DNA-seq Bioinformatics Analysis: Copy Number Variation

Size: px
Start display at page:

Download "DNA-seq Bioinformatics Analysis: Copy Number Variation"

Transcription

1 DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France

2 NGS Applications 5C HiC DNA-seq Chip-seq RNA-seq ENCODE project 2

3 Whole Genome or Target DNA sequencing Whole Genome vs Target Sequencing Genome Amplicon Sequencing Sequencing of a dedicated panel of genes/hotspots DNA fragmentation Hybridization PCR amplification Separation Elution Illumina technology (Hiseq, Miseq, NextSeq) Mostly IonTorrent technology (PGM/Proton) 3

4 Normalized copy number DNA-seq: some applications Detection of: - Single Nucleotide Variations (SNVs) & Insertions/Deletions (Indels) in germline sample in tumoral sample (somatic analysis) 3bp Del SNV - Copy Number Variations (CNV): large duplication or deletion event Tumor/Germline Exomes Germline events among a cohort Distinction between Capture & Amplicon sequencing Genomic position (3-kb window), chr5 4

5 Variant Calling: germline VS somatic Expectation: Homozygous variant: 0/0 (0% alternative allele) or 1/1 (100% alternative allele) Heterozygous variant: 0/1 (50% reference / 50% alternative) Reality in normal samples: sequencing data = noisy 0/0 : [0% - 25%[ 0/1 : [25%-75%] 1/1 : ]75%-100%] 0/0 0/1 1/1 Allelic ratio (%) Reality in tumor samples: Tumor = mixture of tumor clones & normal cells 0/1 : ]0% - 50%] 1/1 : ]0% - 100%] Normal cells Major clone 5

6 Normalized copy number DNA-seq: some applications Detection of: - Single Nucleotide Variations (SNVs) & Insertions/Deletions (Indels) in germline sample in tumoral sample (somatic analysis) 3bp Del SNV - Copy Number Variations (CNV): large duplication or deletion event Tumor/Germline Exomes Germline events among a cohort Distinction between Capture & Amplicon sequencing Genomic position (3-kb window), chr5 6

7 CNV detection methods Different methods: FISH: fluorescence in situ hybridization acgh: array-comparative genomic hybridization SNP array: genome-wide SNP array HTS: High-Throughput sequencing 7

8 Previous Workflow Reference Genome (Fasta) Reads (Fastq) Quality Control (QC1/QC2) Mapping PCR duplicates Marking MarkDup /!\ Not for small targets / amplicon design /!\ QC3 Aligned and preprocessed reads (BAM) Marked PCR duplicates - Intersected on target regions - Realigned around indels - Recalibrated Target regions (bed) Target Intersection Intersect Bam [Optional] Preprocess part Local realignment around indels [Optional] Preprocess part Base Quality Score Recalibration 8

9 Copy Number Variation Germlines Aligned and preprocessed Reads (BAM) Copy Number Variation Tumor Aligned and preprocessed Reads (BAM) Germline Aligned and preprocessed Reads (BAM) Copy Number Alteration 9

10 Copy Number Variation in Exome-seq Detection of large-scale variation events: amplification, gain, loss, deletion Criteria: (Somatic Germline/Somatic) %GC/Mappability Normalization Ploidy/Cellularity Estimation LOH Detection (Allele specific) Sub-clonal events detection Absence of Control Sample No tool meets all those criteria yet: Sequenza, Titan, facets : %GC Normalization, Allele-Specific (LOH), Cellularity Estimation, sub-clonal events (Facets, Titan) but require a normal sample CopywriteR: use off-target % to estimate CNV without normal samples Contra: Germline event using reference germlines to normalize read depth 10

11 Metrics Zhao et al., BMC Bioinformatics

12 Normalization Normalization by: GC content Mappability (uniqueness of the region) Matched normal sample B-Allele Frequency Homozygous SNPs: BAF at 0 (AA) or 1 (BB) Heterozygous SNPs: BAF at 0.5 (AB) Allelic imbalance : intermediate values (AAB : 66%/33%) Help assess copy number Allows to determine LOH (Loss-of-heterozygosity) for somatic samples 12

13 Copy Number Variation & Amplicon-seq [not in Galaxy] CNVpanelizer: germline CNV event using references sample (other germlines) IonCopy: CNA detection without match-normal sample 13

14 Recurrent event [not in Galaxy] Fragl plot: representation of the frequency of each event among the cohort (red: gain/amplification, green: loss/deletion) 14

15 Workflow Germline1 Aligned and preprocessed Reads (BAM) Germline N Aligned and preprocessed Reads (BAM) Germline Copy Number Detection [Not in Galaxy ] - Cohort comparison - Litterature Comparison Tumor Aligned and preprocessed Reads (BAM) Germline Aligned and preprocessed Reads (BAM) Somatic Copy Number Detection [Not in Galaxy ] - Cohort comparison - Litterature Comparison 15

16 Dataset for somatic CNV Public data: Pair of Lung Adenocarcinoma Tumor & Match Germline Paired-end reads of 100bp, Illumina HiSeq2000 Available in EBI-SRA: ERP Corresponding RNA-seq data available (ERP001058, Ju et al., Genome Res, 2012) Use of Sequenza: use of paired tumor-normal DNA sequencing data to estimate tumor cellularity and ploidy & to calculate allele-specific CN profiles Tumor Aligned and preprocessed Reads (BAM) Germline Aligned and preprocessed Reads (BAM) Somatic Copy Number Detection [Not in Galaxy ] - Cohort comparison - Litterature Comparison 16

17 Import Data 1. Go to 2. Go to «Shared Data» in the top menu then «Published Histories» 3. Click on «TP_CNV_SEQUENZA_FILES» then on «Import History» 17

18 Create Mpileup files In the search bar, find «Mpileup» : Create a per-base description of the alignments Repeat for the normal BAM file. Rename the outputs to identify Tumor from Germline 18

19 Call CNV using Sequenza In the search bar, find «Sequenza» Use read depth ratio (tumor/normal) & BAF extracted from mpileup files 19

20 Exome Somatic CNV: Sequenza B-Allele Frequency Depth Ratio Copy Number Allele-Spefic Copy Number 20

21 Datasets for Germline events Public data: Pair of Tumor & Match Germline + duplicate germline Available in Contra sourceforge repository Use of Contra: comparison of base-level log-ratios calculated from read depth between case and control samples Germline1 Aligned and preprocessed Reads (BAM) Germline N Aligned and preprocessed Reads (BAM) Germline Copy Number Detection [Not in Galaxy ] - Cohort comparison - Litterature Comparison 21

22 Import Data 1. Go to 2. Go to «Shared Data» in the top menu then «Published Histories» 3. Click on «TP_CNV_CONTRA_FILES» then on «Import History» 22

23 Create baseline from germlines In the search bar, find «Baseline : Control files for Contra» 23

24 Call CNV using Contra In the search bar, find «Contra Copy Number analysis» Set «bed» & «large deletion» to true in the optional parameters 24

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,

More information

Analysis with SureCall 2.1

Analysis with SureCall 2.1 Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis

More information

Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies

Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Stanford Biostatistics Workshop Pierre Neuvial with Henrik Bengtsson and Terry Speed Department of Statistics, UC Berkeley

More information

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation

More information

Chip Seq Peak Calling in Galaxy

Chip Seq Peak Calling in Galaxy Chip Seq Peak Calling in Galaxy Chris Seward PowerPoint by Pei-Chen Peng Chip-Seq Peak Calling in Galaxy Chris Seward 2018 1 Introduction This goals of the lab are as follows: 1. Gain experience using

More information

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant

More information

Performance Characteristics BRCA MASTR Plus Dx

Performance Characteristics BRCA MASTR Plus Dx Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Table of Contents 1. Workflow... 4 2. Performance Characteristics

More information

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.

More information

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and

More information

P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.

P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences

More information

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department

More information

Investigating rare diseases with Agilent NGS solutions

Investigating rare diseases with Agilent NGS solutions Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe

More information

Introduction to LOH and Allele Specific Copy Number User Forum

Introduction to LOH and Allele Specific Copy Number User Forum Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.

More information

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic

More information

Molecular Characterization of Tumors Using Next-Generation Sequencing

Molecular Characterization of Tumors Using Next-Generation Sequencing Molecular Characterization of Tumors Using Next-Generation Sequencing Using BaseSpace to visualize molecular changes in cancer. Tumor-Normal Sequencing Data in BaseSpace To enable researchers new to next-generation

More information

Cytogenetics 101: Clinical Research and Molecular Genetic Technologies

Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these

More information

Detection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit

Detection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit APPLICATION NOTE Ion PGM System Detection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit Key findings The Ion PGM System, in concert with the Ion ReproSeq PGS View Kit and Ion Reporter

More information

Genome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl.

Genome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl. GenomeVIP: the Genome Institute at Washington University A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud R. Jay Mashl October 20, 2014 Turnkey Variant

More information

Detection of copy number variations in PCR-enriched targeted sequencing data

Detection of copy number variations in PCR-enriched targeted sequencing data Detection of copy number variations in PCR-enriched targeted sequencing data German Demidov Parseq Lab, Saint-Petersburg University of Russian Academy of Sciences, current: Center for Genomic Regulation

More information

Golden Helix s End-to-End Solution for Clinical Labs

Golden Helix s End-to-End Solution for Clinical Labs Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics

More information

Please Silence Your Cell Phones. Thank You

Please Silence Your Cell Phones. Thank You Please Silence Your Cell Phones Thank You Utility of NGS and Comprehensive Genomic Profiling in Hematopathology Practice Maria E. Arcila M.D. Memorial Sloan Kettering Cancer Center New York, NY Disclosure

More information

Andrew Parrish, Richard Caswell, Garan Jones, Christopher M. Watson, Laura A. Crinnion 3,4, Sian Ellard 1,2

Andrew Parrish, Richard Caswell, Garan Jones, Christopher M. Watson, Laura A. Crinnion 3,4, Sian Ellard 1,2 METHOD ARTICLE An enhanced method for targeted next generation sequencing copy number variant detection using ExomeDepth [version 1; referees: 1 approved, 1 approved with reservations] 1 2 1 3,4 Andrew

More information

Data mining with Ensembl Biomart. Stéphanie Le Gras

Data mining with Ensembl Biomart. Stéphanie Le Gras Data mining with Ensembl Biomart Stéphanie Le Gras (slegras@igbmc.fr) Guidelines Genome data Genome browsers Getting access to genomic data: Ensembl/BioMart 2 Genome Sequencing Example: Human genome 2000:

More information

AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients

AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients AD (Leave blank) Award Number: W81XWH-12-1-0444 TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients PRINCIPAL INVESTIGATOR: Mark A. Watson, MD PhD CONTRACTING ORGANIZATION:

More information

Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing

Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing Karl V. Voelkerding, MD Professor of Pathology University of Utah Medical

More information

CNV Detection and Interpretation in Genomic Data

CNV Detection and Interpretation in Genomic Data CNV Detection and Interpretation in Genomic Data Benjamin W. Darbro, M.D., Ph.D. Assistant Professor of Pediatrics Director of the Shivanand R. Patil Cytogenetics and Molecular Laboratory Overview What

More information

NEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca

NEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca NEXT GENERATION SEQUENCING R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca SANGER SEQUENCING 5 3 3 5 + Capillary Electrophoresis DNA NEXT GENERATION SEQUENCING SOLEXA-ILLUMINA

More information

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Fig. 1: Quality assessment of formalin-fixed paraffin-embedded (FFPE)-derived DNA and nuclei. (a) Multiplex PCR analysis of unrepaired and repaired bulk FFPE gdna from

More information

Understanding DNA Copy Number Data

Understanding DNA Copy Number Data Understanding DNA Copy Number Data Adam B. Olshen Department of Epidemiology and Biostatistics Helen Diller Family Comprehensive Cancer Center University of California, San Francisco http://cc.ucsf.edu/people/olshena_adam.php

More information

NGS in tissue and liquid biopsy

NGS in tissue and liquid biopsy NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences

More information

Mosaic loss of chromosome Y in peripheral blood is associated with shorter survival and higher risk of cancer

Mosaic loss of chromosome Y in peripheral blood is associated with shorter survival and higher risk of cancer Supplementary Information Mosaic loss of chromosome Y in peripheral blood is associated with shorter survival and higher risk of cancer Lars A. Forsberg, Chiara Rasi, Niklas Malmqvist, Hanna Davies, Saichand

More information

DNA Sequence Bioinformatics Analysis with the Galaxy Platform

DNA Sequence Bioinformatics Analysis with the Galaxy Platform DNA Sequence Bioinformatics Analysis with the Galaxy Platform University of São Paulo, Brazil 28 July - 1 August 2014 Dave Clements Johns Hopkins University Robson Francisco de Souza University of São

More information

The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients

The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients ASSC Scientific Meeting 13 th October 2016 Prof Andrew Barbour UQ SOM

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Rates of different mutation types in CRC.

Nature Genetics: doi: /ng Supplementary Figure 1. Rates of different mutation types in CRC. Supplementary Figure 1 Rates of different mutation types in CRC. (a) Stratification by mutation type indicates that C>T mutations occur at a significantly greater rate than other types. (b) As for the

More information

Genome-wide copy-number calling (CNAs not CNVs!) Dr Geoff Macintyre

Genome-wide copy-number calling (CNAs not CNVs!) Dr Geoff Macintyre Genome-wide copy-number calling (CNAs not CNVs!) Dr Geoff Macintyre Structural variation (SVs) Copy-number variations C Deletion A B C Balanced rearrangements A B A B C B A C Duplication Inversion Causes

More information

Recherche de variants génomiques en oncologie clinique. Avec des diapos, données & scripts R de: Yannick Boursin, IGR Bastien Job, IGR

Recherche de variants génomiques en oncologie clinique. Avec des diapos, données & scripts R de: Yannick Boursin, IGR Bastien Job, IGR Recherche de variants génomiques en oncologie clinique Avec des diapos, données & scripts R de: Yannick Boursin, IGR Bastien Job, IGR Génétique constitutionnelle At hospital Blood sample Sequence gene

More information

Cancer Gene Panels. Dr. Andreas Scherer. Dr. Andreas Scherer President and CEO Golden Helix, Inc. Twitter: andreasscherer

Cancer Gene Panels. Dr. Andreas Scherer. Dr. Andreas Scherer President and CEO Golden Helix, Inc. Twitter: andreasscherer Cancer Gene Panels Dr. Andreas Scherer Dr. Andreas Scherer President and CEO Golden Helix, Inc. scherer@goldenhelix.com Twitter: andreasscherer About Golden Helix - Founded in 1998 - Main outside investor:

More information

PSSV User Manual (V1.0)

PSSV User Manual (V1.0) PSSV User Manual (V1.0) 1. Introduction A novel pattern-based probabilistic approach, PSSV, is developed to identify somatic structural variations from WGS data. Specifically, discordant and concordant

More information

Identification of genomic alterations in cervical cancer biopsies by exome sequencing

Identification of genomic alterations in cervical cancer biopsies by exome sequencing Chapter- 4 Identification of genomic alterations in cervical cancer biopsies by exome sequencing 105 4.1 INTRODUCTION Athough HPV has been identified as the prime etiological factor for cervical cancer,

More information

Simple, rapid, and reliable RNA sequencing

Simple, rapid, and reliable RNA sequencing Simple, rapid, and reliable RNA sequencing RNA sequencing applications RNA sequencing provides fundamental insights into how genomes are organized and regulated, giving us valuable information about the

More information

CNV detection. Introduction and detection in NGS data. G. Demidov 1,2. NGSchool2016. Centre for Genomic Regulation. CNV detection. G.

CNV detection. Introduction and detection in NGS data. G. Demidov 1,2. NGSchool2016. Centre for Genomic Regulation. CNV detection. G. Introduction and detection in NGS data 1,2 1 Genomic and Epigenomic Variation in Disease group, Centre for Genomic Regulation 2 Universitat Pompeu Fabra NGSchool2016 methods: methods Outline methods: methods

More information

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)

More information

ChIP-seq data analysis

ChIP-seq data analysis ChIP-seq data analysis Harri Lähdesmäki Department of Computer Science Aalto University November 24, 2017 Contents Background ChIP-seq protocol ChIP-seq data analysis Transcriptional regulation Transcriptional

More information

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11 ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N

More information

Nature Biotechnology: doi: /nbt.1904

Nature Biotechnology: doi: /nbt.1904 Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is

More information

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold

More information

High-resolution characterization of sequence signatures due to non-random cleavage of cell-free DNA

High-resolution characterization of sequence signatures due to non-random cleavage of cell-free DNA Chandrananda et al. BMC Medical Genomics (2015) 8:29 DOI 10.1186/s12920-015-0107-z RESEARCH ARTICLE High-resolution characterization of sequence signatures due to non-random cleavage of cell-free DNA Dineika

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

Copy Number Varia/on Detec/on. Alex Mawla UCD Genome Center Bioinforma5cs Core Tuesday June 16, 2015

Copy Number Varia/on Detec/on. Alex Mawla UCD Genome Center Bioinforma5cs Core Tuesday June 16, 2015 Copy Number Varia/on Detec/on Alex Mawla UCD Genome Center Bioinforma5cs Core Tuesday June 16, 2015 Today s Goals Understand the applica5on and capabili5es of using targe5ng sequencing and CNV calling

More information

Somatic cancer applications of NGS in in vitro Diagnostics.

Somatic cancer applications of NGS in in vitro Diagnostics. Somatic cancer applications of NGS in in vitro Diagnostics. Nitin Udar PhD In Vitro Diagnsotics Division Illumina, Inc. 2013 Illumina, Inc. All rights reserved. Illumina, IlluminaDx, BaseSpace, BeadArray,

More information

Nature Genetics: doi: /ng Supplementary Figure 1. SEER data for male and female cancer incidence from

Nature Genetics: doi: /ng Supplementary Figure 1. SEER data for male and female cancer incidence from Supplementary Figure 1 SEER data for male and female cancer incidence from 1975 2013. (a,b) Incidence rates of oral cavity and pharynx cancer (a) and leukemia (b) are plotted, grouped by males (blue),

More information

Nature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data.

Nature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data. Supplementary Figure 1 PCA for ancestry in SNV data. (a) EIGENSTRAT principal-component analysis (PCA) of SNV genotype data on all samples. (b) PCA of only proband SNV genotype data. (c) PCA of SNV genotype

More information

WHOLE EXOME SEQUENCING PIPELINE EVALUATION AND MUTATION DETECTION IN ESOPHAGEAL CANCER PATIENTS

WHOLE EXOME SEQUENCING PIPELINE EVALUATION AND MUTATION DETECTION IN ESOPHAGEAL CANCER PATIENTS WHOLE EXOME SEQUENCING PIPELINE EVALUATION AND MUTATION DETECTION IN ESOPHAGEAL CANCER PATIENTS SUMMARY Tran Thi Bich Ngoc 1 ; Ho Viet Hoanh 2 ; Vu Phuong Nhung 1 ; Nguyen Hai Ha 1 Nguyen Van Ba 2 ; Nguyen

More information

Targeted qpcr. Debate on PGS Technology: Targeted vs. Whole genome approach. Discolsure Stake shareholder of GENETYX S.R.L

Targeted qpcr. Debate on PGS Technology: Targeted vs. Whole genome approach. Discolsure Stake shareholder of GENETYX S.R.L Antonio Capalbo, PhD Laboratory Director GENETYX, reproductive genetics laboratory, Italy PGT responsible GENERA centers for reproductive medicine, Italy Debate on PGS Technology: Targeted vs. Whole genome

More information

PG-Seq NGS Kit for Preimplantation Genetic Screening

PG-Seq NGS Kit for Preimplantation Genetic Screening Application Note: PG-Seq Validation Study PG-Seq NGS Kit for Preimplantation Genetic Screening Validation using Multi (5-10) Cells and Single Cells from euploid and aneuploid cell lines Introduction Advances

More information

High Throughput Sequence (HTS) data analysis. Lei Zhou

High Throughput Sequence (HTS) data analysis. Lei Zhou High Throughput Sequence (HTS) data analysis Lei Zhou (leizhou@ufl.edu) High Throughput Sequence (HTS) data analysis 1. Representation of HTS data. 2. Visualization of HTS data. 3. Discovering genomic

More information

Accel-Amplicon Panels

Accel-Amplicon Panels Accel-Amplicon Panels Amplicon sequencing has emerged as a reliable, cost-effective method for ultra-deep targeted sequencing. This highly adaptable approach is especially applicable for in-depth interrogation

More information

Tumor mutational burden and its transition towards the clinic

Tumor mutational burden and its transition towards the clinic Tumor mutational burden and its transition towards the clinic G C C A T C A C Wolfram Jochum Institute of Pathology Kantonsspital St.Gallen CH-9007 St.Gallen wolfram.jochum@kssg.ch 30th European Congress

More information

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes

More information

Supplementary Figure 1. Estimation of tumour content

Supplementary Figure 1. Estimation of tumour content Supplementary Figure 1. Estimation of tumour content a, Approach used to estimate the tumour content in S13T1/T2, S6T1/T2, S3T1/T2 and S12T1/T2. Tissue and tumour areas were evaluated by two independent

More information

Below, we included the point-to-point response to the comments of both reviewers.

Below, we included the point-to-point response to the comments of both reviewers. To the Editor and Reviewers: We would like to thank the editor and reviewers for careful reading, and constructive suggestions for our manuscript. According to comments from both reviewers, we have comprehensively

More information

Calling DNA variants SNVs, CNVs, and SVs. Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017

Calling DNA variants SNVs, CNVs, and SVs. Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017 1 Calling DNA variants SNVs, CNVs, and SVs Steve Laurie Variant Effect Predictor Training Course Prague, 6 th November 2017 Calling DNA variants SNVs, CNVs, SVs 2 1. What is a variant? 2. Paired End read

More information

5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff

5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff 5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff National molecular screening of patients with lung cancer for a national trial of multiple novel agents. 2000 NSCLC patients/year (late

More information

cn.mops - Mixture of Poissons for CNV detection in NGS data Günter Klambauer Institute of Bioinformatics, Johannes Kepler University Linz

cn.mops - Mixture of Poissons for CNV detection in NGS data Günter Klambauer Institute of Bioinformatics, Johannes Kepler University Linz Software Manual Institute of Bioinformatics, Johannes Kepler University Linz cn.mops - Mixture of Poissons for CNV detection in NGS data Günter Klambauer Institute of Bioinformatics, Johannes Kepler University

More information

Accessing and Using ENCODE Data Dr. Peggy J. Farnham

Accessing and Using ENCODE Data Dr. Peggy J. Farnham 1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000

More information

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why

More information

Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters

Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters XXXth International Symposium on Technical Innovations in Laboratory Hematology Honolulu, Hawaii

More information

RNA SEQUENCING AND DATA ANALYSIS

RNA SEQUENCING AND DATA ANALYSIS RNA SEQUENCING AND DATA ANALYSIS Length of mrna transcripts in the human genome 5,000 5,000 4,000 3,000 2,000 4,000 1,000 0 0 200 400 600 800 3,000 2,000 1,000 0 0 2,000 4,000 6,000 8,000 10,000 Length

More information

Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection

Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin

More information

A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis

A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis Jian Xu, Ph.D. Children s Research Institute, UTSW Introduction Outline Overview of genomic and next-gen sequencing technologies

More information

Fluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS

Fluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor

More information

An integrated map of genetic variation from 1092 human genomes

An integrated map of genetic variation from 1092 human genomes SUPPLEMENTAL METHODS AND MATERIALS Whole genome sequencing Alignment: Short insert paired-end reads were aligned to the GRCh37 reference human genome with 1000 genomes decoy contigs using BWA-mem(1). Somatic

More information

SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN

SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN Structural variation (SV) Variants larger than 50bps Affect

More information

ChIP-seq hands-on. Iros Barozzi, Campus IFOM-IEO (Milan) Saverio Minucci, Gioacchino Natoli Labs

ChIP-seq hands-on. Iros Barozzi, Campus IFOM-IEO (Milan) Saverio Minucci, Gioacchino Natoli Labs ChIP-seq hands-on Iros Barozzi, Campus IFOM-IEO (Milan) Saverio Minucci, Gioacchino Natoli Labs Main goals Becoming familiar with essential tools and formats Visualizing and contextualizing raw data Understand

More information

Figure S4. 15 Mets Whole Exome. 5 Primary Tumors Cancer Panel and WES. Next Generation Sequencing

Figure S4. 15 Mets Whole Exome. 5 Primary Tumors Cancer Panel and WES. Next Generation Sequencing Figure S4 Next Generation Sequencing 15 Mets Whole Exome 5 Primary Tumors Cancer Panel and WES Get coverage of all variant loci for all three Mets Variant Filtering Sequence Alignments Index and align

More information

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate

More information

Genomic structural variation

Genomic structural variation Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural

More information

Illuminating the genetics of complex human diseases

Illuminating the genetics of complex human diseases Illuminating the genetics of complex human diseases Michael Schatz Sept 27, 2012 Beyond the Genome @mike_schatz / #BTG2012 Outline 1. De novo mutations in human diseases 1. Autism Spectrum Disorder 2.

More information

The Epigenome Tools 2: ChIP-Seq and Data Analysis

The Epigenome Tools 2: ChIP-Seq and Data Analysis The Epigenome Tools 2: ChIP-Seq and Data Analysis Chongzhi Zang zang@virginia.edu http://zanglab.com PHS5705: Public Health Genomics March 20, 2017 1 Outline Epigenome: basics review ChIP-seq overview

More information

Supplementary Note. Nature Genetics: doi: /ng.2928

Supplementary Note. Nature Genetics: doi: /ng.2928 Supplementary Note Loss of heterozygosity analysis (LOH). We used VCFtools v0.1.11 to extract only singlenucleotide variants with minimum depth of 15X and minimum mapping quality of 20 to create a ped

More information

Identifying Mutations Responsible for Rare Disorders Using New Technologies

Identifying Mutations Responsible for Rare Disorders Using New Technologies Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance

More information

Nature Medicine: doi: /nm.4439

Nature Medicine: doi: /nm.4439 Figure S1. Overview of the variant calling and verification process. This figure expands on Fig. 1c with details of verified variants identification in 547 additional validation samples. Somatic variants

More information

Structural Variation and Medical Genomics

Structural Variation and Medical Genomics Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,

More information

Session 4 Rebecca Poulos

Session 4 Rebecca Poulos The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 20

More information

underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The

underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The Supplementary Figures Figure S1. Patient cohorts and study design. To define and interrogate the genetic alterations underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The

More information

Figure S2. Distribution of acgh probes on all ten chromosomes of the RIL M0022

Figure S2. Distribution of acgh probes on all ten chromosomes of the RIL M0022 96 APPENDIX B. Supporting Information for chapter 4 "changes in genome content generated via segregation of non-allelic homologs" Figure S1. Potential de novo CNV probes and sizes of apparently de novo

More information

No mutations were identified.

No mutations were identified. Hereditary High Cholesterol Test ORDERING PHYSICIAN PRIMARY CONTACT SPECIMEN Report date: Aug 1, 2017 Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA Kelly Peters Sample Medical Group 123

More information

White Paper. Copy number variant detection. Sample to Insight. August 19, 2015

White Paper. Copy number variant detection. Sample to Insight. August 19, 2015 White Paper Copy number variant detection August 19, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 Fax: +45 86 20 12 22 www.clcbio.com

More information

cn.mops - Mixture of Poissons for CNV detection in NGS data Günter Klambauer Institute of Bioinformatics, Johannes Kepler University Linz

cn.mops - Mixture of Poissons for CNV detection in NGS data Günter Klambauer Institute of Bioinformatics, Johannes Kepler University Linz Software Manual Institute of Bioinformatics, Johannes Kepler University Linz cn.mops - Mixture of Poissons for CNV detection in NGS data Günter Klambauer Institute of Bioinformatics, Johannes Kepler University

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA

Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials

More information

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc.

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc. Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets

More information

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:

More information

Challenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014

Challenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014 Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical

More information

The Cancer Genome Atlas & International Cancer Genome Consortium

The Cancer Genome Atlas & International Cancer Genome Consortium The Cancer Genome Atlas & International Cancer Genome Consortium Session 3 Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 31 st July 2014 1

More information

Copy number and somatic mutations drive tumors

Copy number and somatic mutations drive tumors Detection of copy number alterations, ploidy and loss of heterozygosity across the genome in FFPE specimens Utility for diagnosis and treatment with comparison to FISH-based and as a complement to sequencing

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases.

Nature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases. Supplementary Figure 1 Somatic coding mutations identified by WES/WGS for 83 ATL cases. (a) The percentage of targeted bases covered by at least 2, 10, 20 and 30 sequencing reads (top) and average read

More information

Enterprise Interest Thermo Fisher Scientific / Employee

Enterprise Interest Thermo Fisher Scientific / Employee Enterprise Interest Thermo Fisher Scientific / Employee A next-generation sequencing assay to estimate tumor mutation load from FFPE research samples Fiona Hyland. Director of R&D, Bioinformatics Clinical

More information