as an Assessment of Chronic Nonproductive Cough* Sang Yeub Lee, MD ; Jae Youn Cho, MD; Jae Jeong Shim, MD; Han Kyeom Kim, MD; Kyung Ho Kang, MD, FCCP; Se Hwa Yoo, MD; and Kwang Ho In,

More information

RNA/DNA Stabilization Reagent for Blood/Bone Marrow

RNA/DNA Stabilization Reagent for Blood/Bone Marrow For general laboratory use. Not for use in diagnostic procedures. FOR IN VITRO USE ONLY. RNA/DNA Stabilization Reagent for Blood/Bone Marrow For simultaneous cell lysis and stabilization of nucleic acids

More information