Golden Helix s End-to-End Solution for Clinical Labs

Size: px
Start display at page:

Download "Golden Helix s End-to-End Solution for Clinical Labs"

Transcription

1 Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics Solution Providers Hype Cycle for Life sciences

2 Questions during the presentation Use the Questions pane in your GoToWebinar window

3 Golden Helix Golden Helix is a global bioinformatics company founded in Variant Calling Filtering and Annotation Clinical Reports CNV Analysis Pipeline: Run Workflows Variant Warehouse Centralized Annotations Hosted Reports Sharing and Integration GWAS Genomic Prediction Large-N-Population Studies RNA-Seq Large-N CNV-Analysis

4 Cited in over 1,100 peer-reviewed publications

5 Over 350 customers globally

6 Golden Helix Who We Are When you choose a Golden Helix solution, you get more than just software REPUTATION TRUST EXPERIENCE INDUSTRY FOCUS THOUGHT LEADERSHIP COMMUNITY TRAINING SUPPORT RESPONSIVENESS INNOVATION and SPEED CUSTOMIZATIONS

7

8 Secondary Analysis

9 Why Sentieon? Pipeline Improvements Why Improve Broad s GATK Haplotype Caller? GATK Haplotype Caller is the most accurate DNA analysis tool Problem: GATK Haplotype Caller is too Slow Solution Consistent: No down-sampling or thread dependency = no run-to-run differences = More accurate No Javascript: low level C More Robust: Can handle joint genotyping on over 100K samples simultaneously without needing a gvcf Software-only Solution: Easily deployable, easily scalable, and easily upgraded. Two Product Lines DNAseq BWA-GATK Haplotype Caller Tnseq MuTect and MuTec2

10 Performance: Sentieon vs Broad DNAseq TNseq

11 Proven Accuracy Precision FDA Consistency Challenge - Processed single sample consistency - Single biological sample x two library preps - Top overall performance - Highest reproducibility Truth Challenge - Determine accuracy in Truth Set - Highest indel precision - Highest SNP recall

12 Proven Accuracy - ICGC-TCGA DREAM Mutation Calling Challenge Evaluates Somatic Variant Call Accuracy SNV INDEL Structural Variants Sentieon 98.57% Sentieon 98.14% Sentieon 100% Bina/Roche 97.57% Bina/Roche 97.01% Genowis 99.82% Genowis 96.92% OICR GSI 86.99% Gridss 99.63% Sentieon leads in all categories

13 Customizable secondary pipeline CNV caller Sequencer FASTQ Sentieon BAM Linux VCF -Annotate & filter -Clinical reports

14 CNV and LoH Detection VarSeq Calls CNVs on - Gene Panel Data - Exome Data - Whole Genome Data Faster than CMA and MLPA Utilizes existing coverage data Calls CNVs of every size - Small Single Exon Events - Large Cytogenetic Events

15 CNV Detection via NGS CNVs are called from coverage data Challenges - Coverage varies between samples - Coverage fluctuates between targets - Systematic biases impact coverage Solutions - Data Normalization - Reference Sample Comparison

16 CNV calling in VarSeq Reference samples used for normalization Metrics - Z-score: number of standard deviations from reference sample mean - Ratio: sample coverage divided by reference sample mean - VAF: Variant Allele Frequency For Gene Panels and Exomes - Probabilistic model used to call CNVs - Segmentation identifies large cytogenetic events For Whole Genome Data - Targets segmented using Z-scores - Events called based on Z-score and Ratio thresholds

17 VarSeq Full Clinical Stack

18 VarSeq Suite Flexible Simple VarSeq Scalable Variant annotation, filtering, and interpretation Rich visualizations with GenomeBrowse built-in Powerful GUI and command-line interfaces Repeatable workflows

19 Example Workflows Illumina TruSight Cancer Sequencing Panel - Oncogenes & Tumor Suppressor Genes - Drug Targeting Information & Ongoing Clinical Trials Exome Trio Workflow - Casual Variants Associated with Phenotype - Incidental Findings Hereditary Risk Sequencing Panel - Comprehensive coverage of 175 genes with known associations to inherited cardiac conditions, cancers, and other inherited diseases.

20 Sample Data for Cancer Gene Panels Illumina TruSight Cancer Sequencing Panel - Comprehensive coverage of 154 genes designed to target exons of key tumor suppressor genes and frequently cited oncogenes. - BAM and VCF files for each replicate are available VSReports

21 VarSeq Demonstration

22 Sample Data for Exome Trio Workflows NA year old Caucasian Women - Admitted for Symptoms of Acute Gastroenteritis. - Serum testing revealed elevated pancreatic enzymes. - Genetic testing revealed Heterozygosity for CFTR gene mutation Δ F508 Incidental Findings NA12892 NA12891 NA12878

23 VarSeq Demonstration

24 VSWarehouse Variant Warehouse Server A place to archive full VCFs of every sequenced sample Centralized genomic data hosting, integration with other systems Ask the Variant Warehouse: - Have I ever seen this variant in my previous test samples? - At what frequency? (counts as well) - Does this gene contain other rare variants in my cohort? - Did I provide a pathogenicity assessment for this variant? Has that changed? - Has ClinVar changed since that assessment was initially made? - Have I put this variant into a clinical report for any previous samples?

25 Integration with VarSeq VarSeq can Export to Warehouse - Create a new Project - Current project template is used - Add Variants to Existing (data only) Annotate with Warehouse Counts - Allele / Genotype counts computed on warehouse variants (or other sources in template). Remote Assessment Catalogs - Customize databases of variant classifications or internal flags like false-positives. Remote Reports - Central versioning of report - Queryable database of all saved reports, with all data in form ready for EMR/LIMS integration

26 VSWarehouse Centralized Collaboration Project A Project B VSWarehouse Server Group A Group B Collaborators

27 VSWarehouse Centralized Collaboration

28 VarSeq Full Clinical Stack

29 Questions or more info: Request an evaluation of the software at

New Enhancements: GWAS Workflows with SVS

New Enhancements: GWAS Workflows with SVS New Enhancements: GWAS Workflows with SVS August 9 th, 2017 Gabe Rudy VP Product & Engineering 20 most promising Biotech Technology Providers Top 10 Analytics Solution Providers Hype Cycle for Life sciences

More information

Cancer Gene Panels. Dr. Andreas Scherer. Dr. Andreas Scherer President and CEO Golden Helix, Inc. Twitter: andreasscherer

Cancer Gene Panels. Dr. Andreas Scherer. Dr. Andreas Scherer President and CEO Golden Helix, Inc. Twitter: andreasscherer Cancer Gene Panels Dr. Andreas Scherer Dr. Andreas Scherer President and CEO Golden Helix, Inc. scherer@goldenhelix.com Twitter: andreasscherer About Golden Helix - Founded in 1998 - Main outside investor:

More information

Analysis with SureCall 2.1

Analysis with SureCall 2.1 Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis

More information

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and

More information

Investigating rare diseases with Agilent NGS solutions

Investigating rare diseases with Agilent NGS solutions Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe

More information

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation

More information

The Focused Exome service at Bristol Genetics Laboratory

The Focused Exome service at Bristol Genetics Laboratory The Focused Exome service at Bristol Genetics Laboratory Chris Buxton Maggie Williams July 2016 Bristol Clinical exome Service to mid July Validation: Agilent FE kit, NextSeq 500 and new pipeline 1st reports

More information

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole

More information

Fluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS

Fluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor

More information

DNA-seq Bioinformatics Analysis: Copy Number Variation

DNA-seq Bioinformatics Analysis: Copy Number Variation DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq

More information

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant

More information

ACE ImmunoID. ACE ImmunoID. Precision immunogenomics. Precision Genomics for Immuno-Oncology

ACE ImmunoID. ACE ImmunoID. Precision immunogenomics. Precision Genomics for Immuno-Oncology ACE ImmunoID ACE ImmunoID Precision immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. A universal biomarker platform for immuno-oncology Patient response to cancer immunotherapies

More information

PERSONALIZED GENETIC REPORT CLIENT-REPORTED DATA PURPOSE OF THE X-SCREEN TEST

PERSONALIZED GENETIC REPORT CLIENT-REPORTED DATA PURPOSE OF THE X-SCREEN TEST INCLUDED IN THIS REPORT: REVIEW OF YOUR GENETIC INFORMATION RELEVANT TO ENDOMETRIOSIS PERSONAL EDUCATIONAL INFORMATION RELEVANT TO YOUR GENES INFORMATION FOR OBTAINING YOUR ENTIRE X-SCREEN DATA FILE PERSONALIZED

More information

Figure S4. 15 Mets Whole Exome. 5 Primary Tumors Cancer Panel and WES. Next Generation Sequencing

Figure S4. 15 Mets Whole Exome. 5 Primary Tumors Cancer Panel and WES. Next Generation Sequencing Figure S4 Next Generation Sequencing 15 Mets Whole Exome 5 Primary Tumors Cancer Panel and WES Get coverage of all variant loci for all three Mets Variant Filtering Sequence Alignments Index and align

More information

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,

More information

Home Brewed Personalized Genomics

Home Brewed Personalized Genomics Home Brewed Personalized Genomics The Quest for Meaningful Analysis Results of a 23andMe Exome Pilot Trio of Myself, Wife, and Son February 22, 2013 Gabe Rudy, Vice President of Product Development Exome

More information

NGS ONCOPANELS: FDA S PERSPECTIVE

NGS ONCOPANELS: FDA S PERSPECTIVE NGS ONCOPANELS: FDA S PERSPECTIVE CBA Workshop: Biomarker and Application in Drug Development August 11, 2018 Rockville, MD You Li, Ph.D. Division of Molecular Genetics and Pathology Food and Drug Administration

More information

NGS Types of gene dossier applications UKGTN can evaluate

NGS Types of gene dossier applications UKGTN can evaluate NGS Types of gene dossier applications UKGTN can evaluate Jo Whittaker on behalf of the Genetic Test Evaluation Working Group & UKGTN Project team NGS used in a number of ways Replacement technology for

More information

The Deciphering Development Disorders (DDD) project: What a genomic approach can achieve

The Deciphering Development Disorders (DDD) project: What a genomic approach can achieve The Deciphering Development Disorders (DDD) project: What a genomic approach can achieve RCP ADVANCED MEDICINE, LONDON FEB 5 TH 2018 HELEN FIRTH DM FRCP DCH, SANGER INSTITUTE 3,000,000,000 bases in each

More information

Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing

Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing Karl V. Voelkerding, MD Professor of Pathology University of Utah Medical

More information

Performance Characteristics BRCA MASTR Plus Dx

Performance Characteristics BRCA MASTR Plus Dx Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Table of Contents 1. Workflow... 4 2. Performance Characteristics

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Rates of different mutation types in CRC.

Nature Genetics: doi: /ng Supplementary Figure 1. Rates of different mutation types in CRC. Supplementary Figure 1 Rates of different mutation types in CRC. (a) Stratification by mutation type indicates that C>T mutations occur at a significantly greater rate than other types. (b) As for the

More information

Enterprise Interest Thermo Fisher Scientific / Employee

Enterprise Interest Thermo Fisher Scientific / Employee Enterprise Interest Thermo Fisher Scientific / Employee A next-generation sequencing assay to estimate tumor mutation load from FFPE research samples Fiona Hyland. Director of R&D, Bioinformatics Clinical

More information

Supplementary Tables. Supplementary Figures

Supplementary Tables. Supplementary Figures Supplementary Files for Zehir, Benayed et al. Mutational Landscape of Metastatic Cancer Revealed from Prospective Clinical Sequencing of 10,000 Patients Supplementary Tables Supplementary Table 1: Sample

More information

AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients

AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients AD (Leave blank) Award Number: W81XWH-12-1-0444 TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients PRINCIPAL INVESTIGATOR: Mark A. Watson, MD PhD CONTRACTING ORGANIZATION:

More information

NGS Gateway Lab Services

NGS Gateway Lab Services TM NGS Gateway Lab Services Accelerating Precision Medicine Design a Complete Genomic Testing Portfolio with Turnkey Assays About NGS Gateway Lab Services TM Designed to provide a gateway to your own in-house

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department

More information

NGS IN ONCOLOGY: FDA S PERSPECTIVE

NGS IN ONCOLOGY: FDA S PERSPECTIVE NGS IN ONCOLOGY: FDA S PERSPECTIVE ASQ Biomed/Biotech SIG Event April 26, 2018 Gaithersburg, MD You Li, Ph.D. Division of Molecular Genetics and Pathology Food and Drug Administration (FDA) Center for

More information

Identifying Mutations Responsible for Rare Disorders Using New Technologies

Identifying Mutations Responsible for Rare Disorders Using New Technologies Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance

More information

Benefits and pitfalls of new genetic tests

Benefits and pitfalls of new genetic tests Benefits and pitfalls of new genetic tests Amanda Krause Division of Human Genetics, NHLS and University of the Witwatersrand Definition of Genetic Testing the analysis of human DNA, RNA, chromosomes,

More information

Detection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit

Detection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit APPLICATION NOTE Ion PGM System Detection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit Key findings The Ion PGM System, in concert with the Ion ReproSeq PGS View Kit and Ion Reporter

More information

Molecular Characterization of Tumors Using Next-Generation Sequencing

Molecular Characterization of Tumors Using Next-Generation Sequencing Molecular Characterization of Tumors Using Next-Generation Sequencing Using BaseSpace to visualize molecular changes in cancer. Tumor-Normal Sequencing Data in BaseSpace To enable researchers new to next-generation

More information

Reporting TP53 gene analysis results in CLL

Reporting TP53 gene analysis results in CLL Reporting TP53 gene analysis results in CLL Mutations in TP53 - From discovery to clinical practice in CLL Discovery Validation Clinical practice Variant diversity *Leroy at al, Cancer Research Review

More information

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes

More information

Clinical Utility of Actionable Genome Information in Precision Oncology Clinic

Clinical Utility of Actionable Genome Information in Precision Oncology Clinic Indian Ocean Rim 2017 Laboratory Haematology Congress 2017. 6.18-19, Singapore Clinical Utility of Actionable Genome Information in Precision Oncology Clinic Reimbursement program for NGS panel tests in

More information

Simple, rapid, and reliable RNA sequencing

Simple, rapid, and reliable RNA sequencing Simple, rapid, and reliable RNA sequencing RNA sequencing applications RNA sequencing provides fundamental insights into how genomes are organized and regulated, giving us valuable information about the

More information

Personalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection

Personalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection Personalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection Personalis, Inc. 1350 Willow Road, Suite 202, Menlo Park, California 94025

More information

DNA Sequence Bioinformatics Analysis with the Galaxy Platform

DNA Sequence Bioinformatics Analysis with the Galaxy Platform DNA Sequence Bioinformatics Analysis with the Galaxy Platform University of São Paulo, Brazil 28 July - 1 August 2014 Dave Clements Johns Hopkins University Robson Francisco de Souza University of São

More information

The 100,000 Genomes Project Harnessing the power of genomics for NHS rare disease and cancer patients

The 100,000 Genomes Project Harnessing the power of genomics for NHS rare disease and cancer patients The 100,000 Genomes Project Harnessing the power of genomics for NHS rare disease and cancer patients Dr Richard Scott, Clinical Lead for Rare Disease Dr Nirupa Murugaesu, Clinical Lead for Cancer Four

More information

VARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN

VARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN VARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN Email: apatwardhan@personalis.com MICHAEL CLARK Email: michael.clark@personalis.com ALEX MORGAN Email:

More information

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.

More information

CS2220 Introduction to Computational Biology

CS2220 Introduction to Computational Biology CS2220 Introduction to Computational Biology WEEK 8: GENOME-WIDE ASSOCIATION STUDIES (GWAS) 1 Dr. Mengling FENG Institute for Infocomm Research Massachusetts Institute of Technology mfeng@mit.edu PLANS

More information

NGS panels in clinical diagnostics: Utrecht experience. Van Gijn ME PhD Genome Diagnostics UMCUtrecht

NGS panels in clinical diagnostics: Utrecht experience. Van Gijn ME PhD Genome Diagnostics UMCUtrecht NGS panels in clinical diagnostics: Utrecht experience Van Gijn ME PhD Genome Diagnostics UMCUtrecht 93 Gene panels UMC Utrecht Cardiovascular disease (CAR) (5 panels) Epilepsy (EPI) (11 panels) Hereditary

More information

AACR GENIE Data Guide

AACR GENIE Data Guide AACR GENIE Data Guide About this Document Version of Data Data Access Terms of Access Introduction to AACR GENIE Human Subjects Protection and Privacy Summary of Data by Center Genomic Profiling at Each

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Frequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R

Frequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R Frequency(%) 1 a b ALK FS-indel ALK R1Q HRAS Q61R HRAS G13R IDH R17K IDH R14Q MET exon14 SS-indel KIT D8Y KIT L76P KIT exon11 NFS-indel SMAD4 R361 IDH1 R13 CTNNB1 S37 CTNNB1 S4 AKT1 E17K ERBB D769H ERBB

More information

ISOWN: accurate somatic mutation identification in the absence of normal tissue controls

ISOWN: accurate somatic mutation identification in the absence of normal tissue controls Kalatskaya et al. Genome Medicine (2017) 9:59 DOI 10.1186/s13073-017-0446-9 SOFTWARE ISOWN: accurate somatic mutation identification in the absence of normal tissue controls Irina Kalatskaya 1*, Quang

More information

American Psychiatric Nurses Association

American Psychiatric Nurses Association Francis J. McMahon International Society of Psychiatric Genetics Johns Hopkins University School of Medicine Dept. of Psychiatry Human Genetics Branch, National Institute of Mental Health* * views expressed

More information

TPMI Presents: Translational Genomics Research Update, Opportunities and Challenges

TPMI Presents: Translational Genomics Research Update, Opportunities and Challenges TPMI Presents: Translational Genomics Research Update, Opportunities and Challenges April 12, 2016 Darren D. O Rielly, Ph.D., FCCMG Director, Molecular Genetics Laboratory, Eastern Health Director, Translational

More information

Cancer troublemakers: a tale of usual suspects and novel villains

Cancer troublemakers: a tale of usual suspects and novel villains Cancer troublemakers: a tale of usual suspects and novel villains Abel González-Pérez and Núria López-Bigas Biomedical Genomics Group Lab web: http://bg.upf.edu Driver genes/mutations: the troublemakers

More information

Nature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data.

Nature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data. Supplementary Figure 1 PCA for ancestry in SNV data. (a) EIGENSTRAT principal-component analysis (PCA) of SNV genotype data on all samples. (b) PCA of only proband SNV genotype data. (c) PCA of SNV genotype

More information

September 23, The Role of In Vitro Diagnostic Tests in Pediatric Master Protocol Development

September 23, The Role of In Vitro Diagnostic Tests in Pediatric Master Protocol Development The Role of In Vitro Diagnostic Tests in Pediatric Master Protocol Development September 23, 2016 Anand Pathak, MD, PhD, MPH Medical Officer Molecular Genetics Branch Division of Molecular Genetics and

More information

PSSV User Manual (V1.0)

PSSV User Manual (V1.0) PSSV User Manual (V1.0) 1. Introduction A novel pattern-based probabilistic approach, PSSV, is developed to identify somatic structural variations from WGS data. Specifically, discordant and concordant

More information

Counsyl Foresight Carrier Screen. Utmost confidence in every result

Counsyl Foresight Carrier Screen. Utmost confidence in every result Counsyl Foresight Carrier Screen Utmost confidence in every result EXTENDING THE BENEFITS OF CARRIER SCREENING Elevate quality of care with expanded carrier screening (ECS) Carrier screening is used to

More information

TP53 mutational profile in CLL : A retrospective study of the FILO group.

TP53 mutational profile in CLL : A retrospective study of the FILO group. TP53 mutational profile in CLL : A retrospective study of the FILO group. Fanny Baran-Marszak Hopital Avicenne Bobigny France 2nd ERIC workshop on TP53 analysis in CLL, Stresa 2017 TP53 abnormalities :

More information

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)

More information

Below, we included the point-to-point response to the comments of both reviewers.

Below, we included the point-to-point response to the comments of both reviewers. To the Editor and Reviewers: We would like to thank the editor and reviewers for careful reading, and constructive suggestions for our manuscript. According to comments from both reviewers, we have comprehensively

More information

Hands-On Ten The BRCA1 Gene and Protein

Hands-On Ten The BRCA1 Gene and Protein Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such

More information

NGS in neurodegenerative disorders - our experience

NGS in neurodegenerative disorders - our experience Neurology Clinic, Clinical Center of Serbia Faculty of Medicine, University of Belgrade Belgrade, Serbia NGS in neurodegenerative disorders - our experience Marija Branković, MSc Belgrade, 2018 Next Generation

More information

Cancer Informatics Lecture

Cancer Informatics Lecture Cancer Informatics Lecture Mayo-UIUC Computational Genomics Course June 22, 2018 Krishna Rani Kalari Ph.D. Associate Professor 2017 MFMER 3702274-1 Outline The Cancer Genome Atlas (TCGA) Genomic Data Commons

More information

underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The

underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The Supplementary Figures Figure S1. Patient cohorts and study design. To define and interrogate the genetic alterations underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The

More information

Integration of Cancer Genome into GECCO- Genetics and Epidemiology of Colorectal Cancer Consortium

Integration of Cancer Genome into GECCO- Genetics and Epidemiology of Colorectal Cancer Consortium Integration of Cancer Genome into GECCO- Genetics and Epidemiology of Colorectal Cancer Consortium Ulrike Peters Fred Hutchinson Cancer Research Center University of Washington U01-CA137088-05, PI: Peters

More information

NGS for Cancer Predisposition

NGS for Cancer Predisposition NGS for Cancer Predisposition Colin Pritchard MD, PhD University of Washington Dept. of Lab Medicine AMP Companion Society Meeting USCAP Boston March 22, 2015 Disclosures I am an employee of the University

More information

Implementation of BRCA Oncomine panel for germline and somatic variant analysis

Implementation of BRCA Oncomine panel for germline and somatic variant analysis Tagliafico ESHG 2017.pptm 3.2% 03/03/2017 Implementation of BRCA Oncomine panel for germline and somatic variant analysis Enrico Tagliafico MD, PhD, Modena, Italy Center for Genome Research University

More information

Introduction to LOH and Allele Specific Copy Number User Forum

Introduction to LOH and Allele Specific Copy Number User Forum Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.

More information

Recherche de variants génomiques en oncologie clinique. Avec des diapos, données & scripts R de: Yannick Boursin, IGR Bastien Job, IGR

Recherche de variants génomiques en oncologie clinique. Avec des diapos, données & scripts R de: Yannick Boursin, IGR Bastien Job, IGR Recherche de variants génomiques en oncologie clinique Avec des diapos, données & scripts R de: Yannick Boursin, IGR Bastien Job, IGR Génétique constitutionnelle At hospital Blood sample Sequence gene

More information

Van test naar diagnose naar

Van test naar diagnose naar Van test naar diagnose naar V therapie op maat Marjolein Kriek, LUMC Joris Veltman, RUNMC Exome diagnostics in genetically heterogeneous disease Joris Veltman, PhD Department of Human Genetics Radboud

More information

Andrew Parrish, Richard Caswell, Garan Jones, Christopher M. Watson, Laura A. Crinnion 3,4, Sian Ellard 1,2

Andrew Parrish, Richard Caswell, Garan Jones, Christopher M. Watson, Laura A. Crinnion 3,4, Sian Ellard 1,2 METHOD ARTICLE An enhanced method for targeted next generation sequencing copy number variant detection using ExomeDepth [version 1; referees: 1 approved, 1 approved with reservations] 1 2 1 3,4 Andrew

More information

AACR GENIE Data Guide

AACR GENIE Data Guide AACR GENIE Data Guide About this Document Version of Data Data Access Terms of Access Introduction to AACR GENIE Human Subjects Protection and Privacy Summary of Data by Center Genomic Profiling at Each

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-12-1-0298 TITLE: MTHFR Functional Polymorphism C677T and Genomic Instability in the Etiology of Idiopathic Autism in Simplex Families PRINCIPAL INVESTIGATOR: Xudong Liu, PhD CONTRACTING

More information

No mutations were identified.

No mutations were identified. Hereditary High Cholesterol Test ORDERING PHYSICIAN PRIMARY CONTACT SPECIMEN Report date: Aug 1, 2017 Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA Kelly Peters Sample Medical Group 123

More information

CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY

CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY More genetic information requires cutting-edge interpretation techniques Whole Exome Sequencing For certain patients the combination of symptoms does not allow

More information

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc.

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc. Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets

More information

Session 4 Rebecca Poulos

Session 4 Rebecca Poulos The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 20

More information

Genome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl.

Genome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl. GenomeVIP: the Genome Institute at Washington University A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud R. Jay Mashl October 20, 2014 Turnkey Variant

More information

PRECISION INSIGHTS. GPS Cancer. Molecular Insights You Can Rely On. Tumor-normal sequencing of DNA + RNA expression.

PRECISION INSIGHTS. GPS Cancer. Molecular Insights You Can Rely On. Tumor-normal sequencing of DNA + RNA expression. PRECISION INSIGHTS GPS Cancer Molecular Insights You Can Rely On Tumor-normal sequencing of DNA + RNA expression www.nanthealth.com Cancer Care is Evolving Oncologists use all the information available

More information

Finding subtle mutations with the Shannon human mrna splicing pipeline

Finding subtle mutations with the Shannon human mrna splicing pipeline Finding subtle mutations with the Shannon human mrna splicing pipeline Presentation at the CLC bio Medical Genomics Workshop American Society of Human Genetics Annual Meeting November 9, 2012 Peter K Rogan

More information

Research Strategy: 1. Background and Significance

Research Strategy: 1. Background and Significance Research Strategy: 1. Background and Significance 1.1. Heterogeneity is a common feature of cancer. A better understanding of this heterogeneity may present therapeutic opportunities: Intratumor heterogeneity

More information

PMDA Perspectives on Oncology Panel. REIKO YANAGIHARA, Ph.D. Office of In Vitro Diagnostics PMDA

PMDA Perspectives on Oncology Panel. REIKO YANAGIHARA, Ph.D. Office of In Vitro Diagnostics PMDA 15th DIA Japan Annual Meeting 2018 Promoting Better Collaboration to Drive Global Health and Innovation in an Era of Medical and Scientific Transformation November 11-13, 2018 Tokyo Big Sight PMDA Perspectives

More information

CONTRACTING ORGANIZATION: The Chancellor, Masters and Scholars of the University of Cambridge, Clara East, The Old Schools, Cambridge CB2 1TN

CONTRACTING ORGANIZATION: The Chancellor, Masters and Scholars of the University of Cambridge, Clara East, The Old Schools, Cambridge CB2 1TN AWARD NUMBER: W81XWH-14-1-0110 TITLE: A Molecular Framework for Understanding DCIS PRINCIPAL INVESTIGATOR: Gregory Hannon CONTRACTING ORGANIZATION: The Chancellor, Masters and Scholars of the University

More information

CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY

CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY More genetic information requires cutting-edge interpretation techniques Whole Exome Sequencing For some patients, the combination of symptoms does not allow

More information

Introduction of an NGS gene panel into the Haemato-Oncology MPN service

Introduction of an NGS gene panel into the Haemato-Oncology MPN service Introduction of an NGS gene panel into the Haemato-Oncology MPN service Dr. Anna Skowronska, Dr Jane Bryon, Dr Samuel Clokie, Dr Yvonne Wallis and Professor Mike Griffiths West Midlands Regional Genetics

More information

Introduction. Introduction

Introduction. Introduction Introduction We are leveraging genome sequencing data from The Cancer Genome Atlas (TCGA) to more accurately define mutated and stable genes and dysregulated metabolic pathways in solid tumors. These efforts

More information

Daniel Lieber, Ph.D. Senior Scientist, Computational Biology Foundation Medicine, Cambridge, MA. AACR 2017: Clinical Biomarkers April 3, 2017

Daniel Lieber, Ph.D. Senior Scientist, Computational Biology Foundation Medicine, Cambridge, MA. AACR 2017: Clinical Biomarkers April 3, 2017 Validation & clinical feasibility of a comprehensive genomic profiling assay to identify likely immunotherapy responders through tumor mutational burden (TMB) Daniel Lieber, Ph.D. Senior Scientist, Computational

More information

Part III of IV: Precision Medicine and Pharmacogenomics. How cancer genomics is causing a radical shift in cancer research and management

Part III of IV: Precision Medicine and Pharmacogenomics. How cancer genomics is causing a radical shift in cancer research and management Part III of IV: Precision Medicine and Pharmacogenomics How cancer genomics is causing a radical shift in cancer research and management March 2018 Author Shealynn Buck, M.D. Chief Medical Officer Lockton

More information

National Surgical Adjuvant Breast and Bowel Project (NSABP) Foundation Annual Progress Report: 2011 Formula Grant

National Surgical Adjuvant Breast and Bowel Project (NSABP) Foundation Annual Progress Report: 2011 Formula Grant National Surgical Adjuvant Breast and Bowel Project (NSABP) Foundation Annual Progress Report: 2011 Formula Grant Reporting Period July 1, 2012 June 30, 2013 Formula Grant Overview The NSABP Foundation

More information

Sequencing of 58 STRs using the Illumina ForenSeq TM workflow and analysis of the data with the STRinNGS v.1.0 software

Sequencing of 58 STRs using the Illumina ForenSeq TM workflow and analysis of the data with the STRinNGS v.1.0 software Sequencing of 58 STRs using the Illumina ForenSeq TM workflow and analysis of the data with the STRinNGS v.1.0 software C. Hussing, C. Huber, R. Bytyci, H.S. Mogensen, C. Børsting, and N. Morling Section

More information

Illuminating the genetics of complex human diseases

Illuminating the genetics of complex human diseases Illuminating the genetics of complex human diseases Michael Schatz Sept 27, 2012 Beyond the Genome @mike_schatz / #BTG2012 Outline 1. De novo mutations in human diseases 1. Autism Spectrum Disorder 2.

More information

Tumor mutational burden and its transition towards the clinic

Tumor mutational burden and its transition towards the clinic Tumor mutational burden and its transition towards the clinic G C C A T C A C Wolfram Jochum Institute of Pathology Kantonsspital St.Gallen CH-9007 St.Gallen wolfram.jochum@kssg.ch 30th European Congress

More information

Data mining with Ensembl Biomart. Stéphanie Le Gras

Data mining with Ensembl Biomart. Stéphanie Le Gras Data mining with Ensembl Biomart Stéphanie Le Gras (slegras@igbmc.fr) Guidelines Genome data Genome browsers Getting access to genomic data: Ensembl/BioMart 2 Genome Sequencing Example: Human genome 2000:

More information

Genome Wide Variant Analysis of Simplex Autism Families with an Integrative Clinical-Bioinformatics Pipeline

Genome Wide Variant Analysis of Simplex Autism Families with an Integrative Clinical-Bioinformatics Pipeline Genome Wide Variant Analysis of Simplex Autism Families with an Integrative Clinical-Bioinformatics Pipeline Laura T. Jiménez-Barrón 1,5, Jason A. O Rawe 1,2, Yiyang Wu 1,2, Margaret Yoon 1, Han Fang 1,

More information

Accel-Amplicon Panels

Accel-Amplicon Panels Accel-Amplicon Panels Amplicon sequencing has emerged as a reliable, cost-effective method for ultra-deep targeted sequencing. This highly adaptable approach is especially applicable for in-depth interrogation

More information

Comprehensive genomic profiling for various solid tumors

Comprehensive genomic profiling for various solid tumors Content Highlight Test Specification Test Content Performance Validation Test Report I II III IV V The NovoPM TM comprehensive cancer genomic profiling test Comprehensive genomic profiling for various

More information

Non-Profit Startup Paradigm Launches Cancer Panel Based on DNA, RNA Sequencing

Non-Profit Startup Paradigm Launches Cancer Panel Based on DNA, RNA Sequencing Non-Profit Startup Paradigm Launches Cancer Panel Based on DNA, RNA Sequencing April 11, 2014 By Tony Fong Non-profit diagnostics outfit Paradigm last month joined a growing list of entrants in the clinical

More information

David Tamborero, PhD

David Tamborero, PhD David Tamborero, PhD Lopez-Bigas' lab Study of Tumor Genomes Study of Tumor Genomes Study sequencing data of tumors to understand the biological mechanisms shaping the mutational processes observed at

More information

6/12/2018. Disclosures. Clinical Genomics The CLIA Lab Perspective. Outline. COH HopeSeq Heme Panels

6/12/2018. Disclosures. Clinical Genomics The CLIA Lab Perspective. Outline. COH HopeSeq Heme Panels Clinical Genomics The CLIA Lab Perspective Disclosures Raju K. Pillai, M.D. Hematopathologist / Molecular Pathologist Director, Pathology Bioinformatics City of Hope National Medical Center, Duarte, CA

More information

Session 4 Rebecca Poulos

Session 4 Rebecca Poulos The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 28

More information

Heartland Genetics and Newborn Screening Collaborative Conference

Heartland Genetics and Newborn Screening Collaborative Conference Heartland Genetics and Newborn Screening Collaborative Conference Laurel K. Willig, MD Assistant Medical Director for the Center for Pediatric Genomic Medicine and Joshua E. Petrikin, MD Director of Neonatal

More information