SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA. Giuseppe Narzisi, PhD Schatz Lab
|
|
- Patrick Murphy
- 6 years ago
- Views:
Transcription
1 SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA Giuseppe Narzisi, PhD Schatz Lab
2 November 14, 2013 Micro-Assembly Approach to detect INDELs 2 Outline Scalpel micro-assembly pipeline Large-scale validation experiment De novo/transmitted mutations in Autism
3 November 14, 2013 Micro-Assembly Approach to detect INDELs 3 SCALPEL Micro-assembly pipeline
4 November 14, 2013 Micro-Assembly Approach to detect INDELs 4 The detection challenge Repeats Mapping errors Coverage Coverage Father Mother Self Sibling Genome location Irregularity in capture efficiency near the edges of the coding region SNP or Indel? Long insertion..ttgaattagccttggtgaattgagcctt...tttag agtgc..!! GAATGAGCC GAAT-GAGCC TTTAGAATAGGC! ATAGGCGAGTGC R SNP R
5 November 14, 2013 Micro-Assembly Approach to detect INDELs 5 Scalpel Novel DNA sequence micro-assembly pipeline to detect mutations within exome-capture data. Whole-Genome assembly Large scale genome structure Genotypic Heuristics to optimize resources (Time and Space) Micro-assembly Detect genome variations Haplotypic (Hom/Het state) Feasible to perform exhaustive search Features: 1. Self-tuning k-mer. 2. On-the-fly repeat composition analysis. 3. Family pedigree: joint analysis of family members to detect de novo and transmitted mutations.
6 November 14, 2013 Micro-Assembly Approach to detect INDELs 6 Extract reads reference Build de Bruijn graph K = K+1 Remove low coverage nodes, dead-ends and compress Mark Source and Sink source yes If cycle or near-perfect repeat in any path source sink no sink Traverse graph and enumerate haplotype paths deletion insertion Align to reference
7 November 14, 2013 Micro-Assembly Approach to detect INDELs 7 Walking along the exome Extraction, assembly, alignment and INDEL detection performed in overlapping windows along the exon. 1. Localized assembly (smaller graph). 2. Minimize problem with coverage drops. 3. Distributed approach Father Mother Self Sibling Coverage Genome location
8 November 14, 2013 Micro-Assembly Approach to detect INDELs 8 LARGE SCALE EXPERIMENT Re-sequencing of 1000 INDELs
9 November 14, 2013 Micro-Assembly Approach to detect INDELs 9 INDELs in one Exome Individual affected by Attention Deficit/ Hyperactivity Disorder (ADHD) Captured using Agilent SureSelect v.2 and sequenced on the Illumina platform. 80% of the target at >20x coverage INDELs for validation: 200 Scalpel 200 Haplotype Caller 200 SOAPindel 200 within intersection 200 long INDELs (>30bp) Hard to judge the quality of INDELs specific to each pipeline. Superior sensitivity or poor specificity??
10 November 14, 2013 Micro-Assembly Approach to detect INDELs 10 Focus on size distribution Frequency Scalpel Size All Unique Frequency SOAPindel Size All Unique Frequency HaplotypeCaller Bias towards deletions (for HaplotypeCaller) or insertion (for SOAPindel). Scalpel instead shows a well-balanced distribution between insertions and deletions Size All Unique
11 November 14, 2013 Validated INDELs specific to each pipeline Micro-Assembly Approach to detect INDELs 11 log total 10 Scalpel 77% PPV Invalid Valid size log total 10 SOAPindel 50% PPV Invalid Valid size log total 10 HaplotypeCaller 22% PPV Invalid Valid size INDELs not passing validation correlate well with size bias.
12 November 14, 2013 Micro-Assembly Approach to detect INDELs 12 Validated INDELs log total 10 Scalpel 77% PPV Invalid Valid size log total 10 SOAPindel 50% PPV Invalid Valid size log total 10 HaplotypeCaller 22% PPV Invalid Valid size INDELs not passing validation correlate well with size bias.
13 November 14, 2013 Micro-Assembly Approach to detect INDELs 13 DE NOVO MUTATIONS IN AUTISM Simons Simplex Collection
14 November 14, 2013 Micro-Assembly Approach to detect INDELs 14 Simons Simplex Collection ~2700 families. Quad: two parents, one affected child and one unaffected child. NimbleGen SeqCap EZ Exome v2.0 (36 Mb). Illumina HiSeq: ~93bp reads after removing barcodes. Three major studies reporting strong enrichment for de novo gene killing mutations in autistic kids: CSHL: Iossifov et al. (2012) Neuron. 74: Yale: Sanders et al. (2012) Nature. 485, WashU: O Roak et al. (2012) Nature. 485,
15 November 14, 2013 Micro-Assembly Approach to detect INDELs 15 INDELs in 593 families Database with > 3 million INDELs Increased power to detect insertions. Subdivide by annotation category. Goal: discover significant biology that was impossible to measure a few year ago
16 November 14, 2013 Micro-Assembly Approach to detect INDELs 16 De novo INDELs in Autism 593 families: 343 CSHL, 200 StateLab, and 50 EichlerLab # INDEL&effect& Aut& Sib& Aut&M& Aut&F& Sib&M& Sib&F& Total& Frame&shift& 35# 16# 25# 10# 12# 4# 51# Intron& 13# 16# 11# 2# 6# 10# 29# Intergenic& 2# 0# 2# 0# 0# 0# 2# No&frame&shift& 4# 5# 4# 0# 1# 4# 9# Splice=site& 2# 0# 2# 0# 0# 0# 2# UTR& 2# 2# 2# 0# 0# 2# 4# Total& 58# 39# 46# 12# 19# 20# 97# De novo INDELs that are likely to severely disrupt the encoded protein are significantly more abundant in affected children than in unaffected siblings
17 November 14, 2013 Micro-Assembly Approach to detect INDELs 17 CONCLUSION
18 November 14, 2013 Micro-Assembly Approach to detect INDELs 18 Conclusions Scalpel: highly accurate tool to detect de novo, transmitted, and somatic INDELs. Errors of current detection software explained by a largescale (1000 INDELs) re-sequencing experiment. Population wide analysis: de novo INDELs in Autism.
19 November 14, 2013 Micro-Assembly Approach to detect INDELs 19 Acknowledgment Michael C. Schatz Michael Wigler Gholson J. Lyon Ivan Iossifov ADHD project Jason O Rawe Yiyang Wu Autism project Dan Levy Michael Ronemus Yoonha Lee Zihua Wang Ewa Grabowska Peter Andrews Mitchell Bekritsky Jude Kendall
20 November 14, 2013 Micro-Assembly Approach to detect INDELs 20 THANK YOU
TOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY. Giuseppe Narzisi, PhD Bioinformatics Scientist
TOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY Giuseppe Narzisi, PhD Bioinformatics Scientist July 29, 2014 Micro-Assembly Approach to detect INDELs 2 Outline 1 Detecting INDELs:
More informationIlluminating the genetics of complex human diseases
Illuminating the genetics of complex human diseases Michael Schatz Sept 27, 2012 Beyond the Genome @mike_schatz / #BTG2012 Outline 1. De novo mutations in human diseases 1. Autism Spectrum Disorder 2.
More informationReducing INDEL calling errors in whole genome and exome sequencing data.
Reducing INDEL calling errors in whole genome and exome sequencing data. Han Fang November 8, 2014 CSHL Biological Data Science Meeting Acknowledgments Lyon Lab Yiyang Wu Jason O Rawe Laura J Barron Max
More informationThe next 10 years of quantitative biology
The next 10 years of quantitative biology Michael Schatz March 25, 2014 Keystone Meeting on Big Data in Biology @mike_schatz / #KSBigData Unsolved Questions in Biology What is your genome sequence? How
More informationBig Data Meets DNA How Biological Data Science is improving our health, foods, and energy needs
Big Data Meets DNA How Biological Data Science is improving our health, foods, and energy needs Michael Schatz April 8, 2014 IEEE Fellows Night Syracuse @mike_schatz The secret of life Your DNA, along
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature13908 Supplementary Tables Supplementary Table 1: Families in this study (.xlsx) All families included in the study are listed. For each family, we show: the genders of the probands and
More informationAdvance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
More informationAlgorithms for studying the structure and function of genomes
Algorithms for studying the structure and function of genomes Michael Schatz Feb 5, 2015 JHU Dept. of Biology Schatzlab Overview Human Genetics Role of mutations in disease Narzisi et al. (2014) Iossifov
More informationHuman Genetics and Plant Genomics: The long and the short of it
Human Genetics and Plant Genomics: The long and the short of it Michael Schatz Simons Center for Quantitative Biology CSHL In-House Symposium XXVI November 20, 2012 Schatz Lab Overview Human Genetics Computation
More informationAlgorithms for the analysis of complex genomes
Algorithms for the analysis of complex genomes Michael Schatz Oct 18, 2013 CSHL In House Introductions Srividya Sri Ramakrishnan DOE Systems Biology Knowledgebase Worlds fastest genomics pipelines Tyler
More informationBig Data Meets DNA How Biological Data Science is improving our health, foods, and energy needs
Big Data Meets DNA How Biological Data Science is improving our health, foods, and energy needs Michael Schatz June 18, 2014 CSHL Public Lecture Series DNA: The secret of life Your DNA, along with your
More informationAnalysis with SureCall 2.1
Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis
More informationMultiplex target enrichment using DNA indexing for ultra-high throughput variant detection
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin
More informationIdentifying Mutations Responsible for Rare Disorders Using New Technologies
Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance
More informationAlgorithms for de novo genome assembly and disease analytics
Algorithms for de novo genome assembly and disease analytics Michael Schatz April 7, 2014 Hamilton College Schatz Lab Overview Computation Human Genetics Sequencing Modeling Plant Genomics Introductions
More informationDe Novo Gene Disruptions in Children on the Autistic Spectrum
Article De Novo Gene Disruptions in Children on the Autistic Spectrum Ivan Iossifov, 1,6 Michael Ronemus, 1,6 Dan Levy, 1 Zihua Wang, 1 Inessa Hakker, 1 Julie Rosenbaum, 1 Boris Yamrom, 1 Yoon-ha Lee,
More informationAlgorithms for de novo genome assembly and disease analytics
Algorithms for de novo genome assembly and disease analytics Michael Schatz Feb 18, 2014 CCMB, Brown University Outline 1. De novo assembly by analogy 2. Long Read Assembly 3. Disease Analytics Shredded
More informationAlgorithms for de novo genome assembly and disease analytics
Algorithms for de novo genome assembly and disease analytics Michael Schatz Feb 11, 2014 IDIES Seminar, Johns Hopkins University Outline 1. Biological Data Science 2. De novo genome assembly 3. Disease
More informationLecture 20. Disease Genetics
Lecture 20. Disease Genetics Michael Schatz April 12 2018 JHU 600.749: Applied Comparative Genomics Part 1: Pre-genome Era Sickle Cell Anaemia Sickle-cell anaemia (SCA) is an abnormality in the oxygen-carrying
More informationNo mutations were identified.
Hereditary High Cholesterol Test ORDERING PHYSICIAN PRIMARY CONTACT SPECIMEN Report date: Aug 1, 2017 Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA Kelly Peters Sample Medical Group 123
More informationInvestigating rare diseases with Agilent NGS solutions
Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe
More informationDe novo assembly of complex genomes
De novo assembly of complex genomes Michael Schatz April 10, 2013 CPHG, University of Virginia Schatz Lab Overview Computation Human Genetics Sequencing Modeling Plant Genomics Outline 1. Genome assembly
More informationGenome Wide Variant Analysis of Simplex Autism Families with an Integrative Clinical-Bioinformatics Pipeline
Genome Wide Variant Analysis of Simplex Autism Families with an Integrative Clinical-Bioinformatics Pipeline Laura T. Jiménez-Barrón 1,5, Jason A. O Rawe 1,2, Yiyang Wu 1,2, Margaret Yoon 1, Han Fang 1,
More informationUsing the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep
Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationNature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data.
Supplementary Figure 1 PCA for ancestry in SNV data. (a) EIGENSTRAT principal-component analysis (PCA) of SNV genotype data on all samples. (b) PCA of only proband SNV genotype data. (c) PCA of SNV genotype
More informationVictor Guryev. European Research Institute for the Biology of Ageing
Victor Guryev European Research Institute for the Biology of Ageing September 29, 2014 Genomic resequencing in Medical diagnostics course Erasmus MC, Rotterdam /a /g Low coverage whole genome and deep
More informationSAPLING: A Tool for Gene Network Analysis focusing on Psychiatric Genetics
SAPLING: A Tool for Gene Network Analysis focusing on Psychiatric Genetics sapling.cshl.edu Wim Verleyen, Ph.D. Gillis Lab Outline Motivation Disease-gene analysis Enrichment analysis Gene network analysis:
More informationWhole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes
More informationVariant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
More informationThe contribution of de novo coding mutations to autism spectrum disorder
doi:10.1038/nature13908 The contribution of de novo coding mutations to autism spectrum disorder Ivan Iossifov 1 *, Brian J. O Roak,3 *, Stephan J. Sanders 4,5 *, Michael Ronemus 1 *, Niklas Krumm, Dan
More informationColorspace & Matching
Colorspace & Matching Outline Color space and 2-base-encoding Quality Values and filtering Mapping algorithm and considerations Estimate accuracy Coverage 2 2008 Applied Biosystems Color Space Properties
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationGenomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
More informationPERSONALIZED GENETIC REPORT CLIENT-REPORTED DATA PURPOSE OF THE X-SCREEN TEST
INCLUDED IN THIS REPORT: REVIEW OF YOUR GENETIC INFORMATION RELEVANT TO ENDOMETRIOSIS PERSONAL EDUCATIONAL INFORMATION RELEVANT TO YOUR GENES INFORMATION FOR OBTAINING YOUR ENTIRE X-SCREEN DATA FILE PERSONALIZED
More informationWHOLE EXOME SEQUENCING PIPELINE EVALUATION AND MUTATION DETECTION IN ESOPHAGEAL CANCER PATIENTS
WHOLE EXOME SEQUENCING PIPELINE EVALUATION AND MUTATION DETECTION IN ESOPHAGEAL CANCER PATIENTS SUMMARY Tran Thi Bich Ngoc 1 ; Ho Viet Hoanh 2 ; Vu Phuong Nhung 1 ; Nguyen Hai Ha 1 Nguyen Van Ba 2 ; Nguyen
More informationP. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.
Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences
More informationNature Biotechnology: doi: /nbt.1904
Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is
More informationMutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
More informationHow many disease-causing variants in a normal person? Matthew Hurles
How many disease-causing variants in a normal person? Matthew Hurles Summary What is in a genome? What is normal? Depends on age What is a disease-causing variant? Different classes of variation Final
More informationgenomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
More informationNature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Illustrative example of ptdt using height The expected value of a child s polygenic risk score (PRS) for a trait is the average of maternal and paternal PRS values. For example,
More informationCharacterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
More informationFrequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R
Frequency(%) 1 a b ALK FS-indel ALK R1Q HRAS Q61R HRAS G13R IDH R17K IDH R14Q MET exon14 SS-indel KIT D8Y KIT L76P KIT exon11 NFS-indel SMAD4 R361 IDH1 R13 CTNNB1 S37 CTNNB1 S4 AKT1 E17K ERBB D769H ERBB
More informationHome Brewed Personalized Genomics
Home Brewed Personalized Genomics The Quest for Meaningful Analysis Results of a 23andMe Exome Pilot Trio of Myself, Wife, and Son February 22, 2013 Gabe Rudy, Vice President of Product Development Exome
More informationGolden Helix s End-to-End Solution for Clinical Labs
Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics
More informationMEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)
Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)
More informationNGS in tissue and liquid biopsy
NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences
More informationBWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space
Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate
More informationIntroduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016
Introduction to genetic variation He Zhang Bioinformatics Core Facility 6/22/2016 Outline Basic concepts of genetic variation Genetic variation in human populations Variation and genetic disorders Databases
More informationGlobal variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
More information!"##"$%#"&!'&$'()$(%&'*& Terapia Pediatrica e Farmacologia dello Sviluppo +,-./&01,23&34,53& :&;.<&2-.=;:3&;.;2>6-6&-.&;&
!!! "#$%&'($)*!+&,-$!.)/+$!+$!01,-$1'$!!"##"$%#"&!'&$'()$(%&'*& Terapia Pediatrica e Farmacologia dello Sviluppo 0$2-3!44566!! +,-./&01,23&34,53&63783.9-.:&;.6-6&-.&;& 582/-:3.3?;/-,.;2&@;5-2>&63:?3:;/-.:&#>A3&B&!-;C3/36&!.&))3'&!(2$&#)$7$23!+$(2$8-$#1'&!+$!177&'[!!
More informationCalling DNA variants SNVs, CNVs, and SVs. Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017
1 Calling DNA variants SNVs, CNVs, and SVs Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017 Calling DNA variants SNVs, CNVs, SVs 2 1. What is a variant? 2. Paired End read
More informationProblem 3: Simulated Rheumatoid Arthritis Data
Problem 3: Simulated Rheumatoid Arthritis Data Michael B Miller Michael Li Gregg Lind Soon-Young Jang The plan
More informationAVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
More informationChIP-seq data analysis
ChIP-seq data analysis Harri Lähdesmäki Department of Computer Science Aalto University November 24, 2017 Contents Background ChIP-seq protocol ChIP-seq data analysis Transcriptional regulation Transcriptional
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationCopy number variation detection and genotyping from exome sequence data
Method Copy number variation detection and genotyping from exome sequence data Niklas Krumm, 1 Peter H. Sudmant, 1 Arthur Ko, 1 Brian J. O Roak, 1 Maika Malig, 1 Bradley P. Coe, 1 NHLBI Exome Sequencing
More informationThe Amazing Brain Webinar Series: Select Topics in Neuroscience and Child Development for the Clinician
The Amazing Brain Webinar Series: Select Topics in Neuroscience and Child Development for the Clinician Part VII Recent Advances in the Genetics of Autism Spectrum Disorders Abha R. Gupta, MD, PhD Jointly
More informationThe feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients
The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients ASSC Scientific Meeting 13 th October 2016 Prof Andrew Barbour UQ SOM
More informationVARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN
VARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN Email: apatwardhan@personalis.com MICHAEL CLARK Email: michael.clark@personalis.com ALEX MORGAN Email:
More informationGinkgo Interactive analysis and quality assessment of single-cell CNV data
Ginkgo Interactive analysis and quality assessment of single-cell CNV data @RobAboukhalil Robert Aboukhalil, Tyler Garvin, Jude Kendall, Timour Baslan, Gurinder S. Atwal, Jim Hicks, Michael Wigler, Michael
More informationHands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
More informationSingle-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationEpigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017
Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of
More informationPROGRESS: Beginning to Understand the Genetic Predisposition to PSC
PROGRESS: Beginning to Understand the Genetic Predisposition to PSC Konstantinos N. Lazaridis, MD Associate Professor of Medicine Division of Gastroenterology and Hepatology Associate Director Center for
More informationAnalysis of Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing
www.sciencemag.org/cgi/content/full/science.1186802/dc1 Supporting Online Material for Analysis of Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing Jared C. Roach, Gustavo Glusman, Arian
More informationJULY 21, Genetics 101: SCN1A. Katie Angione, MS CGC Certified Genetic Counselor CHCO Neurology
JULY 21, 2018 Genetics 101: SCN1A Katie Angione, MS CGC Certified Genetic Counselor CHCO Neurology Disclosures: I have no financial interests or relationships to disclose. Objectives 1. Review genetic
More informationUnderstanding genetics, mutation and other details. Stanley F. Nelson, MD 6/29/18
Understanding genetics, mutation and other details Stanley F. Nelson, MD 6/29/18 1 6 11 16 21 Duchenne muscular dystrophy 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 600 500 400 300 200 100 0 Duchenne/Becker
More informationBelow, we included the point-to-point response to the comments of both reviewers.
To the Editor and Reviewers: We would like to thank the editor and reviewers for careful reading, and constructive suggestions for our manuscript. According to comments from both reviewers, we have comprehensively
More informationMedical Advisory Council: Verified
What is White Sutton Syndrome? White Sutton Syndrome (WHSUS) is a condition characterized by autism and developmental delay and/or intellectual disability, as well as a characteristic facial profile. Children
More informationRaymond Auerbach PhD Candidate, Yale University Gerstein and Snyder Labs August 30, 2012
Elucidating Transcriptional Regulation at Multiple Scales Using High-Throughput Sequencing, Data Integration, and Computational Methods Raymond Auerbach PhD Candidate, Yale University Gerstein and Snyder
More informationCITATION FILE CONTENT/FORMAT
CITATION For any resultant publications using please cite: Matthew A. Field, Vicky Cho, T. Daniel Andrews, and Chris C. Goodnow (2015). "Reliably detecting clinically important variants requires both combined
More informationNeuropsychiatric Disease Working Group Plan June 14, 2016 NHGRI Centers for Common Disease Genomics Program
Neuropsychiatric Disease Working Group Plan June 14, 2016 NHGRI Centers for Common Disease Genomics Program Disease/Phenotype As its inaugural CCDG project, the Neuropsychiatric Working Group (NWG) proposes
More informationNGS for Cancer Predisposition
NGS for Cancer Predisposition Colin Pritchard MD, PhD University of Washington Dept. of Lab Medicine AMP Companion Society Meeting USCAP Boston March 22, 2015 Disclosures I am an employee of the University
More informationLarge-scale identity-by-descent mapping discovers rare haplotypes of large effect. Suyash Shringarpure 23andMe, Inc. ASHG 2017
Large-scale identity-by-descent mapping discovers rare haplotypes of large effect Suyash Shringarpure 23andMe, Inc. ASHG 2017 1 Why care about rare variants of large effect? Months from randomization 2
More informationComputer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015
Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a
More informationInteractive analysis and quality assessment of single-cell copy-number variations
Interactive analysis and quality assessment of single-cell copy-number variations Tyler Garvin, Robert Aboukhalil, Jude Kendall, Timour Baslan, Gurinder S. Atwal, James Hicks, Michael Wigler, Michael C.
More informationClinical Genomics of Neuropsychiatric Illnesses. Gholson Lyon, M.D. Ph.D.
Clinical Genomics of Neuropsychiatric Illnesses Gholson Lyon, M.D. Ph.D. Jason O Rawe Yiyang Wu Han Fang Max Doerfel Acknowledgments MarQn Reese Edward Kiruluta Reid Robison David MiPelman Gareth Highnam
More informationCHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE
CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE is_clinical dbsnp MITO GENE chr1 13273 G C heterozygous - - -. - DDX11L1 chr1 949654 A G Homozygous 52 - - rs8997 - ISG15 chr1 1021346 A G heterozygous
More informationTranscriptome and isoform reconstruc1on with short reads. Tangled up in reads
Transcriptome and isoform reconstruc1on with short reads Tangled up in reads Topics of this lecture Mapping- based reconstruc1on methods Case study: The domes1c dog De- novo reconstruc1on method Trinity
More informationSupplementary Figure 1
Supplementary Figure 1 An example of the gene-term-disease network automatically generated by Phenolyzer web server for 'autism'. The largest word represents the user s input term, Autism. The pink round
More informationDMD Genetics: complicated, complex and critical to understand
DMD Genetics: complicated, complex and critical to understand Stanley Nelson, MD Professor of Human Genetics, Pathology and Laboratory Medicine, and Psychiatry Co Director, Center for Duchenne Muscular
More informationAD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients
AD (Leave blank) Award Number: W81XWH-12-1-0444 TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients PRINCIPAL INVESTIGATOR: Mark A. Watson, MD PhD CONTRACTING ORGANIZATION:
More informationEntering the era of mega-genomics
Entering the era of mega-genomics Michael Schatz March 2, 2012 UNC Charlotte Schatz Lab Overview Human Genetics Computation Sequencing Modeling Plant Genomics Outline 1. Milestones in genomics 1. Sanger
More informationDOES THE BRCAX GENE EXIST? FUTURE OUTLOOK
CHAPTER 6 DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK Genetic research aimed at the identification of new breast cancer susceptibility genes is at an interesting crossroad. On the one hand, the existence
More informationAnalyse de données de séquençage haut débit
Analyse de données de séquençage haut débit Vincent Lacroix Laboratoire de Biométrie et Biologie Évolutive INRIA ERABLE 9ème journée ITS 21 & 22 novembre 2017 Lyon https://its.aviesan.fr Sequencing is
More informationDe Novo Viral Quasispecies Assembly using Overlap Graphs
De Novo Viral Quasispecies Assembly using Overlap Graphs Alexander Schönhuth joint with Jasmijn Baaijens, Amal Zine El Aabidine, Eric Rivals Milano 18th of November 2016 Viral Quasispecies Assembly: HaploClique
More informationIso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing
Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing PacBio Americas User Group Meeting Sample Prep Workshop June.27.2017 Tyson Clark, Ph.D. For Research Use Only. Not
More informationNature Neuroscience: doi: /nn Supplementary Figure 1 Density plots of sequence coverage in the UK10K, INTERVAL and DDD data sets.
Supplementary Figure 1 Density plots of sequence coverage in the UK10K, INTERVAL and DDD data sets. Per-sample sequence coverage was calculated and summarised from exome sequencing data generated in the
More informationSupplemental Data. De Novo Truncating Mutations in WASF1. Cause Intellectual Disability with Seizures
The American Journal of Human Genetics, Volume 13 Supplemental Data De Novo Truncating Mutations in WASF1 Cause Intellectual Disability with Seizures Yoko Ito, Keren J. Carss, Sofia T. Duarte, Taila Hartley,
More informationWelcome to the Genetic Code: An Overview of Basic Genetics. October 24, :00pm 3:00pm
Welcome to the Genetic Code: An Overview of Basic Genetics October 24, 2016 12:00pm 3:00pm Course Schedule 12:00 pm 2:00 pm Principles of Mendelian Genetics Introduction to Genetics of Complex Disease
More informationTranscript reconstruction
Transcript reconstruction Summary I Data types, file formats and utilities Annotation: Genomic regions Genes Peaks bedtools Alignment: Map reads BAM/SAM Samtools Aggregation: Summary files Wig (UCSC) TDF
More informationSequencing studies implicate inherited mutations in autism
NEWS Sequencing studies implicate inherited mutations in autism BY EMILY SINGER 23 JANUARY 2013 1 / 5 Unusual inheritance: Researchers have found a relatively mild mutation in a gene linked to Cohen syndrome,
More informationApproach to Mental Retardation and Developmental Delay. SR Ghaffari MSc MD PhD
Approach to Mental Retardation and Developmental Delay SR Ghaffari MSc MD PhD Introduction Objectives Definition of MR and DD Classification Epidemiology (prevalence, recurrence risk, ) Etiology Importance
More informationMEDICAL GENOMICS LABORATORY. Non-NF1 RASopathy panel by Next-Gen Sequencing and Deletion/Duplication Analysis of SPRED1 (NNP-NG)
Non-NF1 RASopathy panel by Next-Gen Sequencing and Deletion/Duplication Analysis of SPRED1 (NNP-NG) Ordering Information Acceptable specimen types: Blood (3-6ml EDTA; no time limitations associated with
More informationPerformance comparison of two commercial human whole-exome capture systems on formalin-fixed paraffinembedded lung adenocarcinoma samples
Bonfiglio et al. BMC Cancer (2016) 16:692 DOI 10.1186/s12885-016-2720-4 RESEARCH ARTICLE Open Access Performance comparison of two commercial human whole-exome capture systems on formalin-fixed paraffinembedded
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Jacobsen E, Shanmugam V, Jagannathan J. Rosai Dorfman disease
More information