Soluble ADAM33 initiates airway remodeling to promote susceptibility for. Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David I Wilson,
|
|
|
- Candice Jones
- 5 years ago
- Views:
Transcription
1 Revised Suppl. Data: Soluble ADAM33 1 Soluble ADAM33 initiates airway remodeling to promote susceptibility for allergic asthma in early life Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David I Wilson, Stephen T. Holgate, Donna E. Davies, Jeffrey A. Whitsett, Hans Michael Haitchi Supplemental data
2 Revised Suppl. Data: Soluble ADAM33 2 Supplemental Table 1. Subject characteristics of bronchoalveolar lavage fluid (BALF) groups. Healthy Asthma Subjects (n=5) (n=10) Age, yrs 19 (19-21) 42 (21-69)* Male/Female 4/1 3/7 Atopy 0 6 FEV1% predicted 96 (83-101) 70 (30-101)* SABA N/A 10 ICS N/A 7 LABA N/A 7 OCS N/A 2 Other meds N/A 3 Eosinophilic only 1 2 Neutrophilic only 0 3 Eosin.+Neutr. 0 4 Neither 4 1 * Unpaired Student s t-test with Welch's correction (P < 0.05) Number of patients with eosinophilic ( 1%), neutrophilic ( 5%) or both inflammation in bronchoalveolar lavage fluid (BALF) Inhaled short-acting ß2-agonists (SABA), Inhaled corticosteroids (ICS), Inhaled long-acting ß2-agonists (LABA), Oral steroids (OCS), Other medications (Other meds), not applicable (N/A)
3 Revised Suppl. Data: Soluble ADAM33 3 Supplemental Figure 1: Increased soluble ADAM33 (sadam33) Pro- Metalloprotease in bronchoalveolar lavage fluid (BALF) in human asthma. (A) Western blotting of BALF proteins from healthy (n=5) and asthmatic (n=10) subjects using an antibody recognizing the Pro domain of human ADAM33; representative blots are shown. (B) Combined ADAM33 immunoreactive bands (at ~52-76kDa) were analyzed by densitometry in arbitrary units (AU) (Mann Whitney test). Box plots show medians and 25th to 75th percentiles, and whiskers min to max/all points. Full unedited Western blots are available in the Supplemental Material.
4 Revised Suppl. Data: Soluble ADAM33 4 Supplemental Figure 2: ADAM33 metalloprotease (MP) and pro domain (Pro) antibodies do not crossreact with ADAM8 or ADAM12. (A,B,C) Dot blots of 100, 75, 50, 25 and 0 ng recombinant ADAM8, ADAM12 (both with a polyhistidine (HIS) tag) and ADAM33 blotted with antibodies against (A) ADAM33-MP, (B) ADAM-Pro and (C) HIS tag.
5 Revised Suppl. Data: Soluble ADAM33 5 Supplemental Figure 3: Mouse model of house dust mite (HDM)-induced allergic airway inflammation Protocol for intra-peritoneal (i.p.) sensitization (S) of 6-8 week old mice at day 0 and day 7 and intra-tracheal (i.t.) challenges with Saline (Sal) or HDM extract in saline (HDM) on day 14 and 19. Harvesting (Harvest) of mouse bronchoalveolar lavage fluid (BALF) and lung tissue (Harvest), on day after first sensitization.
6 Revised Suppl. Data: Soluble ADAM33 6
7 Revised Suppl. Data: Soluble ADAM33 7 Supplemental Figure 4: Generation of the human sadam33 double transgenic (Ccsp/ADAM33) mouse model. (A) Diagram of the full length ADAM33 protein domain structure, the corresponding mrna exonic structure and the cdna used for cloning sadam33 which contains the signal sequence (SS), pro-domain (PRO) and metalloprotease (MP) domain. (B-F) Plasmid constructs and steps for generation of the linearized TRES-hADAM33-SS-PRO-MP-3Flag DNA construct for microinjection into pro-nuclei from FVB/N mice. (G) Ccsp-rtTA mice line 2 were crossed with founder mice containing the tetracycline response element 2- ADAM33-PRO-MP (TRES-ADAM33-PRO-MP) to generate Doxycycline (Dox)- inducible double transgenic mice expressing human soluble ADAM33 (Ccsp/ADAM33). (H) Agarose gel electrophoresis of PCR products from CcsprtTA (440 base pairs (bp)) or ADAM33-PRO-MP (636 bp) transgenes. Results from DNA of single (STg; Ccsp-rtTA or ADAM33-PRO-MP) or double transgenic (DTg; Ccsp/ADAM33) mice, and negative (H2O) and positive control DNAs are shown.
8 Revised Suppl. Data: Soluble ADAM33 8 Supplemental Figure 5: Expression of sadam33 does not induce airway inflammation or airway resistance. (A) Six to eight week old double transgenic (DTg) Ccsp/ADAM33 (n=8-12) and single transgenic (STg) litter-mate control (n=8-10) mice were fed on Dox diet for 8 weeks. (B) shows differential inflammatory cell counts for macrophages (M ), lymphocytes (Ly), neutrophils (Neu) and eosinophils (Eo) in bronchoalveolar lavage fluid (BALF) from adult DTg Ccsp/ADAM33 or STg control mice (n=8 per group) for 8 weeks on Dox diet; (C) shows airway resistance in response to increasing concentrations of methacholine (Me) in phosphate buffered saline (PBS) in adult DTg Ccsp/ADAM33 (n=12) and litter STg control (n=10) mice. (D) DTg Ccsp/ADAM33 (n=6-13) and STg litter-mate control (n=6-8) were fed on Dox from in utero until 4 weeks post partum to induce transgene expression. (E) shows differential inflammatory cell counts in BALF from young DTg Ccsp/ADAM33 or STg control mice on Dox from in utero for 4 weeks (n=6 per group); (F) shows airway resistance in response to increasing concentrations of methacholine (Me) in phosphate buffered saline (PBS) in DTg Ccsp/ADAM33 (n=13) and litter STg control (n=8) in 4 week old mice on Dox from in utero (twoway ANOVA, Tukey s multiple comparison test). Results are from 3 independent experiments (B,C,E,F).
9 Revised Suppl. Data: Soluble ADAM33 9 Supplemental Figure 6: Adam33 mrna expression in wild type, heterozygous and Adam33 -/- mice. Relative mrna expression of Adam33 in whole lung lysates from wild-type (WT), heterozygous (Adam33 +/- ) and ADAM33 knock out (Adam33 -/- ) mice (n=9/group) was determined by reverse transcription quantitative PCR (RT-qPCR) analysis.
10 Revised Suppl. Data: Soluble ADAM33 10 Supplemental Figure 7: Bronchoalveolar lavage fluid (BALF) enzymatic activity and airway resistance are decreased in Adam33 -/- mice following HDM challenge. Wild-type (WT), heterozygote (Adam33 +/- ) and ADAM33 knock out (Adam33 -/- ) mice were sensitized and challenged with saline or house dust mite extract HDM following the standard protocol. (A) shows ADAM33 enzymatic activity measured using an ADAM33-selective fluorescence resonance energy transfer (FRET) peptide cleavage assay using BALF from mice after HDM or saline challenge as indicated (n = 3/group) (two-way ANOVA, Tukey s multiple comparison test). Data are expressed as mean ± s.d. Results are from 1 experiment (B). (B) shows airway resistance in response to increasing concentrations of methacholine in PBS measured using the forced oscillation technique in anesthetized mice after HDM or saline challenge as indicated (n=9 per group) (one-way ANOVA, Tukey s multiple comparison test). Data are expressed as medians, boxes 25th to 75th percentiles and whiskers min to max/all points. Results are from 3 independent experiments (B
11 Revised Suppl. Data: Soluble ADAM33 11 Supplemental Figure 8: IL13 challenge model and concentration dependence of house dust mite extract (HDM) on bronchial hyperresponsiveness (BHR) and eosinophilic inflammation. (A) Ccsp/ADAM33 mice were mated and double transgenic (DTg) Ccsp/ADAM33 and single transgenic (STg) litter-mate control offspring mice were on Doxycycline (Dox) diet from in utero until day 42 after birth to induce transgene expression; they were then challenged with saline (Sal) or 5 μg of murine IL13 by intra-tracheal (i.t.) installation and harvest of lung tissue after 24 hours (n=4 per group). (B-E) Wild-type mice were sensitized and challenged with saline or 6.25, 12.5 or 25 μg of HDM in saline (n=3 per group) following the standard protocol. (B) shows airway resistance in response to increasing concentrations of methacholine in PBS measured using the forced oscillation technique in anesthetized mice after HDM or saline challenge as indicated; (C) shows differential inflammatory cell count for eosinophils (Eo) in bronchoalveolar lavage fluid (BALF) from mice after HDM or saline challenge as indicated (one-way ANOVA, Tukey s multiple comparison test). (D,E) shows mrna expression
12 Revised Suppl. Data: Soluble ADAM33 12 measured by reverse transcription quantitative PCR (RT-qPCR )using whole lung lysates from mice after HDM or saline challenge as indicated: (D) Ccl11/Eotaxin and (E) Muc5ac (one-way ANOVA, Tukey s multiple comparison test). Data are expressed as mean ± s.d. Results are from 1 experiment (B-E).
13 Revised Suppl. Data: Soluble ADAM33 13 Supplemental Figure 9: Increased airway responsiveness after exposure to a low concentration of house dust mite extract (HDM) allergen in human soluble ADAM33 (sadam33) expressing transgenic mice. (A) Double transgenic (DTg) Ccsp/ADAM33 (n=9/group) and single transgenic (STg) litter-mate control (n=9/group) mice were fed on Doxycycline (Dox) diet for 6 weeks to induce transgene expression; they were then sensitized and challenged with 6.25 μg of HDM or saline. (B,C) show airway resistance in response to increasing concentrations of methacholine (Me) in PBS measured using the forced oscillation technique in anesthetized mice after HDM or saline challenge as indicated (two-way ANOVA, Tukey s multiple comparison test). Data are expressed as mean ± s.d. Results are from 3 independent experiments (B and C).
14 Revised Suppl. Data: Soluble ADAM33 14 Supplemental Figure 10: ADAM33 expression is arrested after 28 days on and 28 days off Doxycycline (Dox). (A) Double transgenic (DTg) Ccsp/ADAM33 and single transgenic (STg) littermate control were fed on Dox from in utero until 28 and 56 days post partum to induce transgene expression. In one group Dox was stopped for 28 days to arrest transgene expression. (B) shows reverse transcription quantitative PCR (RT-qPCR) for ADAM33 mrna expression in whole lungs from DTg Ccsp/ADAM33 or STg control mice on Dox from in utero for 28 (light gray boxes) and 56 days (dark gray boxes) and 28 days on followed by 28days off Dox (white boxes) (n=9 per group) (two-way ANOVA, Tukey s multiple comparison test). Results are from 2 independent experiments (B).
15 Unedited Western blots: Soluble ADAM33 1 Full unedited blots for Figure 1A (top) & Supplementary Figure 1A (bottom):
16 Unedited Western blots: Soluble ADAM33 2 Full unedited blot for Figure 1D:
17 Unedited Western blots: Soluble ADAM33 3 Full unedited Ponceau stain and blot for Figure 2D:
Soluble ADAM33 initiates airway remodeling to promote susceptibility for allergic asthma in early life
Soluble ADAM33 initiates airway remodeling to promote susceptibility for allergic asthma in early life Elizabeth R. Davies, 1,2 Joanne F.C. Kelly, 1 Peter H. Howarth, 3,4 David I. Wilson, 4,5 Stephen T.
Supplementary Information
Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1
Soluble ADAM33 initiates airway remodeling to promote susceptibility for. Faculty of Medicine, University of Southampton, Southampton, United Kingdom
Rev. Research Manuscript: Soluble ADAM33 1 Soluble ADAM33 initiates airway remodeling to promote susceptibility for allergic asthma in early life Elizabeth R. Davies 1,2, Joanne F.C. Kelly 1, Peter H.
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 NLRP12 is downregulated in biopsy samples from patients with active ulcerative colitis (UC). (a-g) NLRP12 expression in 7 UC mrna profiling studies deposited in NCBI GEO database.
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
Role of Tyk-2 in Th9 and Th17 cells in allergic asthma
Supplementary File Role of Tyk-2 in Th9 and Th17 cells in allergic asthma Caroline Übel 1*, Anna Graser 1*, Sonja Koch 1, Ralf J. Rieker 2, Hans A. Lehr 3, Mathias Müller 4 and Susetta Finotto 1** 1 Laboratory
Supplementary Figure 1
d f a IL7 b IL GATA RORγt h HDM IL IL7 PBS Ilra R7 PBS HDM Ilra R7 HDM Foxp Foxp Ilra R7 HDM HDM Ilra R7 HDM. 9..79. CD + FOXP + T reg cell CD + FOXP T conv cell PBS Ilra R7 PBS HDM Ilra R7 HDM CD + FOXP
Supplementary table I. Real-time primers used in the study. The fold change was obtained by
Supplementary table I. Real-time primers used in the study. The fold change was obtained by normalizing the gene expression number to those of HPRT, then comparing the samples to untreated or naive mice.
B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN
B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification
Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic
Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic Reticulum Stress Lokesh Makhija, BE, Veda Krishnan, MSc, Rakhshinda Rehman, MTech, Samarpana Chakraborty, MSc, Shuvadeep Maity,
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
COPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic
COPD lungs show an attached stratified mucus layer that separate bacteria from the epithelial cells resembling the protective colonic mucus SUPPLEMENTARY TABLES AND FIGURES Tables S1 S8, page 1 and separate
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)
Life-long asthma and its relationship to COPD. Stephen T Holgate School of Medicine University of Southampton
Life-long asthma and its relationship to COPD Stephen T Holgate School of Medicine University of Southampton Definitions COPD is a preventable and treatable disease with some significant extrapulmonary
Asthma Pathophysiology and Treatment. John R. Holcomb, M.D.
Asthma Pathophysiology and Treatment John R. Holcomb, M.D. Objectives Definition of Asthma Epidemiology and risk factors of Asthma Pathophysiology of Asthma Diagnostics test of Asthma Management of Asthma
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al
Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al Suppl. Fig. 1 Tissue DN C Proteins kd TSC1-17 TSC 1 loxp bp -48-285 ctin PEMs Neutrophils
Supplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
Eosinophils! 40! 30! 20! 10! 0! NS!
A Macrophages Lymphocytes Eosinophils Neutrophils Percentage (%) 1 ** 4 * 1 1 MMA SA B C Baseline FEV1, % predicted 15 p = 1.11 X 10-9 5 CD4:CD8 ratio 1 Supplemental Figure 1. Cellular infiltrate in the
Neonatal Exposure to Microbial Phosphorylcholine Modulates the Development of House Dust Mite Allergy During Adult Life
Neonatal Exposure to Microbial Phosphorylcholine Modulates the Development of House Dust Mite Allergy During Adult Life J. Sides SEM Preeyam Patel Mentor: Dr John Kearney 015 CAMBAC Research Day 9/18/15
Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice
Supplementary Information Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice Gou Takahashi, Channabasavaiah B Gurumurthy,
CHAPTER 5 RESULTS Previous study: cell culture and organotypical slices
45 CHAPTER 5 RESULTS 5.1. Previous study: cell culture and organotypical slices Initial experiments have been conducted to ensure that the tet-on system works. A neuronal cell culture from mice expressing
Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
Nature Medicine: doi: /nm.3922
Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun
Senior Thesis. Presented to. The Faculty of the School of Arts and Sciences Brandeis University
Greenwald 1 Mouse intercellular adhesion molecule 1 (ICAM-1) isoforms demonstrate different binding affinities to mouse macrophage-1 antigen (Mac-1) and preliminary evidence for alternatively-spliced variants
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment
SUPPLEMENTAL INFORMATION Supplemental Methods Generation of RyR2-S2808D Mice Murine genomic RyR2 clones were isolated from a 129/SvEvTacfBR λ-phage library (Stratagene, La Jolla, CA) (Supplemental Fig.
Asthma Phenotypes, Heterogeneity and Severity: The Basis of Asthma Management
Asthma Phenotypes, Heterogeneity and Severity: The Basis of Asthma Management Eugene R. Bleecker, MD Professor and Director, Center for Genomics & Personalized Medicine Research Professor, Translational
IL-13 Augments Compressive Stress-induced Tissue Factor Expression in Human Airway Epithelial Cells
IL-13 Augments Compressive Stress-induced Tissue Factor Expression in Human Airway Epithelial Cells Jennifer A. Mitchel, Silvio Antoniak, Joo-Hyeon Lee, Sae-Hoon Kim, Maureen McGill, David I. Kasahara,
Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.
Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G
Searching for Targets to Control Asthma
Searching for Targets to Control Asthma Timothy Craig Distinguished Educator Professor Medicine and Pediatrics Penn State University Hershey, PA, USA Inflammation and Remodeling in Asthma The most important
Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.
IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE
Allergy and Immunology Review Corner: Chapter 75 of Middleton s Allergy Principles and Practice, 7 th Edition, edited by N. Franklin Adkinson, et al.
Allergy and Immunology Review Corner: Chapter 75 of Middleton s Allergy Principles and Practice, 7 th Edition, edited by N. Franklin Adkinson, et al. Chapter 75: Approach to Infants and Children with Asthma
Age-related changes of IgE-mediated allergic reaction in patients with late onset asthma.
50 Changes in IgE-mediated allergic reaction with aglllg Age-related changes of IgE-mediated allergic reaction in patients with late onset asthma. Fumihiro Mitsunobu, Takashi Mifune, Yasuhiro Hosaki, Kouzou
Potent and Selective CRTh2 Antagonists are Efficacious in Models of Asthma, Allergic Rhinitis and Atopic Dermatitis
Potent and Selective CRTh2 Antagonists are Efficacious in Models of Asthma, Allergic Rhinitis and Atopic Dermatitis Laura L. Carter, Yoshi Shiraishi, Yooseob Shin, Laurence Burgess, Christine Eberhardt,
NMED-A65251A. Supplementary Figures.
NMED-A65251A Supplementary Figures. Sup. Fig. 1. ILC3 cells are the main source of in obese mice a. We gated on T cells (upper panels) or T cells (lower panels), and examined production. b. CD45 + - IL-13
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)
Immunology of Asthma. Kenneth J. Goodrum,Ph. Ph.D. Ohio University College of Osteopathic Medicine
Immunology of Asthma Kenneth J. Goodrum,Ph Ph.D. Ohio University College of Osteopathic Medicine Outline! Consensus characteristics! Allergens:role in asthma! Immune/inflammatory basis! Genetic basis!
Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.
competes with 20S proteasome for binding with C/EBP leading to its stabilization and Relative mrna levels Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT)
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
Impact of Asthma in the U.S. per Year. Asthma Epidemiology and Pathophysiology. Risk Factors for Asthma. Childhood Asthma Costs of Asthma
American Association for Respiratory Care Asthma Educator Certification Prep Course Asthma Epidemiology and Pathophysiology Robert C. Cohn, MD, FAARC MetroHealth Medical Center Cleveland, OH Impact of
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/3/114/ra23/dc1 Supplementary Materials for Regulation of Zap70 Expression During Thymocyte Development Enables Temporal Separation of CD4 and CD8 Repertoire Selection
Supplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya
Expanded View Figures
Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and
Supplementary Information. Paired immunoglobulin-like receptor A is an intrinsic, self-limiting
Supplementary Information Paired immunoglobulin-like receptor A is an intrinsic, self-limiting suppressor of IL-5-induced eosinophil development Netali Ben Baruch-Morgenstern 1,4, Dana Shik 1,4, Itay Moshkovits
Supplementary Figure 1
Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with
Differentiation-induced Changes of Mediterranean Fever Gene (MEFV) Expression in HL-60 Cell
Differentiation-induced Changes of Mediterranean Fever Gene (MEFV) Expression in HL-60 Cell Wenxin Li Department of Biological Sciences Fordham University Abstract MEFV is a human gene that codes for an
Nature Immunology: doi: /ni Supplementary Figure 1. IC261 inhibits a virus-induced type I interferon response.
Supplementary Figure 1 IC261 inhibits a virus-induced type I interferon response. (a) HEK293T cells were cultured in 384 wells and transiently transfected with 50 ng of the IFN-β promoter-luc construct
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
SUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces
The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the
Supplementary Figure 1. LAG3 + Treg-mediated regulation of germinal center B cells and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the experimental protocol for the
CD4 + and CD8 + T cells play a central role in a HDM driven model of allergic asthma
Raemdonck et al. Respiratory Research (2016)17:45 DOI 10.1186/s12931-016-0359-y RESEARCH CD4 + and CD8 + T cells play a central role in a HDM driven model of allergic asthma Open Access Kristof Raemdonck
GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel
Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György
Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines
CORRECTION NOTICE Nat. Med. doi:10.1038/nm.3547; corrected online 25 August 2014 Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Christine Schauer, Christina
fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
IgE-mediated allergy in elderly patients with asthma
Allergology international (1997) 46: 237-241 Original Article IgE-mediated allergy in elderly patients with asthma Fumihiro Mitsunobu, Takashi Mifune, Yasuhiro Hosaki, Kouzou Ashida, Hirofumi Tsugeno,
Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.
Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times. Western blots shown are representative results from 3 independent
Sponsor. Generic drug name. Trial indication(s) Protocol number. Protocol title. Clinical trial phase. Study Start/End Dates.
Sponsor Novartis Generic drug name Fluticasone propionate Trial indication(s) Moderate-severe bronchial asthma Protocol number CQAE397A2202 Protocol title A randomized open label study to assess the utility
Allergic diseases and treatment. Feng Qian ( 钱峰 )
Allergic diseases and treatment Feng Qian ( 钱峰 ) fengqian@sjtu.edu.cn Hypersensitivity Antigen Host Adaptive responses protective to the host harmful to the host The deleterious consequences of the adaptive
Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.
1 Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. (a) Survival curves. WT Sham (n=5), WT CLP or WT CLP antibiotic
Abnormal Spirometry Medical Risk in Aviation Conference Royal Aeronautical Society, Dec 2017
Abnormal Spirometry Medical Risk in Aviation Conference Royal Aeronautical Society, Dec 2017 Professor Howard Branley MBChB MSc MD FCCP FRCP FRAeS Consultant in Respiratory Medicine What I want to cover
Supplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
Supplementary Figure 1. c Human
Supplementary Figure 1 a b c Human Mouse d Gapdh Amino acid sequence and baseline expression of MYDGF N-terminal signal peptides (S-scores) and signal peptide cleavage sites (C-scores) of (a) human MYDGF
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
DR REBECCA THOMAS CONSULTANT RESPIRATORY PHYSICIAN YORK DISTRICT HOSPITAL
DR REBECCA THOMAS CONSULTANT RESPIRATORY PHYSICIAN YORK DISTRICT HOSPITAL Definition Guidelines contact complicated definitions Central to this is Presence of symptoms Variable airflow obstruction Diagnosis
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/430/ra57/dc1 Supplementary Materials for The 4E-BP eif4e axis promotes rapamycinsensitive growth and proliferation in lymphocytes Lomon So, Jongdae Lee, Miguel
Supplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
The independent effects of vitamin D deficiency and house dust mite exposure on lung function are sexspecific
www.nature.com/scientificreports Received: 8 August 2017 Accepted: 27 October 2017 Published: xx xx xxxx OPEN The independent effects of vitamin D deficiency and house dust mite exposure on lung function
Abhd2 regulates alveolar type Ⅱ apoptosis and airway smooth muscle remodeling: a key target of COPD research
Abhd2 regulates alveolar type Ⅱ apoptosis and airway smooth muscle remodeling: a key target of COPD research Shoude Jin Harbin Medical University, China Background COPD ------ a silent killer Insidious,
293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,
SUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%
FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence
1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
![1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]](/thumbs/87/97258189.jpg "1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]")
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
Abstract. IgE. IgE Th2. x x IL-4 IL-5 IgE CD4 +
D. o ƒf 6,''!" # + % %$ '& ' '' & " k n k x k k k k k x k IgE k x IgE Ò1Ó k Ò2Ó v k x IgE Th2 x } x x IL-4 IL-5 IgE IgE j IFN-γ IgG j j CD4 + { k d «d j B7 w k k x IgE k 1 k Abstract Parental immunization
The clathrin adaptor Numb regulates intestinal cholesterol. absorption through dynamic interaction with NPC1L1
The clathrin adaptor Numb regulates intestinal cholesterol absorption through dynamic interaction with NPC1L1 Pei-Shan Li 1, Zhen-Yan Fu 1,2, Ying-Yu Zhang 1, Jin-Hui Zhang 1, Chen-Qi Xu 1, Yi-Tong Ma
FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells
Supplementary Figure Legends FIG S1 Examination of expression after virus infection. () 549 cells were infected with herpes simplex virus (HSV) (MOI = 1), and harvested at the indicated times, followed
Supplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
Supplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented