Victor Guryev. European Research Institute for the Biology of Ageing

Size: px
Start display at page:

Download "Victor Guryev. European Research Institute for the Biology of Ageing"

Transcription

1 Victor Guryev European Research Institute for the Biology of Ageing September 29, 2014 Genomic resequencing in Medical diagnostics course Erasmus MC, Rotterdam

2 /a /g

3

4 Low coverage whole genome and deep exome sequencing of 2,500 individuals to discover 95% of variants at 1% frequency

5 [Boomsma et al, 2013] [Francioli et al, 2014] Median base coverage: 12x bp 500 bp

6

7

8 1) Twice as many bases per slide! 2) Structural information!!! SINE SINE CONTIG 1 CONTIG 2 G A Molecular haplotyping (phasing) A T Genome assembly Structural variants Better repeat coverage Profiling of transcript isoforms

9

10 [van Heesch et al, 2013] + Fosmid libraries: 40kb tags Protocol for Illumina [Williams et al 2012]

11 Average coverage: 5 WGS /site 5 WGS/site 10 WGS/site 5 WGS/s

12

13

14

15

16

17 Per individual genome (compared to reference genome) 3.7M SNPs 360k short indels (1-20bp) 5.2k medium deletions ( bp) 3.3k large deletions ( 100+ bp)

18 Q: Medium coverage de novo variants validation? A: Possible, but a lot of validation will be required because of FP due to undercovered positions in parents: 917 candidates -> 284 de novo indels; 601 candidates -> 41 de novo SVs.

19

20

21

22 Repeat content in human genome L1 Simple repeats AluYa5 AluYb8 SVA

23

24 Mechanism: polymerase errors Tool example: GATK Haplotype Caller Prevalence: up to 10% of all indels are non-simple

25 Father Mother Child Mechanism: gene conversion Tool example: assembly, discordant pairs Prevalence: currently only several cases

26 Mechanism: (retro)transposition Prevalence: very high (>13,000 MEIs in GoNL) Tool example: Mobster [Thung et al, Genome Biology 15:488]

27 Chr15: 40.85Mb Chr7: Mb to chr deletion Chr15: 40.85Mb 210 Chr7:26.24Mb 534 to chr15 Mechanism: (retro)transposition Prevalence: GoNL about 40 cases Tool example: Discordant pairs (123SV)

28

29 37kb, AF=28% ZF724 ZF257 ZF431 2 genes ZF253 ZF737 ZF100 New ZF expressed => 13 genes ZF93 ZF430 Including: FGRF1, EVC, FKBP10, PLOD2 ZF85 ZF681 ZF708 ZF675 ZF730 ZF724 ZF492 New ZF gene ZF98 ZF726 ZF728 ZF92 GO-term analysis: anomality of the limb diaphyses and bowing of the long bones ZF734 ZF429 ZF273

30 WGS Father WGS Mother WGS Child WES Father WES Mother WES Child Same methodologies are applicable for WES RD analysis: need additional correction to account for variation in enrichment Very limited sensitivity if SV breakpoint is outside of enriched area Tool examplea: GATK HaplotypeCaller, CONIFER, ExomeCNV

31 Father, WGS Mother, WGS Child, WGS Father, WES Mother, WES Child, WES Gene annotation

32 Father, WGS Mother, WGS Child, WGS ather, WES other, WES hild, WES Gene annotation

33 1. Next to the SNP world, there is a whole new world of structural alterations in our genomes. 2. Study design: # of libraries, type (PE, MP), insert sizes, read length 3. Combine methods for SV discovery: read depth, readpair, split-reads, de novo assembly 4. Do verifications ( PCR/Sanger-Seq, acgh, Enrichment -> NGS)

34 GoNL SV Team Victor Guryev UMCG Wigard Kloosterman UMCU Laurent C. Francioli UMCU Jayne Y. Hehir-Kwa UMCN Tobias Marschall CWI/MPI Alexander Schoenhuth CWI Matthijs Moed LUMC Eric-Wubbo Lameijer LUMC Abdel Abdellaoui VU Slavik Koval EMC/LUMC Joep de Ligt UMCN Najaf Amin EMC Freerk van Dijk UMCG Lennart Karssen EM/Polyomica Leon Mei LUMC Kai Ye LUMC/WASHU GoNL steering committee Paul de Bakker UMCU Dorret Boomsma VU Cornelia van Duin EMC Gert-Jan van Ommen LUMC Eline Slagboom LUMC Morris Swertz UMCG Cisca Wimenga UMCG University of Washington Fereydoun Hormozdiari Evan E. Eichler BGI Shenzen Jun Wang ERIBA, RuG, UMC Groningen Diana Spierings Marianna Bevova Rene Wardenaar Tristan de Jong Peter Lansdorp

Nature Biotechnology: doi: /nbt.1904

Nature Biotechnology: doi: /nbt.1904 Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is

More information

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.

More information

SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA. Giuseppe Narzisi, PhD Schatz Lab

SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA. Giuseppe Narzisi, PhD Schatz Lab SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA Giuseppe Narzisi, PhD Schatz Lab November 14, 2013 Micro-Assembly Approach to detect INDELs 2 Outline Scalpel micro-assembly pipeline

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection

Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin

More information

Genomic structural variation

Genomic structural variation Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural

More information

TOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY. Giuseppe Narzisi, PhD Bioinformatics Scientist

TOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY. Giuseppe Narzisi, PhD Bioinformatics Scientist TOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY Giuseppe Narzisi, PhD Bioinformatics Scientist July 29, 2014 Micro-Assembly Approach to detect INDELs 2 Outline 1 Detecting INDELs:

More information

Supplementary note: Comparison of deletion variants identified in this study and four earlier studies

Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Here we compare the results of this study to potentially overlapping results from four earlier studies

More information

CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery

CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences

More information

Analysis with SureCall 2.1

Analysis with SureCall 2.1 Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis

More information

No mutations were identified.

No mutations were identified. Hereditary High Cholesterol Test ORDERING PHYSICIAN PRIMARY CONTACT SPECIMEN Report date: Aug 1, 2017 Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA Kelly Peters Sample Medical Group 123

More information

Below, we included the point-to-point response to the comments of both reviewers.

Below, we included the point-to-point response to the comments of both reviewers. To the Editor and Reviewers: We would like to thank the editor and reviewers for careful reading, and constructive suggestions for our manuscript. According to comments from both reviewers, we have comprehensively

More information

Van test naar diagnose naar

Van test naar diagnose naar Van test naar diagnose naar V therapie op maat Marjolein Kriek, LUMC Joris Veltman, RUNMC Exome diagnostics in genetically heterogeneous disease Joris Veltman, PhD Department of Human Genetics Radboud

More information

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation

More information

CNV detection. Introduction and detection in NGS data. G. Demidov 1,2. NGSchool2016. Centre for Genomic Regulation. CNV detection. G.

CNV detection. Introduction and detection in NGS data. G. Demidov 1,2. NGSchool2016. Centre for Genomic Regulation. CNV detection. G. Introduction and detection in NGS data 1,2 1 Genomic and Epigenomic Variation in Disease group, Centre for Genomic Regulation 2 Universitat Pompeu Fabra NGSchool2016 methods: methods Outline methods: methods

More information

Structural Variation and Medical Genomics

Structural Variation and Medical Genomics Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,

More information

Illuminating the genetics of complex human diseases

Illuminating the genetics of complex human diseases Illuminating the genetics of complex human diseases Michael Schatz Sept 27, 2012 Beyond the Genome @mike_schatz / #BTG2012 Outline 1. De novo mutations in human diseases 1. Autism Spectrum Disorder 2.

More information

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

Aging as Accelerated Accumulation of Somatic Variants: Whole-Genome Sequencing of Centenarian and Middle-Aged Monozygotic Twin Pairs

Aging as Accelerated Accumulation of Somatic Variants: Whole-Genome Sequencing of Centenarian and Middle-Aged Monozygotic Twin Pairs Twin Research and Human Genetics Volume 16 Number 6 pp. 1026 1032 C The Authors 2013 doi:10.1017/thg.2013.73 Aging as Accelerated Accumulation of Somatic Variants: Whole-Genome Sequencing of Centenarian

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

NEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca

NEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca NEXT GENERATION SEQUENCING R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca SANGER SEQUENCING 5 3 3 5 + Capillary Electrophoresis DNA NEXT GENERATION SEQUENCING SOLEXA-ILLUMINA

More information

De Novo Viral Quasispecies Assembly using Overlap Graphs

De Novo Viral Quasispecies Assembly using Overlap Graphs De Novo Viral Quasispecies Assembly using Overlap Graphs Alexander Schönhuth joint with Jasmijn Baaijens, Amal Zine El Aabidine, Eric Rivals Milano 18th of November 2016 Viral Quasispecies Assembly: HaploClique

More information

CNV Detection and Interpretation in Genomic Data

CNV Detection and Interpretation in Genomic Data CNV Detection and Interpretation in Genomic Data Benjamin W. Darbro, M.D., Ph.D. Assistant Professor of Pediatrics Director of the Shivanand R. Patil Cytogenetics and Molecular Laboratory Overview What

More information

Performance Characteristics BRCA MASTR Plus Dx

Performance Characteristics BRCA MASTR Plus Dx Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Table of Contents 1. Workflow... 4 2. Performance Characteristics

More information

Reducing INDEL calling errors in whole genome and exome sequencing data.

Reducing INDEL calling errors in whole genome and exome sequencing data. Reducing INDEL calling errors in whole genome and exome sequencing data. Han Fang November 8, 2014 CSHL Biological Data Science Meeting Acknowledgments Lyon Lab Yiyang Wu Jason O Rawe Laura J Barron Max

More information

Global variation in copy number in the human genome

Global variation in copy number in the human genome Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)

More information

MPS for translocations

MPS for translocations MPS for translocations Filip Van Nieuwerburgh, Ph.D. Lab of Pharmaceutical Biotechnology NXTGNT massively parallel sequencing facility, Ghent University In collaboration with: Center for Medical Genetics,

More information

Accel-Amplicon Panels

Accel-Amplicon Panels Accel-Amplicon Panels Amplicon sequencing has emerged as a reliable, cost-effective method for ultra-deep targeted sequencing. This highly adaptable approach is especially applicable for in-depth interrogation

More information

Cytogenetics 101: Clinical Research and Molecular Genetic Technologies

Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these

More information

Aging as Accelerated Accumulation of Somatic Variants: Whole-Genome Sequencing of Centenarian and Middle-Aged Monozygotic Twin Pairs

Aging as Accelerated Accumulation of Somatic Variants: Whole-Genome Sequencing of Centenarian and Middle-Aged Monozygotic Twin Pairs Twin Research and Human Genetics Volume 16 Number 6 pp. 1026 1032 C The Authors 2013 doi:10.1017/thg.2013.73 Aging as Accelerated Accumulation of Somatic Variants: Whole-Genome Sequencing of Centenarian

More information

PSSV User Manual (V1.0)

PSSV User Manual (V1.0) PSSV User Manual (V1.0) 1. Introduction A novel pattern-based probabilistic approach, PSSV, is developed to identify somatic structural variations from WGS data. Specifically, discordant and concordant

More information

DNA-seq Bioinformatics Analysis: Copy Number Variation

DNA-seq Bioinformatics Analysis: Copy Number Variation DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq

More information

RNA SEQUENCING AND DATA ANALYSIS

RNA SEQUENCING AND DATA ANALYSIS RNA SEQUENCING AND DATA ANALYSIS Length of mrna transcripts in the human genome 5,000 5,000 4,000 3,000 2,000 4,000 1,000 0 0 200 400 600 800 3,000 2,000 1,000 0 0 2,000 4,000 6,000 8,000 10,000 Length

More information

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate

More information

Calling DNA variants SNVs, CNVs, and SVs. Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017

Calling DNA variants SNVs, CNVs, and SVs. Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017 1 Calling DNA variants SNVs, CNVs, and SVs Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017 Calling DNA variants SNVs, CNVs, SVs 2 1. What is a variant? 2. Paired End read

More information

26 th International Workshop on Methodology for Human Genomic Studies: the Advanced course

26 th International Workshop on Methodology for Human Genomic Studies: the Advanced course 26 th International Workshop on Methodology for Human Genomic Studies: the Advanced course Ben Neale (co-director) Goncalo Abecasis(co-director) Jeff Barrett David Evans Pak Sham Lindon Eaves Mike Neale

More information

PSSV User Manual (V2.1)

PSSV User Manual (V2.1) PSSV User Manual (V2.1) 1. Introduction A novel pattern-based probabilistic approach, PSSV, is developed to identify somatic structural variations from WGS data. Specifically, discordant and concordant

More information

Global assessment of genomic variation in cattle by genome resequencing and high-throughput genotyping

Global assessment of genomic variation in cattle by genome resequencing and high-throughput genotyping RESEARCH ARTICLE Open Access Global assessment of genomic variation in cattle by genome resequencing and high-throughput genotyping Bujie Zhan 1, João Fadista 1, Bo Thomsen 1, Jakob Hedegaard 1,2, Frank

More information

Variant Detection & Interpretation in a diagnostic context. Christian Gilissen

Variant Detection & Interpretation in a diagnostic context. Christian Gilissen Variant Detection & Interpretation in a diagnostic context Christian Gilissen c.gilissen@gen.umcn.nl 28-05-2013 So far Sequencing Johan den Dunnen Marja Jakobs Ewart de Bruijn Mapping Victor Guryev Variant

More information

Single-cell RNA sequencing identifies celltypespecific cis-eqtls and co-expression QTLs

Single-cell RNA sequencing identifies celltypespecific cis-eqtls and co-expression QTLs SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41588-018-0089-9 In the format provided by the authors and unedited. Single-cell RNA sequencing identifies celltypespecific cis-eqtls and co-expression

More information

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department

More information

CITATION FILE CONTENT/FORMAT

CITATION FILE CONTENT/FORMAT CITATION For any resultant publications using please cite: Matthew A. Field, Vicky Cho, T. Daniel Andrews, and Chris C. Goodnow (2015). "Reliably detecting clinically important variants requires both combined

More information

NGS panels in clinical diagnostics: Utrecht experience. Van Gijn ME PhD Genome Diagnostics UMCUtrecht

NGS panels in clinical diagnostics: Utrecht experience. Van Gijn ME PhD Genome Diagnostics UMCUtrecht NGS panels in clinical diagnostics: Utrecht experience Van Gijn ME PhD Genome Diagnostics UMCUtrecht 93 Gene panels UMC Utrecht Cardiovascular disease (CAR) (5 panels) Epilepsy (EPI) (11 panels) Hereditary

More information

Genome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl.

Genome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl. GenomeVIP: the Genome Institute at Washington University A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud R. Jay Mashl October 20, 2014 Turnkey Variant

More information

Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017

Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017 Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of

More information

Lecture 20. Disease Genetics

Lecture 20. Disease Genetics Lecture 20. Disease Genetics Michael Schatz April 12 2018 JHU 600.749: Applied Comparative Genomics Part 1: Pre-genome Era Sickle Cell Anaemia Sickle-cell anaemia (SCA) is an abnormality in the oxygen-carrying

More information

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq) RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome

More information

Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016

Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016 Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016 Marwan Tayeh, PhD, FACMG Director, MMGL Molecular Genetics Assistant Professor of Pediatrics Department of Pediatrics

More information

VARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN

VARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN VARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN Email: apatwardhan@personalis.com MICHAEL CLARK Email: michael.clark@personalis.com ALEX MORGAN Email:

More information

Genome Structural Variation

Genome Structural Variation Genome Structural Variation Evan Eichler Howard Hughes Medical Institute University of Washington January 13 th, 2017, Genomics Workshop, Český Krumlov Genetic Variation Types Sequence Single base-pair

More information

Quantifying population dynamics using hidden relatedness. Itsik Pe er Columbia University IGERT, 11/18/2016

Quantifying population dynamics using hidden relatedness. Itsik Pe er Columbia University IGERT, 11/18/2016 Quantifying population dynamics using hidden relatedness Itsik Pe er Columbia University IGERT, 11/18/2016 Population Genomics 101: Data ACTTGTTTTGGGTTGGGTGGGGCATCC ATTTGTTTTGCGTTGGGTGGGGCATCC ACTTATTTTGGGTTGAGTGGGGCATCC

More information

SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN

SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN Structural variation (SV) Variants larger than 50bps Affect

More information

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized

More information

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and

More information

Implementation of the DDD/ClinGen OGT (CytoSure v3) Microarray

Implementation of the DDD/ClinGen OGT (CytoSure v3) Microarray Implementation of the DDD/ClinGen OGT (CytoSure v3) Microarray OGT UGM Birmingham 08/09/2016 Dom McMullan Birmingham Women's NHS Trust WM chromosomal microarray (CMA) testing Population of ~6 million (10%)

More information

Golden Helix s End-to-End Solution for Clinical Labs

Golden Helix s End-to-End Solution for Clinical Labs Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics

More information

Comprehensive Genome and Transcriptome Structural Analysis of a Breast Cancer Cell Line using PacBio Long Read Sequencing

Comprehensive Genome and Transcriptome Structural Analysis of a Breast Cancer Cell Line using PacBio Long Read Sequencing Comprehensive Genome and Transcriptome Structural Analysis of a Breast Cancer Cell Line using PacBio Long Read Sequencing Maria Nattestad Schatz + McCombie + Hicks at Cold Spring Harbor Laboratory McPherson

More information

Rare Variant Burden Tests. Biostatistics 666

Rare Variant Burden Tests. Biostatistics 666 Rare Variant Burden Tests Biostatistics 666 Last Lecture Analysis of Short Read Sequence Data Low pass sequencing approaches Modeling haplotype sharing between individuals allows accurate variant calls

More information

LTA Analysis of HapMap Genotype Data

LTA Analysis of HapMap Genotype Data LTA Analysis of HapMap Genotype Data Introduction. This supplement to Global variation in copy number in the human genome, by Redon et al., describes the details of the LTA analysis used to screen HapMap

More information

Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA

Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials

More information

NGS in tissue and liquid biopsy

NGS in tissue and liquid biopsy NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences

More information

PREVENTION OF HAEMOGLOBINOPATHIES: New methodologies and procedures Non-invasive Prenatal Diagnosis

PREVENTION OF HAEMOGLOBINOPATHIES: New methodologies and procedures Non-invasive Prenatal Diagnosis PREVENTION OF HAEMOGLOBINOPATHIES: New methodologies and procedures Non-invasive Prenatal Diagnosis Marina Kleanthous Cyprus School of Molecular Medicine The Cyprus Institute of Neurology and Genetics

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive

More information

Lecture 8 Understanding Transcription RNA-seq analysis. Foundations of Computational Systems Biology David K. Gifford

Lecture 8 Understanding Transcription RNA-seq analysis. Foundations of Computational Systems Biology David K. Gifford Lecture 8 Understanding Transcription RNA-seq analysis Foundations of Computational Systems Biology David K. Gifford 1 Lecture 8 RNA-seq Analysis RNA-seq principles How can we characterize mrna isoform

More information

DMD Genetics: complicated, complex and critical to understand

DMD Genetics: complicated, complex and critical to understand DMD Genetics: complicated, complex and critical to understand Stanley Nelson, MD Professor of Human Genetics, Pathology and Laboratory Medicine, and Psychiatry Co Director, Center for Duchenne Muscular

More information

How to Standardise and Assemble Raw Data into Sequences: What Does it Mean for a Laboratory to Use Such Technologies?"

How to Standardise and Assemble Raw Data into Sequences: What Does it Mean for a Laboratory to Use Such Technologies? How to Standardise and Assemble Raw Data into Sequences: What Does it Mean for a Laboratory to Use Such Technologies?" Dr Joseph Hughes 11th OIE Seminar Saskatoon - 17th June 2015 Cost per raw Megabase

More information

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11396 A total of 2078 samples from a large sequencing project at decode were used in this study, 219 samples from 78 trios with two grandchildren who were not also members of other trios,

More information

ChIP-seq data analysis

ChIP-seq data analysis ChIP-seq data analysis Harri Lähdesmäki Department of Computer Science Aalto University November 24, 2017 Contents Background ChIP-seq protocol ChIP-seq data analysis Transcriptional regulation Transcriptional

More information

RNA SEQUENCING AND DATA ANALYSIS

RNA SEQUENCING AND DATA ANALYSIS RNA SEQUENCING AND DATA ANALYSIS Download slides and package http://odin.mdacc.tmc.edu/~rverhaak/package.zip http://odin.mdacc.tmc.edu/~rverhaak/rna-seqlecture.zip Overview Introduction into the topic

More information

Ambient temperature regulated flowering time

Ambient temperature regulated flowering time Ambient temperature regulated flowering time Applications of RNAseq RNA- seq course: The power of RNA-seq June 7 th, 2013; Richard Immink Overview Introduction: Biological research question/hypothesis

More information

DNA Basics. We are all made up of cells. Cells contain DNA, or instructions to tell our bodies how to work.

DNA Basics. We are all made up of cells. Cells contain DNA, or instructions to tell our bodies how to work. DNA Basics We are all made up of cells. Cells contain DNA, or instructions to tell our bodies how to work. DNA is packaged into structures called chromosomes. Each chromosome contains many genes and each

More information

P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.

P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences

More information

VirusDetect pipeline - virus detection with small RNA sequencing

VirusDetect pipeline - virus detection with small RNA sequencing VirusDetect pipeline - virus detection with small RNA sequencing CSC webinar 16.1.2018 Eija Korpelainen, Kimmo Mattila, Maria Lehtivaara Big thanks to Jan Kreuze and Jari Valkonen! Outline Small interfering

More information

Cancer Validation in the 100,000 genomes project. Dr Shirley Henderson ACGS spring meeting 06/07/16

Cancer Validation in the 100,000 genomes project. Dr Shirley Henderson ACGS spring meeting 06/07/16 Cancer Validation in the 100,000 genomes project Dr Shirley Henderson ACGS spring meeting 06/07/16 Cancer is a lesion of the Genome Diagnosis Cancer Molecular Lesions Prognosis Disease Monitoring Why is

More information

Applications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns

Applications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns Applications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns جواد کریمزاد حق PhD of Medical Genetics آزمايشگاه پاتوبيولوژي و ژنتيك پارسه

More information

White Paper. Copy number variant detection. Sample to Insight. August 19, 2015

White Paper. Copy number variant detection. Sample to Insight. August 19, 2015 White Paper Copy number variant detection August 19, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 Fax: +45 86 20 12 22 www.clcbio.com

More information

Mosaic loss of chromosome Y in peripheral blood is associated with shorter survival and higher risk of cancer

Mosaic loss of chromosome Y in peripheral blood is associated with shorter survival and higher risk of cancer Supplementary Information Mosaic loss of chromosome Y in peripheral blood is associated with shorter survival and higher risk of cancer Lars A. Forsberg, Chiara Rasi, Niklas Malmqvist, Hanna Davies, Saichand

More information

Figure S2. Distribution of acgh probes on all ten chromosomes of the RIL M0022

Figure S2. Distribution of acgh probes on all ten chromosomes of the RIL M0022 96 APPENDIX B. Supporting Information for chapter 4 "changes in genome content generated via segregation of non-allelic homologs" Figure S1. Potential de novo CNV probes and sizes of apparently de novo

More information

Benefits and pitfalls of new genetic tests

Benefits and pitfalls of new genetic tests Benefits and pitfalls of new genetic tests Amanda Krause Division of Human Genetics, NHLS and University of the Witwatersrand Definition of Genetic Testing the analysis of human DNA, RNA, chromosomes,

More information

Large-scale identity-by-descent mapping discovers rare haplotypes of large effect. Suyash Shringarpure 23andMe, Inc. ASHG 2017

Large-scale identity-by-descent mapping discovers rare haplotypes of large effect. Suyash Shringarpure 23andMe, Inc. ASHG 2017 Large-scale identity-by-descent mapping discovers rare haplotypes of large effect Suyash Shringarpure 23andMe, Inc. ASHG 2017 1 Why care about rare variants of large effect? Months from randomization 2

More information

!"##"$%#"&!'&$'()$(%&'*& Terapia Pediatrica e Farmacologia dello Sviluppo +,-./&01,23&34,53& :&;.<&2-.=;:3&;.;2>6-6&-.&;&

!##$%#&!'&$'()$(%&'*& Terapia Pediatrica e Farmacologia dello Sviluppo +,-./&01,23&34,53& :&;.<&2-.=;:3&;.;2>6-6&-.&;& !!! "#$%&'($)*!+&,-$!.)/+$!+$!01,-$1'$!!"##"$%#"&!'&$'()$(%&'*& Terapia Pediatrica e Farmacologia dello Sviluppo 0$2-3!44566!! +,-./&01,23&34,53&63783.9-.:&;.6-6&-.&;& 582/-:3.3?;/-,.;2&@;5-2>&63:?3:;/-.:&#>A3&B&!-;C3/36&!.&))3'&!(2$&#)$7$23!+$(2$8-$#1'&!+$!177&'&#91!!

More information

A Likelihood-Based Framework for Variant Calling and De Novo Mutation Detection in Families

A Likelihood-Based Framework for Variant Calling and De Novo Mutation Detection in Families A Likelihood-Based Framework for Variant Calling and De Novo Mutation Detection in Families Bingshan Li 1 *, Wei Chen 2, Xiaowei Zhan 3, Fabio Busonero 3,4, Serena Sanna 4, Carlo Sidore 4, Francesco Cucca

More information

Copy Number Varia/on Detec/on. Alex Mawla UCD Genome Center Bioinforma5cs Core Tuesday June 16, 2015

Copy Number Varia/on Detec/on. Alex Mawla UCD Genome Center Bioinforma5cs Core Tuesday June 16, 2015 Copy Number Varia/on Detec/on Alex Mawla UCD Genome Center Bioinforma5cs Core Tuesday June 16, 2015 Today s Goals Understand the applica5on and capabili5es of using targe5ng sequencing and CNV calling

More information

Clinical Genetics. Functional validation in a diagnostic context. Robert Hofstra. Leading the way in genetic issues

Clinical Genetics. Functional validation in a diagnostic context. Robert Hofstra. Leading the way in genetic issues Clinical Genetics Leading the way in genetic issues Functional validation in a diagnostic context Robert Hofstra Clinical Genetics Leading the way in genetic issues Future application of exome sequencing

More information

September 20 & 21, 2012 Putting next generation sequencing in perspective

September 20 & 21, 2012 Putting next generation sequencing in perspective September 20 & 21, 2012 Putting next generation sequencing in perspective The NVHG Two-Day Autumn Symposium 2012 - Dutch Society of Human Genetics Nederlandse Vereniging voor Humane Genetica (www.nvhg-nav.nl)

More information

High-throughput transcriptome sequencing

High-throughput transcriptome sequencing High-throughput transcriptome sequencing Erik Kristiansson (erik.kristiansson@zool.gu.se) Department of Zoology Department of Neuroscience and Physiology University of Gothenburg, Sweden Outline Genome

More information

Genetic Counselling in relation to genetic testing

Genetic Counselling in relation to genetic testing Genetic Counselling in relation to genetic testing Dr Julie Vogt Consultant Geneticist West Midlands Regional Genetics Service September 2016 Disclosures for Research Support/P.I. Employee Consultant Major

More information

Mapping by recurrence and modelling the mutation rate

Mapping by recurrence and modelling the mutation rate Mapping by recurrence and modelling the mutation rate Shamil Sunyaev Broad Institute of M.I.T. and Harvard Current knowledge is from Comparative genomics Experimental systems: yeast reporter assays Potential

More information

Exomes and Beyond Addressing the Genome with OneSeq. Madhuri Hegde, PhD, FACMG Emory University Emory Genetics Laboratory Atlanta, GA

Exomes and Beyond Addressing the Genome with OneSeq. Madhuri Hegde, PhD, FACMG Emory University Emory Genetics Laboratory Atlanta, GA Exomes and Beyond Addressing the Genome with OneSeq Madhuri Hegde, PhD, FACMG Emory University Emory Genetics Laboratory Atlanta, GA Technologies to Detect Various Types of Mutations RESOLUTION Targeted

More information

RNA-Seq guided gene therapy for vision loss. Michael H. Farkas

RNA-Seq guided gene therapy for vision loss. Michael H. Farkas RNA-Seq guided gene therapy for vision loss Michael H. Farkas The retina is a complex tissue Many cell types Neural retina vs. RPE Each highly dependent on the other Graw, Nature Reviews Genetics, 2003

More information

AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients

AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients AD (Leave blank) Award Number: W81XWH-12-1-0444 TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients PRINCIPAL INVESTIGATOR: Mark A. Watson, MD PhD CONTRACTING ORGANIZATION:

More information

Identifying Mutations Responsible for Rare Disorders Using New Technologies

Identifying Mutations Responsible for Rare Disorders Using New Technologies Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance

More information

Home Brewed Personalized Genomics

Home Brewed Personalized Genomics Home Brewed Personalized Genomics The Quest for Meaningful Analysis Results of a 23andMe Exome Pilot Trio of Myself, Wife, and Son February 22, 2013 Gabe Rudy, Vice President of Product Development Exome

More information

Validation of copy number variation analysis for next-generation sequencing diagnostics

Validation of copy number variation analysis for next-generation sequencing diagnostics (2017) 25, 719 724 & 2017 Macmillan Publishers Limited, part of Springer Nature. All rights reserved 1018-4813/17 $32.00 www.nature.com/ejhg ARTICLE Validation of copy number variation analysis for next-generation

More information

Investigating rare diseases with Agilent NGS solutions

Investigating rare diseases with Agilent NGS solutions Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe

More information

Shape-based retrieval of CNV regions in read coverage data. Sangkyun Hong and Jeehee Yoon*

Shape-based retrieval of CNV regions in read coverage data. Sangkyun Hong and Jeehee Yoon* 254 Int. J. Data Mining and Bioinformatics, Vol. 9, No. 3, 2014 Shape-based retrieval of CNV regions in read coverage data Sangkyun Hong and Jeehee Yoon* Department of Computer Engineering, Hallym University

More information

Algorithms for studying the structure and function of genomes

Algorithms for studying the structure and function of genomes Algorithms for studying the structure and function of genomes Michael Schatz Feb 5, 2015 JHU Dept. of Biology Schatzlab Overview Human Genetics Role of mutations in disease Narzisi et al. (2014) Iossifov

More information

Trinity: Transcriptome Assembly for Genetic and Functional Analysis of Cancer [U24]

Trinity: Transcriptome Assembly for Genetic and Functional Analysis of Cancer [U24] Trinity: Transcriptome Assembly for Genetic and Functional Analysis of Cancer [U24] ITCR meeting, June 2016 The Cancer Transcriptome A window into the (expressed) genetic and epigenetic state of a tumor

More information