Patterns of Single-Gene Inheritance Cont.

Transcription

1 Genetic Basis of Disease Patterns of Single-Gene Inheritance Cont. Traditional Mechanisms Chromosomal disorders Single-gene gene disorders Polygenic/multifactorial disorders Novel mechanisms Imprinting Uniparental disomy (UPD) Parent of origin effects Mosaicism Maternal (Cytoplasmic) inheritance Unstable DNA (trinucleotide repeat disorders) Atypical Patterns of Inheritance Exceptions to mendelian inheritance do occur in single-gene gene disorders and must be considered in genetic medicine On basis of mendelian principles, a mutant allele of an autosomal gene is equally likely to be transmitted from a parent, of either sex, to an offspring of either sex Similarly, a female is equally likely to transmit a mutated X-linked X gene to a child of either sex Does the sex of the parent have any effect on the expression of the genes each parent transmit? Atypical Patterns of Inheritance In some genetic disorders, the expression of disease phenotype depends on whether the mutant allele has been inherited from the father or from the mother Differences in gene expression b/w the allele inherited from the father and that inherited from the mother are the result of genomic imprinting Imprinting is an alteration in chromatin that affects gene expression but not its DNA sequence. Thus, it is a reversible form of gene inactivation but is not a mutation Genomic Imprinting Imprinted genes Most genes are expressed equally from both paternal and maternal alleles Genomic imprinting is the epigenetic marking of a gene based on its parental origin that results in monoallelic expression Genomic imprinting differs from classical genetics in that the maternal and paternal complement of imprinted genes are not equivalent The mechanism of imprinting appears to involve a parental specific methylation of CpG-rich domains, that is reset during gametogenesis?? Approx thought to exist Involved in many aspects of development including Fetal and placental growth Cell proliferation Brain development Adult behaviour

2 Genomic imprinting and embryogenesis Haploid sperm + haploid egg normal embryo Haploid sperm + haploid sperm hydatidiform mole Haploid egg + haploid egg ovarian dermoid cyst Indicate that normal human development only proceeds when a complement of the paternal and maternal genomes is present Genomic imprinting in mammals may have evolved because of a conflict of interest between the maternal and paternal genome in regulating fetal growth Imprinting in Genetic Diseases A number of human diseases are associated with imprinting defects Diseases result from either Loss of imprinting (resulting in diallelic rather than monoallelic expression). Control over imprinting appears to be governed by a DNA element called the imprinting center,, located within the imprinted region itself. Uniparental disomy (resulting in either x2 or no expression) Imprinting changes can be either congenital, e.g. Prader-Willi syndrome, Angelman syndrome or acquired, e.g. Altered expression of growth control genes in human cancer IMPRINTED IMPRINTED: Just after fertilization, a global demethylation event occurs in the zygote, first in the paternal pronucleus, followed by the maternal pronucleus. Imprinting established during gametogenesis must resist this demethylation process. Remethylation of the diploid genome occurs post-implantation and sets secondary imprints that are maintained for the life of the individual. Prader-Willi syndrome Prader-Willi syndrome PWS is a relatively common dysmorphic syndrome characterized by obesity, excessive and indiscriminate eating habits, small hands & feet, short stature, hypogonadism, & mental retardation Genomes have genetic info in 15q12 (15q11-q13) q13) that derives only from mothers 70% have paternally derived deletion of 15q12 25% have matupd15 1-2% imprinting center mutation

3 Angelman syndrome Angelman syndrome Characterized by unusual facial appearance, short stature, severe mental retardation, spasticity, and seizures Have genetic info in 15q12 (12q11-q13) q13) derived only from father Also, E6-AP protein ligase mutation E6-AP is located in 15q12 and is normally expressed from maternal allele in the CNS 70% have maternallyderived deletion of 15q12 2% have patupd15 2-4% E6-AP ubiquitin protein ligase mutation 7-9% imprinting center mutation Imprinting Uniparental Disomy Presence of disomic cell line containing two chr s, or portions thereof, inherited from only one parent Isodisomy: if the identical chr present in duplicate Heterodisomy: if both homologs from one parent present maternally inherited allele is not expressed paternally inherited allele is not expressed Examples Cases of PWS & AS Two CF patients with short stature, inherited two identical copies of most or all of their maternal chr. 7. In both cases, the mother happened to be a carrier for CF Father-to to-son transmission of hemophilia, affected boy inherited both X & Y from father Expression of X-linked X in homozygous form in a female offspring of a carrier mother and a normal father Mosaicism Mosaicism is the presence of two or more genetically different cell lines in an individual, all derived from a single zygote Mosaicism can be for chromosomal or single gene disorders Mosaicism may affect either somatic or germline tissues Somatic Mosaicism can result in a range of abnormality depending on the amount and distribution of normal cells (e.g. mosaic Down syndrome, non-inherited cancers) Gonadal (germline) mosaicism affects the germline tissues, explains the increased risk of recurrence in disorders due to new dominant mutations

4 Somatic Mosaicism Depending on stage at which mutation occurred and lineage of somatic cell in which it originated segmented or patchy manifestation If before separation of germline from somatic mutation present in both and transmitted to offspring in complete form + expressed somatically in mosaic form NF-1 1 is sometimes segmental, parents of patient are normal, but if patient has affected child the child s phenotype is complete NF-1. Here mutation must have occurred before separation of germline from somatic cell line that carries the mutation Mutation A mutation occurring during cell proliferation, in either somatic or during gametogenesis, leads to a proportion of cells carrying the mutation Somatic mosaicism documented in many X-X linked disorders in both males and females. e.g., a case of dysfunction of hepatic urea cycle due to deficiency of ornithine transcarbamylase in a boy with unusually mild form. Molecular analysis the boy had somatic mosaicism for a deletion in OTC gene Somatic mosaicism has been reported for hemophilia A & DMD in females who transmitted the mutation and therefore must have had germline as well as somatic mosaicism Germline Mosaicism The chance that a disorder due to a new AD mutation could occur more than once in a sibship is very low, and having two occur independently in the same gene in the same family is very unlikely Given that a child has a defect due to a new AD mutation, the risk of having another child with the same defect is negligible (equivalent to population risk) In rare cases, parents who are phenotypically normal may have more than affected child. Assuming correct diagnosis (e.g., no reduced penetrance or mild expression in any of the parents), the explanation is germline mosaicism A somatic mutation occurs in a germline cell and persists in all clonal descendants of that cell proportion of gametes carries the mutation. Recall that there are ~ 30 mitotic divisions in germline cells before meiosis in female & hundreds in male. So there is a chance for mutation to occur during mitotic stages. Germline Mosaicism No previous family history of this disorder Embryo All or part of a parent s germ line is affected by a disease mutation, but the somatic cells are not

5 Germline mosaicism is well documented in ~ 6% of severe, lethal forms of the AD osteogenesis imperfecta. In which mutations in type I collagen genes lead to abnormal collagen, brittle bones, and frequent fractures Recurrence of the AD OI. Both affected children have the same point mutation in collagen gene. Their father is unaffected and has no such a mutation in DNA from examined somatic tissues Germline mosaicism has been reported for several other disorders, e.g., hemophilia A & B, & DMD The exact recurrence risk is difficult to assess because it depends on what proportion of gametes contains the mutation Apparently non-carrier parents of a child with AD or X-linked X disorder in which the occurrence of mosaicism is unknown, may also have some recurrence. These couples should be offered whatever prenatal diagnostic tests appropriate Germ-line mosaic Male who is a germ-line mosaic Mitochondrial inheritance Non-mosaic male transmitting an autosomal dominant disease One may misclassify this pedigree as having a recessive disease when in fact it s a de novo inherited disease in the affected daughter The Mitochondrial Genome The mt genome consists of a circular chr., 16.5 kb. Most cells contain at least 1000 mtdna molecules, distributed among hundreds of individual mt. Mature oocyte has more than 100,000 copies of mtdna. Mitochondrial DNA (mtdna) contains 37 genes (13 encode polypeptides, 2 rrna, and 22 trnas). Different rearrangements and point mutations identified in mtdna that can cause human disease, often involving the central nervous and musculoskeletal systems (e.g., myoclonic epilepsy with ragged-red red fibers). Mitochondrial diseases a distinctive pattern of inheritance because of three unusual features of mitochondria: replicative segregation, homoplasmy and heteroplasmy, and maternal inheritance.

6 Replicative Segregation Absence of the tightly controlled segregation. At cell division, the multiple copies of mtdna in each of the mitochondria in a cell replicate and sort randomly among newly synthesized mitochondria. The mitochondria, in turn, are distributed randomly between the two daughter cells. This process is known as replicative segregation. Homoplasmy-Heteroplasmy Heteroplasmy When a mutation arises in the mtdna, it is at first present in only one of the mtdna molecules in a mitochondrion. With replicative segregation, however, a mitochondrion containing a mutant mtdna will acquire multiple copies of the mutant molecule. With cell division, a cell containing a mixture of normal and mutant mtdnas can distribute very different proportions of mutant and wild- type mitochondrial DNA to its daughter cells. One daughter cell may, by chance, receive mitochondria that contain only a pure population of normal mtdna or a pure population of mutant mtdna (a situation known as homoplasmy). Alternatively, the daughter cell may receive a mixture of mitochondria, some with and some without mutation (heteroplasmy( heteroplasmy). Because the phenotypic expression of a mutation in mtdna depends on the relative proportions of normal and mutant mtdna in the cells making up different tissues, reduced penetrance, variable expression, and pleiotropy are all typical features of mitochondrial disorders. Homoplasmy and Heteroplasmy Figure Replicative segregation of a heteroplasmic mitochondrial mutation. tion. Random partitioning of mutant and wild-type mitochondria through multiple rounds of mitosis produces a collection of daughter cells with wide w variation in the proportion of mutant and wild-type mitochondria carried by each cell. Cell and tissue dysfunction results when the fraction of mitochondria that are carrying a mutation exceeds a threshold level. N, nucleus. Maternal Inheritance of mtdna The final mtdna is its maternal inheritance. Sperm mitochondria are generally eliminated from the embryo, so that mtdna is inherited from the mother. Maternal inheritance in the presence of heteroplasmy in the mother is associated with additional features of mtdna genetics that are of medical significance. First, the number of mtdna molecules within developing oocytes is reduced before being subsequently amplified to the huge total seen in mature oocytes. This restriction and subsequent amplification of mtdna during oogenesis is termed the mitochondrial genetic bottleneck. As might be expected, mothers with a high proportion of mutant mtdna molecules are more likely to produce eggs with a higher proportion of mutant mtdna and therefore are more likely to have clinically affected offspring than are mothers with a lower proportion. One exception to maternal inheritance occurs when the mother is heteroplasmic for deletion mutation in her mtdna; for unknown reasons, deleted mtdna molecules are generally not transmitted from clinically affected mothers to their children.

7 Mitochondrial inheritance Figure Pedigree of Leber hereditary optic neuropathy, a form of spontaneous blindness caused by a defect in mitochondrial DNA. Inheritance is only through the maternal lineage, in agreement with w the known maternal inheritance of mitochondrial DNA. No affected male transmits the disease. Complications Incomplete penetrance Variable expression Examples of mitochondrial diseases MELAS (Mitochondrial Encephalomyopathy with Lactic Acidosis and Stroke-like episodes MERRF (Myoclonic Epilepsy with Ragged Red Fibres) Leber Hereditary Optic Neuropathy (LHON) External Ophthalmoplegia Kearns-Sayre syndrome Chronic progressive external ophthalmoplegia NARP (Neurogenic weakness Ataxia with Retinitis Pigmentosa) Unstable DNA (Trinucleotide repeat disorders) Dynamic Mutations A Mutation Which Changes Upon Transmission Trinucleotide Repeat Disorders Are the Best Example Three Nucleotides Which Are Present in Increased Number e.g. CAGCAGCAGCAGCAGCAGCAGCAGCAG Trinucleotide Repeats Normal Disease Causing When Expanded Beyond a Certain Threshold Below That Threshold They Are Stable Both in Mitosis and Meiosis Beyond a Certain Number the Repeat Can Be Unstable in Meiosis ± Mitosis Location of trinucleotide expansions in humans Repeat disorders can be classified into two distinct types: The repeats are translated (type I) or not translated (type II) ATG TAA 5 3 CGGCGGCGG GAAGAAGAA CAGCAGCAG CTGCTGCTG Fragile X syndrome Friedreich Ataxia Huntington disease DRPLA SBMA SCA1 SCA2 SCA3 SCA6 SCA7 Myotonic dystrophy

8 Dynamic Mutations Intergenerational instability Repeat changes in size from parent to offspring Sex of transmitting parent important Some more unstable from father, others from mother Anticipation More severe phenotype with successive generations/ earlier onset age Best example is myotonic dystrophy Premutations Repeat size which is unstable but does not result in A phenotype Best example is fragile X syndrome Genotype-phenotype phenotype correlation For all trinucleotide repeat disorders, the larger the repeat, the t earlier the onset Cannot use the repeat size to predict phenotype with accuracy