SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA. Giuseppe Narzisi, PhD Schatz Lab

Size: px
Start display at page:

Download "SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA. Giuseppe Narzisi, PhD Schatz Lab"

Transcription

1 SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA Giuseppe Narzisi, PhD Schatz Lab

2 November 14, 2013 Micro-Assembly Approach to detect INDELs 2 Outline Scalpel micro-assembly pipeline Large-scale validation experiment De novo/transmitted mutations in Autism

3 November 14, 2013 Micro-Assembly Approach to detect INDELs 3 SCALPEL Micro-assembly pipeline

4 November 14, 2013 Micro-Assembly Approach to detect INDELs 4 The detection challenge Repeats Mapping errors Coverage Coverage Father Mother Self Sibling Genome location Irregularity in capture efficiency near the edges of the coding region SNP or Indel? Long insertion..ttgaattagccttggtgaattgagcctt...tttag agtgc..!! GAATGAGCC GAAT-GAGCC TTTAGAATAGGC! ATAGGCGAGTGC R SNP R

5 November 14, 2013 Micro-Assembly Approach to detect INDELs 5 Scalpel Novel DNA sequence micro-assembly pipeline to detect mutations within exome-capture data. Whole-Genome assembly Large scale genome structure Genotypic Heuristics to optimize resources (Time and Space) Micro-assembly Detect genome variations Haplotypic (Hom/Het state) Feasible to perform exhaustive search Features: 1. Self-tuning k-mer. 2. On-the-fly repeat composition analysis. 3. Family pedigree: joint analysis of family members to detect de novo and transmitted mutations.

6 November 14, 2013 Micro-Assembly Approach to detect INDELs 6 Extract reads reference Build de Bruijn graph K = K+1 Remove low coverage nodes, dead-ends and compress Mark Source and Sink source yes If cycle or near-perfect repeat in any path source sink no sink Traverse graph and enumerate haplotype paths deletion insertion Align to reference

7 November 14, 2013 Micro-Assembly Approach to detect INDELs 7 Walking along the exome Extraction, assembly, alignment and INDEL detection performed in overlapping windows along the exon. 1. Localized assembly (smaller graph). 2. Minimize problem with coverage drops. 3. Distributed approach Father Mother Self Sibling Coverage Genome location

8 November 14, 2013 Micro-Assembly Approach to detect INDELs 8 LARGE SCALE EXPERIMENT Re-sequencing of 1000 INDELs

9 November 14, 2013 Micro-Assembly Approach to detect INDELs 9 INDELs in one Exome Individual affected by Attention Deficit/ Hyperactivity Disorder (ADHD) Captured using Agilent SureSelect v.2 and sequenced on the Illumina platform. 80% of the target at >20x coverage INDELs for validation: 200 Scalpel 200 Haplotype Caller 200 SOAPindel 200 within intersection 200 long INDELs (>30bp) Hard to judge the quality of INDELs specific to each pipeline. Superior sensitivity or poor specificity??

10 November 14, 2013 Micro-Assembly Approach to detect INDELs 10 Focus on size distribution Frequency Scalpel Size All Unique Frequency SOAPindel Size All Unique Frequency HaplotypeCaller Bias towards deletions (for HaplotypeCaller) or insertion (for SOAPindel). Scalpel instead shows a well-balanced distribution between insertions and deletions Size All Unique

11 November 14, 2013 Validated INDELs specific to each pipeline Micro-Assembly Approach to detect INDELs 11 log total 10 Scalpel 77% PPV Invalid Valid size log total 10 SOAPindel 50% PPV Invalid Valid size log total 10 HaplotypeCaller 22% PPV Invalid Valid size INDELs not passing validation correlate well with size bias.

12 November 14, 2013 Micro-Assembly Approach to detect INDELs 12 Validated INDELs log total 10 Scalpel 77% PPV Invalid Valid size log total 10 SOAPindel 50% PPV Invalid Valid size log total 10 HaplotypeCaller 22% PPV Invalid Valid size INDELs not passing validation correlate well with size bias.

13 November 14, 2013 Micro-Assembly Approach to detect INDELs 13 DE NOVO MUTATIONS IN AUTISM Simons Simplex Collection

14 November 14, 2013 Micro-Assembly Approach to detect INDELs 14 Simons Simplex Collection ~2700 families. Quad: two parents, one affected child and one unaffected child. NimbleGen SeqCap EZ Exome v2.0 (36 Mb). Illumina HiSeq: ~93bp reads after removing barcodes. Three major studies reporting strong enrichment for de novo gene killing mutations in autistic kids: CSHL: Iossifov et al. (2012) Neuron. 74: Yale: Sanders et al. (2012) Nature. 485, WashU: O Roak et al. (2012) Nature. 485,

15 November 14, 2013 Micro-Assembly Approach to detect INDELs 15 INDELs in 593 families Database with > 3 million INDELs Increased power to detect insertions. Subdivide by annotation category. Goal: discover significant biology that was impossible to measure a few year ago

16 November 14, 2013 Micro-Assembly Approach to detect INDELs 16 De novo INDELs in Autism 593 families: 343 CSHL, 200 StateLab, and 50 EichlerLab # INDEL&effect& Aut& Sib& Aut&M& Aut&F& Sib&M& Sib&F& Total& Frame&shift& 35# 16# 25# 10# 12# 4# 51# Intron& 13# 16# 11# 2# 6# 10# 29# Intergenic& 2# 0# 2# 0# 0# 0# 2# No&frame&shift& 4# 5# 4# 0# 1# 4# 9# Splice=site& 2# 0# 2# 0# 0# 0# 2# UTR& 2# 2# 2# 0# 0# 2# 4# Total& 58# 39# 46# 12# 19# 20# 97# De novo INDELs that are likely to severely disrupt the encoded protein are significantly more abundant in affected children than in unaffected siblings

17 November 14, 2013 Micro-Assembly Approach to detect INDELs 17 CONCLUSION

18 November 14, 2013 Micro-Assembly Approach to detect INDELs 18 Conclusions Scalpel: highly accurate tool to detect de novo, transmitted, and somatic INDELs. Errors of current detection software explained by a largescale (1000 INDELs) re-sequencing experiment. Population wide analysis: de novo INDELs in Autism.

19 November 14, 2013 Micro-Assembly Approach to detect INDELs 19 Acknowledgment Michael C. Schatz Michael Wigler Gholson J. Lyon Ivan Iossifov ADHD project Jason O Rawe Yiyang Wu Autism project Dan Levy Michael Ronemus Yoonha Lee Zihua Wang Ewa Grabowska Peter Andrews Mitchell Bekritsky Jude Kendall

20 November 14, 2013 Micro-Assembly Approach to detect INDELs 20 THANK YOU

TOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY. Giuseppe Narzisi, PhD Bioinformatics Scientist

TOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY. Giuseppe Narzisi, PhD Bioinformatics Scientist TOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY Giuseppe Narzisi, PhD Bioinformatics Scientist July 29, 2014 Micro-Assembly Approach to detect INDELs 2 Outline 1 Detecting INDELs:

More information

Illuminating the genetics of complex human diseases

Illuminating the genetics of complex human diseases Illuminating the genetics of complex human diseases Michael Schatz Sept 27, 2012 Beyond the Genome @mike_schatz / #BTG2012 Outline 1. De novo mutations in human diseases 1. Autism Spectrum Disorder 2.

More information

Reducing INDEL calling errors in whole genome and exome sequencing data.

Reducing INDEL calling errors in whole genome and exome sequencing data. Reducing INDEL calling errors in whole genome and exome sequencing data. Han Fang November 8, 2014 CSHL Biological Data Science Meeting Acknowledgments Lyon Lab Yiyang Wu Jason O Rawe Laura J Barron Max

More information

The next 10 years of quantitative biology

The next 10 years of quantitative biology The next 10 years of quantitative biology Michael Schatz March 25, 2014 Keystone Meeting on Big Data in Biology @mike_schatz / #KSBigData Unsolved Questions in Biology What is your genome sequence? How

More information

Big Data Meets DNA How Biological Data Science is improving our health, foods, and energy needs

Big Data Meets DNA How Biological Data Science is improving our health, foods, and energy needs Big Data Meets DNA How Biological Data Science is improving our health, foods, and energy needs Michael Schatz April 8, 2014 IEEE Fellows Night Syracuse @mike_schatz The secret of life Your DNA, along

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature13908 Supplementary Tables Supplementary Table 1: Families in this study (.xlsx) All families included in the study are listed. For each family, we show: the genders of the probands and

More information

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.

More information

Algorithms for studying the structure and function of genomes

Algorithms for studying the structure and function of genomes Algorithms for studying the structure and function of genomes Michael Schatz Feb 5, 2015 JHU Dept. of Biology Schatzlab Overview Human Genetics Role of mutations in disease Narzisi et al. (2014) Iossifov

More information

Human Genetics and Plant Genomics: The long and the short of it

Human Genetics and Plant Genomics: The long and the short of it Human Genetics and Plant Genomics: The long and the short of it Michael Schatz Simons Center for Quantitative Biology CSHL In-House Symposium XXVI November 20, 2012 Schatz Lab Overview Human Genetics Computation

More information

Algorithms for the analysis of complex genomes

Algorithms for the analysis of complex genomes Algorithms for the analysis of complex genomes Michael Schatz Oct 18, 2013 CSHL In House Introductions Srividya Sri Ramakrishnan DOE Systems Biology Knowledgebase Worlds fastest genomics pipelines Tyler

More information

Big Data Meets DNA How Biological Data Science is improving our health, foods, and energy needs

Big Data Meets DNA How Biological Data Science is improving our health, foods, and energy needs Big Data Meets DNA How Biological Data Science is improving our health, foods, and energy needs Michael Schatz June 18, 2014 CSHL Public Lecture Series DNA: The secret of life Your DNA, along with your

More information

Analysis with SureCall 2.1

Analysis with SureCall 2.1 Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis

More information

Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection

Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin

More information

Identifying Mutations Responsible for Rare Disorders Using New Technologies

Identifying Mutations Responsible for Rare Disorders Using New Technologies Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance

More information

Algorithms for de novo genome assembly and disease analytics

Algorithms for de novo genome assembly and disease analytics Algorithms for de novo genome assembly and disease analytics Michael Schatz April 7, 2014 Hamilton College Schatz Lab Overview Computation Human Genetics Sequencing Modeling Plant Genomics Introductions

More information

De Novo Gene Disruptions in Children on the Autistic Spectrum

De Novo Gene Disruptions in Children on the Autistic Spectrum Article De Novo Gene Disruptions in Children on the Autistic Spectrum Ivan Iossifov, 1,6 Michael Ronemus, 1,6 Dan Levy, 1 Zihua Wang, 1 Inessa Hakker, 1 Julie Rosenbaum, 1 Boris Yamrom, 1 Yoon-ha Lee,

More information

Algorithms for de novo genome assembly and disease analytics

Algorithms for de novo genome assembly and disease analytics Algorithms for de novo genome assembly and disease analytics Michael Schatz Feb 18, 2014 CCMB, Brown University Outline 1. De novo assembly by analogy 2. Long Read Assembly 3. Disease Analytics Shredded

More information

Algorithms for de novo genome assembly and disease analytics

Algorithms for de novo genome assembly and disease analytics Algorithms for de novo genome assembly and disease analytics Michael Schatz Feb 11, 2014 IDIES Seminar, Johns Hopkins University Outline 1. Biological Data Science 2. De novo genome assembly 3. Disease

More information

Lecture 20. Disease Genetics

Lecture 20. Disease Genetics Lecture 20. Disease Genetics Michael Schatz April 12 2018 JHU 600.749: Applied Comparative Genomics Part 1: Pre-genome Era Sickle Cell Anaemia Sickle-cell anaemia (SCA) is an abnormality in the oxygen-carrying

More information

No mutations were identified.

No mutations were identified. Hereditary High Cholesterol Test ORDERING PHYSICIAN PRIMARY CONTACT SPECIMEN Report date: Aug 1, 2017 Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA Kelly Peters Sample Medical Group 123

More information

Investigating rare diseases with Agilent NGS solutions

Investigating rare diseases with Agilent NGS solutions Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe

More information

De novo assembly of complex genomes

De novo assembly of complex genomes De novo assembly of complex genomes Michael Schatz April 10, 2013 CPHG, University of Virginia Schatz Lab Overview Computation Human Genetics Sequencing Modeling Plant Genomics Outline 1. Genome assembly

More information

Genome Wide Variant Analysis of Simplex Autism Families with an Integrative Clinical-Bioinformatics Pipeline

Genome Wide Variant Analysis of Simplex Autism Families with an Integrative Clinical-Bioinformatics Pipeline Genome Wide Variant Analysis of Simplex Autism Families with an Integrative Clinical-Bioinformatics Pipeline Laura T. Jiménez-Barrón 1,5, Jason A. O Rawe 1,2, Yiyang Wu 1,2, Margaret Yoon 1, Han Fang 1,

More information

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

Nature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data.

Nature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data. Supplementary Figure 1 PCA for ancestry in SNV data. (a) EIGENSTRAT principal-component analysis (PCA) of SNV genotype data on all samples. (b) PCA of only proband SNV genotype data. (c) PCA of SNV genotype

More information

Victor Guryev. European Research Institute for the Biology of Ageing

Victor Guryev. European Research Institute for the Biology of Ageing Victor Guryev European Research Institute for the Biology of Ageing September 29, 2014 Genomic resequencing in Medical diagnostics course Erasmus MC, Rotterdam /a /g Low coverage whole genome and deep

More information

SAPLING: A Tool for Gene Network Analysis focusing on Psychiatric Genetics

SAPLING: A Tool for Gene Network Analysis focusing on Psychiatric Genetics SAPLING: A Tool for Gene Network Analysis focusing on Psychiatric Genetics sapling.cshl.edu Wim Verleyen, Ph.D. Gillis Lab Outline Motivation Disease-gene analysis Enrichment analysis Gene network analysis:

More information

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes

More information

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc.

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc. Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets

More information

The contribution of de novo coding mutations to autism spectrum disorder

The contribution of de novo coding mutations to autism spectrum disorder doi:10.1038/nature13908 The contribution of de novo coding mutations to autism spectrum disorder Ivan Iossifov 1 *, Brian J. O Roak,3 *, Stephan J. Sanders 4,5 *, Michael Ronemus 1 *, Niklas Krumm, Dan

More information

Colorspace & Matching

Colorspace & Matching Colorspace & Matching Outline Color space and 2-base-encoding Quality Values and filtering Mapping algorithm and considerations Estimate accuracy Coverage 2 2008 Applied Biosystems Color Space Properties

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Genomic structural variation

Genomic structural variation Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural

More information

PERSONALIZED GENETIC REPORT CLIENT-REPORTED DATA PURPOSE OF THE X-SCREEN TEST

PERSONALIZED GENETIC REPORT CLIENT-REPORTED DATA PURPOSE OF THE X-SCREEN TEST INCLUDED IN THIS REPORT: REVIEW OF YOUR GENETIC INFORMATION RELEVANT TO ENDOMETRIOSIS PERSONAL EDUCATIONAL INFORMATION RELEVANT TO YOUR GENES INFORMATION FOR OBTAINING YOUR ENTIRE X-SCREEN DATA FILE PERSONALIZED

More information

WHOLE EXOME SEQUENCING PIPELINE EVALUATION AND MUTATION DETECTION IN ESOPHAGEAL CANCER PATIENTS

WHOLE EXOME SEQUENCING PIPELINE EVALUATION AND MUTATION DETECTION IN ESOPHAGEAL CANCER PATIENTS WHOLE EXOME SEQUENCING PIPELINE EVALUATION AND MUTATION DETECTION IN ESOPHAGEAL CANCER PATIENTS SUMMARY Tran Thi Bich Ngoc 1 ; Ho Viet Hoanh 2 ; Vu Phuong Nhung 1 ; Nguyen Hai Ha 1 Nguyen Van Ba 2 ; Nguyen

More information

P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.

P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences

More information

Nature Biotechnology: doi: /nbt.1904

Nature Biotechnology: doi: /nbt.1904 Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is

More information

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,

More information

How many disease-causing variants in a normal person? Matthew Hurles

How many disease-causing variants in a normal person? Matthew Hurles How many disease-causing variants in a normal person? Matthew Hurles Summary What is in a genome? What is normal? Depends on age What is a disease-causing variant? Different classes of variation Final

More information

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq) RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome

More information

Nature Genetics: doi: /ng Supplementary Figure 1

Nature Genetics: doi: /ng Supplementary Figure 1 Supplementary Figure 1 Illustrative example of ptdt using height The expected value of a child s polygenic risk score (PRS) for a trait is the average of maternal and paternal PRS values. For example,

More information

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why

More information

Frequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R

Frequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R Frequency(%) 1 a b ALK FS-indel ALK R1Q HRAS Q61R HRAS G13R IDH R17K IDH R14Q MET exon14 SS-indel KIT D8Y KIT L76P KIT exon11 NFS-indel SMAD4 R361 IDH1 R13 CTNNB1 S37 CTNNB1 S4 AKT1 E17K ERBB D769H ERBB

More information

Home Brewed Personalized Genomics

Home Brewed Personalized Genomics Home Brewed Personalized Genomics The Quest for Meaningful Analysis Results of a 23andMe Exome Pilot Trio of Myself, Wife, and Son February 22, 2013 Gabe Rudy, Vice President of Product Development Exome

More information

Golden Helix s End-to-End Solution for Clinical Labs

Golden Helix s End-to-End Solution for Clinical Labs Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics

More information

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)

More information

NGS in tissue and liquid biopsy

NGS in tissue and liquid biopsy NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences

More information

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate

More information

Introduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016

Introduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016 Introduction to genetic variation He Zhang Bioinformatics Core Facility 6/22/2016 Outline Basic concepts of genetic variation Genetic variation in human populations Variation and genetic disorders Databases

More information

Global variation in copy number in the human genome

Global variation in copy number in the human genome Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)

More information

!"##"$%#"&!'&$'()$(%&'*& Terapia Pediatrica e Farmacologia dello Sviluppo +,-./&01,23&34,53& :&;.<&2-.=;:3&;.;2>6-6&-.&;&

!##$%#&!'&$'()$(%&'*& Terapia Pediatrica e Farmacologia dello Sviluppo +,-./&01,23&34,53& :&;.<&2-.=;:3&;.;2>6-6&-.&;& !!! "#$%&'($)*!+&,-$!.)/+$!+$!01,-$1'$!!"##"$%#"&!'&$'()$(%&'*& Terapia Pediatrica e Farmacologia dello Sviluppo 0$2-3!44566!! +,-./&01,23&34,53&63783.9-.:&;.6-6&-.&;& 582/-:3.3?;/-,.;2&@;5-2>&63:?3:;/-.:&#>A3&B&!-;C3/36&!.&))3'&!(2$&#)$7$23!+$(2$8-$#1'&!+$!177&'&#91!!

More information

Calling DNA variants SNVs, CNVs, and SVs. Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017

Calling DNA variants SNVs, CNVs, and SVs. Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017 1 Calling DNA variants SNVs, CNVs, and SVs Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017 Calling DNA variants SNVs, CNVs, SVs 2 1. What is a variant? 2. Paired End read

More information

Problem 3: Simulated Rheumatoid Arthritis Data

Problem 3: Simulated Rheumatoid Arthritis Data Problem 3: Simulated Rheumatoid Arthritis Data Michael B Miller Michael Li Gregg Lind Soon-Young Jang The plan

More information

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation

More information

ChIP-seq data analysis

ChIP-seq data analysis ChIP-seq data analysis Harri Lähdesmäki Department of Computer Science Aalto University November 24, 2017 Contents Background ChIP-seq protocol ChIP-seq data analysis Transcriptional regulation Transcriptional

More information

DNA-seq Bioinformatics Analysis: Copy Number Variation

DNA-seq Bioinformatics Analysis: Copy Number Variation DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq

More information

Copy number variation detection and genotyping from exome sequence data

Copy number variation detection and genotyping from exome sequence data Method Copy number variation detection and genotyping from exome sequence data Niklas Krumm, 1 Peter H. Sudmant, 1 Arthur Ko, 1 Brian J. O Roak, 1 Maika Malig, 1 Bradley P. Coe, 1 NHLBI Exome Sequencing

More information

The Amazing Brain Webinar Series: Select Topics in Neuroscience and Child Development for the Clinician

The Amazing Brain Webinar Series: Select Topics in Neuroscience and Child Development for the Clinician The Amazing Brain Webinar Series: Select Topics in Neuroscience and Child Development for the Clinician Part VII Recent Advances in the Genetics of Autism Spectrum Disorders Abha R. Gupta, MD, PhD Jointly

More information

The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients

The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients ASSC Scientific Meeting 13 th October 2016 Prof Andrew Barbour UQ SOM

More information

VARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN

VARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN VARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN Email: apatwardhan@personalis.com MICHAEL CLARK Email: michael.clark@personalis.com ALEX MORGAN Email:

More information

Ginkgo Interactive analysis and quality assessment of single-cell CNV data

Ginkgo Interactive analysis and quality assessment of single-cell CNV data Ginkgo Interactive analysis and quality assessment of single-cell CNV data @RobAboukhalil Robert Aboukhalil, Tyler Garvin, Jude Kendall, Timour Baslan, Gurinder S. Atwal, Jim Hicks, Michael Wigler, Michael

More information

Hands-On Ten The BRCA1 Gene and Protein

Hands-On Ten The BRCA1 Gene and Protein Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such

More information

Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA

Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials

More information

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017

Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017 Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of

More information

PROGRESS: Beginning to Understand the Genetic Predisposition to PSC

PROGRESS: Beginning to Understand the Genetic Predisposition to PSC PROGRESS: Beginning to Understand the Genetic Predisposition to PSC Konstantinos N. Lazaridis, MD Associate Professor of Medicine Division of Gastroenterology and Hepatology Associate Director Center for

More information

Analysis of Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing

Analysis of Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing www.sciencemag.org/cgi/content/full/science.1186802/dc1 Supporting Online Material for Analysis of Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing Jared C. Roach, Gustavo Glusman, Arian

More information

JULY 21, Genetics 101: SCN1A. Katie Angione, MS CGC Certified Genetic Counselor CHCO Neurology

JULY 21, Genetics 101: SCN1A. Katie Angione, MS CGC Certified Genetic Counselor CHCO Neurology JULY 21, 2018 Genetics 101: SCN1A Katie Angione, MS CGC Certified Genetic Counselor CHCO Neurology Disclosures: I have no financial interests or relationships to disclose. Objectives 1. Review genetic

More information

Understanding genetics, mutation and other details. Stanley F. Nelson, MD 6/29/18

Understanding genetics, mutation and other details. Stanley F. Nelson, MD 6/29/18 Understanding genetics, mutation and other details Stanley F. Nelson, MD 6/29/18 1 6 11 16 21 Duchenne muscular dystrophy 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 600 500 400 300 200 100 0 Duchenne/Becker

More information

Below, we included the point-to-point response to the comments of both reviewers.

Below, we included the point-to-point response to the comments of both reviewers. To the Editor and Reviewers: We would like to thank the editor and reviewers for careful reading, and constructive suggestions for our manuscript. According to comments from both reviewers, we have comprehensively

More information

Medical Advisory Council: Verified

Medical Advisory Council: Verified What is White Sutton Syndrome? White Sutton Syndrome (WHSUS) is a condition characterized by autism and developmental delay and/or intellectual disability, as well as a characteristic facial profile. Children

More information

Raymond Auerbach PhD Candidate, Yale University Gerstein and Snyder Labs August 30, 2012

Raymond Auerbach PhD Candidate, Yale University Gerstein and Snyder Labs August 30, 2012 Elucidating Transcriptional Regulation at Multiple Scales Using High-Throughput Sequencing, Data Integration, and Computational Methods Raymond Auerbach PhD Candidate, Yale University Gerstein and Snyder

More information

CITATION FILE CONTENT/FORMAT

CITATION FILE CONTENT/FORMAT CITATION For any resultant publications using please cite: Matthew A. Field, Vicky Cho, T. Daniel Andrews, and Chris C. Goodnow (2015). "Reliably detecting clinically important variants requires both combined

More information

Neuropsychiatric Disease Working Group Plan June 14, 2016 NHGRI Centers for Common Disease Genomics Program

Neuropsychiatric Disease Working Group Plan June 14, 2016 NHGRI Centers for Common Disease Genomics Program Neuropsychiatric Disease Working Group Plan June 14, 2016 NHGRI Centers for Common Disease Genomics Program Disease/Phenotype As its inaugural CCDG project, the Neuropsychiatric Working Group (NWG) proposes

More information

NGS for Cancer Predisposition

NGS for Cancer Predisposition NGS for Cancer Predisposition Colin Pritchard MD, PhD University of Washington Dept. of Lab Medicine AMP Companion Society Meeting USCAP Boston March 22, 2015 Disclosures I am an employee of the University

More information

Large-scale identity-by-descent mapping discovers rare haplotypes of large effect. Suyash Shringarpure 23andMe, Inc. ASHG 2017

Large-scale identity-by-descent mapping discovers rare haplotypes of large effect. Suyash Shringarpure 23andMe, Inc. ASHG 2017 Large-scale identity-by-descent mapping discovers rare haplotypes of large effect Suyash Shringarpure 23andMe, Inc. ASHG 2017 1 Why care about rare variants of large effect? Months from randomization 2

More information

Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015

Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015 Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a

More information

Interactive analysis and quality assessment of single-cell copy-number variations

Interactive analysis and quality assessment of single-cell copy-number variations Interactive analysis and quality assessment of single-cell copy-number variations Tyler Garvin, Robert Aboukhalil, Jude Kendall, Timour Baslan, Gurinder S. Atwal, James Hicks, Michael Wigler, Michael C.

More information

Clinical Genomics of Neuropsychiatric Illnesses. Gholson Lyon, M.D. Ph.D.

Clinical Genomics of Neuropsychiatric Illnesses. Gholson Lyon, M.D. Ph.D. Clinical Genomics of Neuropsychiatric Illnesses Gholson Lyon, M.D. Ph.D. Jason O Rawe Yiyang Wu Han Fang Max Doerfel Acknowledgments MarQn Reese Edward Kiruluta Reid Robison David MiPelman Gareth Highnam

More information

CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE

CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE is_clinical dbsnp MITO GENE chr1 13273 G C heterozygous - - -. - DDX11L1 chr1 949654 A G Homozygous 52 - - rs8997 - ISG15 chr1 1021346 A G heterozygous

More information

Transcriptome and isoform reconstruc1on with short reads. Tangled up in reads

Transcriptome and isoform reconstruc1on with short reads. Tangled up in reads Transcriptome and isoform reconstruc1on with short reads Tangled up in reads Topics of this lecture Mapping- based reconstruc1on methods Case study: The domes1c dog De- novo reconstruc1on method Trinity

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 An example of the gene-term-disease network automatically generated by Phenolyzer web server for 'autism'. The largest word represents the user s input term, Autism. The pink round

More information

DMD Genetics: complicated, complex and critical to understand

DMD Genetics: complicated, complex and critical to understand DMD Genetics: complicated, complex and critical to understand Stanley Nelson, MD Professor of Human Genetics, Pathology and Laboratory Medicine, and Psychiatry Co Director, Center for Duchenne Muscular

More information

AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients

AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients AD (Leave blank) Award Number: W81XWH-12-1-0444 TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients PRINCIPAL INVESTIGATOR: Mark A. Watson, MD PhD CONTRACTING ORGANIZATION:

More information

Entering the era of mega-genomics

Entering the era of mega-genomics Entering the era of mega-genomics Michael Schatz March 2, 2012 UNC Charlotte Schatz Lab Overview Human Genetics Computation Sequencing Modeling Plant Genomics Outline 1. Milestones in genomics 1. Sanger

More information

DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK

DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK CHAPTER 6 DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK Genetic research aimed at the identification of new breast cancer susceptibility genes is at an interesting crossroad. On the one hand, the existence

More information

Analyse de données de séquençage haut débit

Analyse de données de séquençage haut débit Analyse de données de séquençage haut débit Vincent Lacroix Laboratoire de Biométrie et Biologie Évolutive INRIA ERABLE 9ème journée ITS 21 & 22 novembre 2017 Lyon https://its.aviesan.fr Sequencing is

More information

De Novo Viral Quasispecies Assembly using Overlap Graphs

De Novo Viral Quasispecies Assembly using Overlap Graphs De Novo Viral Quasispecies Assembly using Overlap Graphs Alexander Schönhuth joint with Jasmijn Baaijens, Amal Zine El Aabidine, Eric Rivals Milano 18th of November 2016 Viral Quasispecies Assembly: HaploClique

More information

Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing

Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing PacBio Americas User Group Meeting Sample Prep Workshop June.27.2017 Tyson Clark, Ph.D. For Research Use Only. Not

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1 Density plots of sequence coverage in the UK10K, INTERVAL and DDD data sets.

Nature Neuroscience: doi: /nn Supplementary Figure 1 Density plots of sequence coverage in the UK10K, INTERVAL and DDD data sets. Supplementary Figure 1 Density plots of sequence coverage in the UK10K, INTERVAL and DDD data sets. Per-sample sequence coverage was calculated and summarised from exome sequencing data generated in the

More information

Supplemental Data. De Novo Truncating Mutations in WASF1. Cause Intellectual Disability with Seizures

Supplemental Data. De Novo Truncating Mutations in WASF1. Cause Intellectual Disability with Seizures The American Journal of Human Genetics, Volume 13 Supplemental Data De Novo Truncating Mutations in WASF1 Cause Intellectual Disability with Seizures Yoko Ito, Keren J. Carss, Sofia T. Duarte, Taila Hartley,

More information

Welcome to the Genetic Code: An Overview of Basic Genetics. October 24, :00pm 3:00pm

Welcome to the Genetic Code: An Overview of Basic Genetics. October 24, :00pm 3:00pm Welcome to the Genetic Code: An Overview of Basic Genetics October 24, 2016 12:00pm 3:00pm Course Schedule 12:00 pm 2:00 pm Principles of Mendelian Genetics Introduction to Genetics of Complex Disease

More information

Transcript reconstruction

Transcript reconstruction Transcript reconstruction Summary I Data types, file formats and utilities Annotation: Genomic regions Genes Peaks bedtools Alignment: Map reads BAM/SAM Samtools Aggregation: Summary files Wig (UCSC) TDF

More information

Sequencing studies implicate inherited mutations in autism

Sequencing studies implicate inherited mutations in autism NEWS Sequencing studies implicate inherited mutations in autism BY EMILY SINGER 23 JANUARY 2013 1 / 5 Unusual inheritance: Researchers have found a relatively mild mutation in a gene linked to Cohen syndrome,

More information

Approach to Mental Retardation and Developmental Delay. SR Ghaffari MSc MD PhD

Approach to Mental Retardation and Developmental Delay. SR Ghaffari MSc MD PhD Approach to Mental Retardation and Developmental Delay SR Ghaffari MSc MD PhD Introduction Objectives Definition of MR and DD Classification Epidemiology (prevalence, recurrence risk, ) Etiology Importance

More information

MEDICAL GENOMICS LABORATORY. Non-NF1 RASopathy panel by Next-Gen Sequencing and Deletion/Duplication Analysis of SPRED1 (NNP-NG)

MEDICAL GENOMICS LABORATORY. Non-NF1 RASopathy panel by Next-Gen Sequencing and Deletion/Duplication Analysis of SPRED1 (NNP-NG) Non-NF1 RASopathy panel by Next-Gen Sequencing and Deletion/Duplication Analysis of SPRED1 (NNP-NG) Ordering Information Acceptable specimen types: Blood (3-6ml EDTA; no time limitations associated with

More information

Performance comparison of two commercial human whole-exome capture systems on formalin-fixed paraffinembedded lung adenocarcinoma samples

Performance comparison of two commercial human whole-exome capture systems on formalin-fixed paraffinembedded lung adenocarcinoma samples Bonfiglio et al. BMC Cancer (2016) 16:692 DOI 10.1186/s12885-016-2720-4 RESEARCH ARTICLE Open Access Performance comparison of two commercial human whole-exome capture systems on formalin-fixed paraffinembedded

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Jacobsen E, Shanmugam V, Jagannathan J. Rosai Dorfman disease

More information