Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
|
|
- Angelica York
- 5 years ago
- Views:
Transcription
1 Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
2 Epigenetics in Mainstream Media
3 Epigenetics *Current definition: The study of mitotically and meiotically heritable changes in gene function that cannot be explained by changes in DNA sequence *This definition is being actively debated within the scientific community. What does this mean? And why should we care?
4 Regulation of gene expression in eukaryotic cells Transcription factor Marmorstein, Nature Reviews Mol Cell Bio (2001) Is this version of gene regulation over-simplified?
5 Direct cell reprogramming Vierbuchen and Wernig (2012)
6
7 Ramen Noodles and Chromatin? 4 x 5 x 1
8 Ramen Noodles and Chromatin? 4 x 5 x of noodles!
9
10
11 Histones can be modified, and these modifications can affect gene expression
12 A Histone Code
13 Regulation of gene expression - transcription factors + epigenetics Berger, Nature (2000)
14 Epigenetics Nova ScienceNow, July 2007 Histone modifications Acetylation, methylation, phosphorylation, arginylation, ubiquitination DNA methylation
15 Epigenetics Nova ScienceNow, July 2007 Histone modifications Acetylation, methylation, phosphorylation, arginylation, ubiquitination DNA methylation
16 How are these epigenetic modifications established? There are a host of proteins whose function is to write, erase, or read epigenetic modifications HATs - histone acetyltransferases HDACs - histone deacetylases HMTs - histone methyltransferases DNMTs - DNA methyltransferases
17 How do are cells know which regions should have open or closed chromatin? And how are these regions marked?
18 ChIP experimental workflow PCR Band or no band?
19 Human Genome Sequencing Using traditional Sanger sequencing, it took an international team 11 years and $3 billion to sequence the human genome (about $1 per base pair) Advances in sequencing technology have dramatically reduced the time and cost - currently about $5000 and can be completed in a week - expected to drop to below $1000 in the next months
20 NGS is not just for whole genome sequencing! ChIP-seq - chromatin immunoprecipitation + seq Methyl-seq - DNA methylation sequencing RNA-seq - capture RNA and sequence (vs. microarray) Small RNA-seq - focus on mirnas, snorna, trnas, etc. RIP-seq - RNA immunoprecipitation + seq (to identify RNAs associated with specific proteins) A common thread throughout all of these strategies is to first use another technique to enrich the samples for a given type of analysis, followed by NGS
21 Illumina Next-Generation Sequencing Metzker, Nat Rev Genetics (2010) Allows tens of millions of sequencing reactions to be performed simultaneously Also referred to as massively parallel sequencing
22 Illumina Next-Generation Sequencing Metzker, Nat Rev Genetics (2010) 51x --> 51 bp reads
23 How does next-generation sequencing work? Another name for next-generation sequencing is massively parallel sequencing Illumina
24 Analyzing NGS data requires the assistance of bioinformatics (topic of future Mini-STEM lecture) Mortazavi, et al, Nature Methods (2008)
25 ChIP-seq experimental workflow
26 Mapping the precise locations of histone modifications throughout the entire genome Specific histone modifications have previously had functions ascribed to them, such as facilitating gene expression (H3K4me3) or suppressing gene expression (H3K27me3) H3K4me3 = trimethylation of lysine 4 on histone H3 H3K27me3 = trimethylation of lysine 27 on histone H3
27 ENCODE Encyclopedia of DNA Elements Project that aims to delineate all of the functional elements encoded in the human genome Identification and quantification of RNA species in whole cells and sub cellular compartments Analysis of RNA binding proteins Mapping of noncoding and proteincoding genes Delineation of chromatin and DNA accessibility Mapping of histone modifications and transcription factor-binding sites by ChIP Measurement of DNA methylation Performed 1,640 sequencing studies on 147 different human cell types Examination of long-range chromatin interactions
28 Summary of ENCODE findings The vast majority of the human genome (80.4%) participates in at least one biochemical RNA- and/or chromatin-associated event in at least one cell type 95% of the genome lies within 8 kb of a DNA-protein interaction, and 99% is within 1.7 kb of at least one biochemical event Classifying the genome into seven chromatin states indicates 399,124 regions with enhancer-like features and 70,292 regions with promoter-like features It is possible to correlate quantitatively RNA production and processing with both chromatin marks and transcription factor binding at promoters, indicating that promoter functionality can explain most of the variation in RNA expression Many non-coding variants in individual genome sequences lie in ENCODE-annotated functional regions; this number is at least as large as those that lie in protein-coding regions Single-nucleotide polymorphisms (SNPs) associated with disease by GWAS are enriched within non-coding functional elements, with a majority residing in or near ENCODE-defined regions that are outside of protein coding genes. In many cases, the disease phenotypes can be associated with a specific cell type or transcription factor.
29 Green, et al, Nature (2011)
30 Correlating ChIP-seq data with GWAS SNP studies GWAS = genome-wide association studies SNP = single nucleotide polymorphisms ENCODE Consortium, Nature (2012)
31 Drugs that modify epigenetic modifications DeWoskin and Million, Nature Reviews Drug Discovery (2013)
32 Lithium and valproic acid are both use to treat bipolar disorder - do they work the same way?
33 VPA is an HDAC inhibitor VPA = valproic acid Because of our discovery, VPA has been successfully used clinically in the treatment of different leukemias
34 DNA Methylation Simple modification of cytosine bases, mediated by enzymes called DNA methyltransferases! Approximately 5% of the genome is methylated! The pattern of DNA methylation can overlap, but is distinct for each cell type in our bodies
35 Glycogen Synthase Kinase-3 (Gsk-3) Applies the Brakes to Many Signaling Pathways Cohen, Nature Rev Mol Cell Bio (2006) Barker and Clevers, Nature Rev Drug Discovery (2006)
36 Gsk-3-Deficient Mouse Embryonic Stem Cells WT ESCs Gsk-3 DKO ESCs
37 Whole-Genome Expression Analysis via Microarray 1. Isolate RNA samples. Synthesize DNA copies. RNA population or probes Clinical sample 4. Analyze data and correlate with histoclinical data 2. Hybridize labeled probe with DNA microarray on a chip 8x4x2 2x4x8 3. Scan the chip We recently found that cells deficient in Gsk-3 also have reduced DNA methylation at specific regions of the genome
38 Genome-wide DNA Methylation Sequencing Tony D Ippolito Gavin Meredith, Ph.D. The Ohio State University Major - Molecular Genetics! *Currently - Duke University Ph.D. Program in Genetics Life Technologies R&D Manager
39 Genome-wide DNA Methylation Sequencing Tony D Ippolito Gavin Meredith, Ph.D. The Ohio State University Major - Molecular Genetics! *Currently - Duke University Ph.D. Program in Genetics Life Technologies R&D Manager Which genomic regions in Gsk-3 DKO ESCs are hypomethylated compared to WT ESCs?
40 Genome-wide DNA Methylation Sequencing Tony D Ippolito Gavin Meredith, Ph.D. The Ohio State University Major - Molecular Genetics! *Currently - Duke University Ph.D. Program in Genetics Life Technologies R&D Manager Which genomic regions in Gsk-3 DKO ESCs are hypomethylated compared to WT ESCs?
41 Understanding How DNA Methylation Differences Are Determined via NGS Peaks are built up by aligning sequences to reference genome WT Each box represents a 51 bp fragment of DNA DKO
42 Methyl-Seq Data in Genome Viewer WT DKO
43 Genomic Imprinting, DNA Methylation, and Dnmt3a2 Mammals inherit one copy of each gene from both parents However, not all genes are equally expressed Imprinted genes are those in which one inherited copy is silenced by DNA methylation There have been approximately 100 imprinted genes identified in mice IMPORTANT - these are parent-of-origin effects, not gender effects
44 Genomic Imprinting, DNA Methylation, and Dnmt3a2 Mammals inherit one copy of each gene from both parents However, not all genes are equally expressed Imprinted genes are those in which one inherited copy is silenced by DNA methylation There have been approximately 100 imprinted genes identified in mice IMPORTANT - these are parent-of-origin effects, not gender effects Igf2 - Insulin-like growth factor 2 = methylation
45 Genomic Imprinting, DNA Methylation, and Dnmt3a2 Mammals inherit one copy of each gene from both parents However, not all genes are equally expressed Imprinted genes are those in which one inherited copy is silenced by DNA methylation There have been approximately 100 imprinted genes identified in mice IMPORTANT - these are parent-of-origin effects, not gender effects Igf2 - Insulin-like growth factor 2 = methylation
46 Genomic Imprinting, DNA Methylation, and Dnmt3a2 Mammals inherit one copy of each gene from both parents However, not all genes are equally expressed Imprinted genes are those in which one inherited copy is silenced by DNA methylation There have been approximately 100 imprinted genes identified in mice IMPORTANT - these are parent-of-origin effects, not gender effects Igf2 - Insulin-like growth factor 2 = methylation Human imprinting disorders Beckwith-Wiedemann syndrome/wilm s tumor, Prader-Willi syndrome/angelman syndrome
47 Genomic Imprinting, DNA Methylation, and Dnmt3a2 Mammals inherit one copy of each gene from both parents However, not all genes are equally expressed Imprinted genes are those in which one inherited copy is silenced by DNA methylation There have been approximately 100 imprinted genes identified in mice IMPORTANT - these are parent-of-origin effects, not gender effects Igf2 - Insulin-like growth factor 2 = methylation Human imprinting disorders Beckwith-Wiedemann syndrome/wilm s tumor, Prader-Willi syndrome/angelman syndrome **Dnmt3a/3a2 is the DNA methyltransferase that is responsible for methylating imprinted loci**
48 Genomic Imprinting, DNA Methylation, and Dnmt3a2 Methylated loci Methylation re-established Most of genome demethylated
49 Example of an Imprinted Locus H19/Igf2 Differentially methylated region (DMR)
50 DNA Methylation at the H19 DMR is Reduced in Gsk-3 DKO ESCs 303 bp fragment with 15 CpGs WT % Sequence of 13 clones from WT ESCs DKO % Sequence of 11 clones from DKO ESCs = Unmethylated CpG = Methylated CpG
51 Model for the Regulation of Igf2/H19 Gene Expression in Gsk-3 DKO ESCs
52 Constitutive Activation of Insulin Signaling in Wild-Type Embryonic Stem Cells WT p110* 100 kd 75 kd 75 kd 50 kd 75 kd 50 kd 50 kd PI3K p-akt Akt p-gsk-3 50 kd 50 kd GSK-3 Tubulin Western blots (protein) CST antibodies Cohen, Nature Rev Mol Cell Bio (2006) Phosphorylation of Gsk-3α and Gsk-3β by Akt results in inhibition of Gsk-3 activity
53 Increasing DNA methylation in pregnant Agouti mice results in reduced obesity in the offspring Jirtle and Skinner, Nature Reviews Genetics (2007)
54 The fungicide viclozolin has been reported to cause transgenerational effects in rats Kaiser, Science (2014)
55 Activation of Insulin Signaling via Activated PI3K Results in Reduced DNA Methylation Igf2/H19 DMD WT 81.3% p110* 52.9%
56 Connecting Food Availability to Epigenetics and Disease
57 Connecting Food Availability to Epigenetics and Disease Pembrey, et al, Eur J Med Gen (2006)
58 Could altered insulin signaling be the mechanism behind this effect?? (Insulin signaling & Gsk-3 inhibition)
Epigenetics. Lyle Armstrong. UJ Taylor & Francis Group. f'ci Garland Science NEW YORK AND LONDON
... Epigenetics Lyle Armstrong f'ci Garland Science UJ Taylor & Francis Group NEW YORK AND LONDON Contents CHAPTER 1 INTRODUCTION TO 3.2 CHROMATIN ARCHITECTURE 21 THE STUDY OF EPIGENETICS 1.1 THE CORE
More informationEpigenetics Armstrong_Prelims.indd 1 04/11/2013 3:28 pm
Epigenetics Epigenetics Lyle Armstrong vi Online resources Accessible from www.garlandscience.com, the Student and Instructor Resource Websites provide learning and teaching tools created for Epigenetics.
More informationGenetics and Genomics in Medicine Chapter 6 Questions
Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions
More informationEpigenetics 101. Kevin Sweet, MS, CGC Division of Human Genetics
Epigenetics 101 Kevin Sweet, MS, CGC Division of Human Genetics Learning Objectives 1. Evaluate the genetic code and the role epigenetic modification plays in common complex disease 2. Evaluate the effects
More informationR. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS
R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS EPIGENETICS THE STUDY OF CHANGES IN GENE EXPRESSION THAT ARE POTENTIALLY HERITABLE AND THAT DO NOT ENTAIL A
More informationLecture 27. Epigenetic regulation of gene expression during development
Lecture 27 Epigenetic regulation of gene expression during development Development of a multicellular organism is not only determined by the DNA sequence but also epigenetically through DNA methylation
More informationImprinting. Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821
Imprinting Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821 Learning Objectives 1. To understand the basic concepts of genomic imprinting Genomic imprinting is an epigenetic phenomenon that causes
More informationFragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype
Fragile X Syndrome Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype A loss of function of the FMR-1 gene results in severe learning problems, intellectual disability
More informationHistones modifications and variants
Histones modifications and variants Dr. Institute of Molecular Biology, Johannes Gutenberg University, Mainz www.imb.de Lecture Objectives 1. Chromatin structure and function Chromatin and cell state Nucleosome
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationEpigenetics and Chromatin Remodeling
Epigenetics and Chromatin Remodeling Bradford Coffee, PhD, FACMG Emory University Atlanta, GA Speaker Disclosure Information Grant/Research Support: none Salary/Consultant Fees: none Board/Committee/Advisory
More informationEPIGENOMICS PROFILING SERVICES
EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation
More informationJayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3
Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3 1 Department of Biotechnology, JMIT, Radaur, Haryana, India 2 KITM, Kurukshetra, Haryana, India 3 NIDDK, National Institute of Health,
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationAccessing and Using ENCODE Data Dr. Peggy J. Farnham
1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000
More informationgenomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
More informationGene Expression DNA RNA. Protein. Metabolites, stress, environment
Gene Expression DNA RNA Protein Metabolites, stress, environment 1 EPIGENETICS The study of alterations in gene function that cannot be explained by changes in DNA sequence. Epigenetic gene regulatory
More informationEpigenetic Inheritance
(2) The role of Epigenetic Inheritance Lamarck Revisited Lamarck was incorrect in thinking that the inheritance of acquired characters is the main mechanism of evolution (Natural Selection more common)
More informationAre you the way you are because of the
EPIGENETICS Are you the way you are because of the It s my fault!! Nurture Genes you inherited from your parents? Nature Experiences during your life? Similar DNA Asthma, Autism, TWINS Bipolar Disorders
More informationEpigenetics: Basic Principals and role in health and disease
Epigenetics: Basic Principals and role in health and disease Cambridge Masterclass Workshop on Epigenetics in GI Health and Disease 3 rd September 2013 Matt Zilbauer Overview Basic principals of Epigenetics
More informationToday. Genomic Imprinting & X-Inactivation
Today 1. Quiz (~12 min) 2. Genomic imprinting in mammals 3. X-chromosome inactivation in mammals Note that readings on Dosage Compensation and Genomic Imprinting in Mammals are on our web site. Genomic
More informationAn epigenetic approach to understanding (and predicting?) environmental effects on gene expression
www.collaslab.com An epigenetic approach to understanding (and predicting?) environmental effects on gene expression Philippe Collas University of Oslo Institute of Basic Medical Sciences Stem Cell Epigenetics
More informationAllelic reprogramming of the histone modification H3K4me3 in early mammalian development
Allelic reprogramming of the histone modification H3K4me3 in early mammalian development 张戈 Method and material STAR ChIP seq (small-scale TELP-assisted rapid ChIP seq) 200 mouse embryonic stem cells PWK/PhJ
More informationEpigenomics. Ivana de la Serna Block Health Science
Epigenomics Ivana de la Serna Block Health Science 388 383-4111 ivana.delaserna@utoledo.edu Outline 1. Epigenetics-definition and overview 2. DNA methylation/hydroxymethylation 3. Histone modifications
More informationBack to the Basics: Methyl-Seq 101
Back to the Basics: Methyl-Seq 101 Presented By: Alex Siebold, Ph.D. October 9, 2013 Field Applications Scientist Agilent Technologies Life Sciences & Diagnostics Group Life Sciences & Diagnostics Group
More informationNature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.
Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized
More informationStem Cell Epigenetics
Stem Cell Epigenetics Philippe Collas University of Oslo Institute of Basic Medical Sciences Norwegian Center for Stem Cell Research www.collaslab.com Source of stem cells in the body Somatic ( adult )
More informationResults. Abstract. Introduc4on. Conclusions. Methods. Funding
. expression that plays a role in many cellular processes affecting a variety of traits. In this study DNA methylation was assessed in neuronal tissue from three pigs (frontal lobe) and one great tit (whole
More informationAn Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice
An Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice Mei-Yi Wu 1 *, Ming Jiang 1, Xiaodong Zhai 2, Arthur L. Beaudet 2, Ray-Chang Wu 1 * 1 Department of
More informationChromatin-Based Regulation of Gene Expression
Chromatin-Based Regulation of Gene Expression.George J. Quellhorst, Jr., PhD.Associate Director, R&D.Biological Content Development Topics to be Discussed Importance of Chromatin-Based Regulation Mechanism
More informationDNA methylation & demethylation
DNA methylation & demethylation Lars Schomacher (Group Christof Niehrs) What is Epigenetics? Epigenetics is the study of heritable changes in gene expression (active versus inactive genes) that do not
More informationComputational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological
More informationDNA methylation: a potential clinical biomarker for the detection of human cancers
DNA methylation: a potential clinical biomarker for the detection of human cancers Name: Tong Samuel Supervisor: Zigui CHEN Date: 1 st December 2016 Department: Microbiology Source: cited from Jakubowski,
More informationEukaryotic transcription (III)
Eukaryotic transcription (III) 1. Chromosome and chromatin structure Chromatin, chromatid, and chromosome chromatin Genomes exist as chromatins before or after cell division (interphase) but as chromatids
More informationEpigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017
Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of
More informationNature Structural & Molecular Biology: doi: /nsmb.2419
Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb
More informationSession 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology
Session 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology Bhaskar Gollapudi, Ph.D The Dow Chemical Company Workshop: Genetic Toxicology: Opportunities to Integrate New Approaches
More informationSession 6: Integration of epigenetic data. Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016
Session 6: Integration of epigenetic data Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016 Utilizing complimentary datasets Frequent mutations in chromatin regulators
More informationEpigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation
Epigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation Robert FEIL Director of Research CNRS & University of Montpellier, Montpellier, France. E-mail:
More informationTranscriptional and Epigenetic Mechanisms of Addiction
Transcriptional and Epigenetic Mechanisms of Addiction Eric J. Nestler Mount Sinai School of Medicine New York, NY Dr. Ray Fuller There is every reason to be optimistic that in the future we will find
More informationJoanna Hillman Michael Higgins Lab Oncology for Scientists I 10/29/2015
Joanna Hillman Michael Higgins Lab Oncology for Scientists I 10/29/2015 ! Define Epigenetics & Genomic Imprinting! Discovery! What is the imprint! Lifecycle of an Imprint DMRs and ICEs! 2 main mechanisms
More informationThe Epigenome Tools 2: ChIP-Seq and Data Analysis
The Epigenome Tools 2: ChIP-Seq and Data Analysis Chongzhi Zang zang@virginia.edu http://zanglab.com PHS5705: Public Health Genomics March 20, 2017 1 Outline Epigenome: basics review ChIP-seq overview
More informationGCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG
Lecture 6 GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG CGTACTGCAACCGGCGGGCCACGCCCCCGTGAAAAGAAGGTTGTT TTCTCCACATTTCGGGGTTCTGGACGTTTCCCGGCTGCGGGGCGG
More informationTranscriptional repression of Xi
Transcriptional repression of Xi Xist Transcription of Xist Xist RNA Spreading of Xist Recruitment of repression factors. Stable repression Translocated Xic cannot efficiently silence autosome regions.
More informationTranscriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc
Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression Chromatin Array of nuc 1 Transcriptional control in Eukaryotes: Chromatin undergoes structural changes
More informationEpigenetics in evolution and disease
Epigenetics in evolution and disease Manel Esteller We are not our genes. Genes are just part of the story. We cannot fully blame our genome for our behaviour and susceptibility to disease. In Lehninger
More informationAN INTRODUCTION TO EPIGENETICS DR CHLOE WONG
AN INTRODUCTION TO EPIGENETICS DR CHLOE WONG MRC SGDP CENTRE, INSTITUTE OF PSYCHIATRY KING S COLLEGE LONDON Oct 2015 Lecture Overview WHY WHAT EPIGENETICS IN PSYCHIARTY Technology-driven genomics research
More informationBiochemical Determinants Governing Redox Regulated Changes in Gene Expression and Chromatin Structure
Biochemical Determinants Governing Redox Regulated Changes in Gene Expression and Chromatin Structure Frederick E. Domann, Ph.D. Associate Professor of Radiation Oncology The University of Iowa Iowa City,
More informationEpigenetic Mechanisms
RCPA Lecture Epigenetic chanisms Jeff Craig Early Life Epigenetics Group, MCRI Dept. of Paediatrics Overview What is epigenetics? Chromatin The epigenetic code What is epigenetics? the interactions of
More information4/20/2016. Objectives. Epigenetic Definitions. Gene Expression. More Questions. Questions to Consider
Objectives Epigentics: You Might Be What Your Grandmother Ate Lynda Britton, Ph.D., MLS(ASCP) CM Professor LSU Health Shreveport Discuss epigenetics and its role in cancer, imprinting and X chromosome
More informationLecture 8. Eukaryotic gene regulation: post translational modifications of histones
Lecture 8 Eukaryotic gene regulation: post translational modifications of histones Recap.. Eukaryotic RNA polymerases Core promoter elements General transcription factors Enhancers and upstream activation
More informationGenetics and Genomics in Medicine Chapter 6. Questions & Answers
Genetics and Genomics in Medicine Chapter 6 Multiple Choice Questions Questions & Answers Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the
More informationStatistical Genetics. Matthew Stephens. Statistics Retreat, October 26th 2012
Statistical Genetics Statistics Retreat, October 26th 2012 Two stories The two most influential statistical ideas in analysis of genetic association studies. 1 Sequence, sequence, everywhere. 1 With apologies
More informationYue Wei 1, Rui Chen 2, Carlos E. Bueso-Ramos 3, Hui Yang 1, and Guillermo Garcia-Manero 1
Genome-wide CHIP-Seq Analysis of Histone Methylation Reveals Modulators of NF- B Signaling And the Histone Demethylase JMJD3 Implicated in Myelodysplastic Syndrome Yue Wei 1, Rui Chen 2, Carlos E. Bueso-Ramos
More informationFOLLICULAR LYMPHOMA- ILLUMINA METHYLATION. Jude Fitzgibbon
FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION Jude Fitzgibbon j.fitzgibbon@qmul.ac.uk Molecular Predictors of Clinical outcome Responders Alive Non-responders Dead TUMOUR GENETICS Targeted therapy, Prognostic
More informationEpigenetics DNA methylation. Biosciences 741: Genomics Fall, 2013 Week 13. DNA Methylation
Epigenetics DNA methylation Biosciences 741: Genomics Fall, 2013 Week 13 DNA Methylation Most methylated cytosines are found in the dinucleotide sequence CG, denoted mcpg. The restriction enzyme HpaII
More informationGenes, Aging and Skin. Helen Knaggs Vice President, Nu Skin Global R&D
Genes, Aging and Skin Helen Knaggs Vice President, Nu Skin Global R&D Presentation Overview Skin aging Genes and genomics How do genes influence skin appearance? Can the use of Genomic Technology enable
More informationI) Development: tissue differentiation and timing II) Whole Chromosome Regulation
Epigenesis: Gene Regulation Epigenesis : Gene Regulation I) Development: tissue differentiation and timing II) Whole Chromosome Regulation (X chromosome inactivation or Lyonization) III) Regulation during
More informationDNA and Histone Methylation in Learning and Memory
EXPERIMENTAL BIOLOGY ANNUAL MEETING April 2010 DNA and Histone Methylation in Learning and Memory J. David Sweatt Dept of Neurobiology McKnight Brain Institute UAB School of Medicine The Molecular Basis
More informationEpigenetic Reprogramming for Cardiovascular Regeneration Chromatin Remodeling in Cardiovascular Development and Physiology
This Review is part of a thematic series on Epigenetics, which includes the following articles: Epigenetic Regulation of the Cardiovascular System: Introduction to a Review Series Epigenome Mapping in
More informationMolecular Cell Biology. Prof. D. Karunagaran. Department of Biotechnology. Indian Institute of Technology Madras
Molecular Cell Biology Prof. D. Karunagaran Department of Biotechnology Indian Institute of Technology Madras Module-9 Molecular Basis of Cancer, Oncogenes and Tumor Suppressor Genes Lecture 6 Epigenetics
More informationEpigenetics: A historical overview Dr. Robin Holliday
Epigenetics 1 Rival hypotheses Epigenisis - The embryo is initially undifferentiated. As development proceeds, increasing levels of complexity emerge giving rise to the larval stage or to the adult organism.
More informationLong noncoding RNAs in DNA methylation: new players stepping into the old game
DOI 10.1186/s13578-016-0109-3 Cell & Bioscience REVIEW Long noncoding RNAs in DNA methylation: new players stepping into the old game Yu Zhao 1, Hao Sun 1,2* and Huating Wang 1,3* Open Access Abstract
More informationH19 Chromatin Insulator in Development and DiseaseEpigenetic Regulation of the
Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 825 H19 Chromatin Insulator in Development and DiseaseEpigenetic Regulation of the BY CLAES HOLMGREN ACTA UNIVERSITATIS
More informationBisphenol A Exposure Disrupts Genomic Imprinting in the Mouse
Bisphenol A Exposure Disrupts Genomic Imprinting in the Mouse Martha Susiarjo 1,2, Isaac Sasson 3, Clementina Mesaros 4, Marisa S. Bartolomei 1,2 * 1 Department of Cell and Developmental Biology, University
More information7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
More informationEpigenetic mechanisms and the development of asthma
Mechanisms of allergic diseases Series editors: Joshua A. Boyce, MD, Fred Finkelman, MD, and William T. Shearer, MD, PhD Epigenetic mechanisms and the development of asthma Ivana V. Yang, PhD, and David
More informationChIP-seq data analysis
ChIP-seq data analysis Harri Lähdesmäki Department of Computer Science Aalto University November 24, 2017 Contents Background ChIP-seq protocol ChIP-seq data analysis Transcriptional regulation Transcriptional
More informationEpigenetics and Environmental Health A Step-by-Step Tutorial
Powerful ideas for a healthier world Epigenetics and Environmental Health A Step-by-Step Tutorial Andrea Baccarelli, MD, PhD, MPH Laboratory of Environmental Epigenetics Objective of my presentation To
More informationCh. 18 Regulation of Gene Expression
Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate
More informationEpigenetic Principles and Mechanisms Underlying Nervous System Function in Health and Disease Mark F. Mehler MD, FAAN
Epigenetic Principles and Mechanisms Underlying Nervous System Function in Health and Disease Mark F. Mehler MD, FAAN Institute for Brain Disorders and Neural Regeneration F.M. Kirby Program in Neural
More informationEpigenetics q&more 01.11
Laurie. Knight, istockphoto.com Epigenetics 6 Bookmarks About the reading of genes in the Book of Life Prof. Dr. Manfred Jung, Julia M. Wagner, Institute for Pharmaceutical Sciences, Albert-Ludwig-University
More informationSupplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region
Supplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region methylation in relation to PSS and fetal coupling. A, PSS values for participants whose placentas showed low,
More informationL epigenetica si riferisce a tutti i cambiamenti dell espressione genica e dell organizzazione della cromatina che sono indipendenti dalla sequenza
L epigenetica si riferisce a tutti i cambiamenti dell espressione genica e dell organizzazione della cromatina che sono indipendenti dalla sequenza del DNA. Epigenome provides instructions and regulates
More informationRegulation of Gene Expression in Eukaryotes
Ch. 19 Regulation of Gene Expression in Eukaryotes BIOL 222 Differential Gene Expression in Eukaryotes Signal Cells in a multicellular eukaryotic organism genetically identical differential gene expression
More informationIntroduction to Systems Biology of Cancer Lecture 2
Introduction to Systems Biology of Cancer Lecture 2 Gustavo Stolovitzky IBM Research Icahn School of Medicine at Mt Sinai DREAM Challenges High throughput measurements: The age of omics Systems Biology
More informationDedicated to my family
Dedicated to my family List of Papers This thesis is based on the following papers, which are referred to in the text by their Roman numerals. I Mohammad F*, Pandey RR*, Nagano T, Chakalova L, Mondal
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationPRADER WILLI/ANGELMAN
SALSA MS-MLPA probemix ME028-B2 PRADER WILLI/ANGELMAN Lot B2-0811: As compared to version B1 (lot B1-0609, B1-1108), the 88 and 96 nt control fragments have been replaced (QDX2). PRADER-WILLI SYNDROME
More informationEpigenetic mechanisms and their implications in animal breeding
Epigenetic mechanisms and their implications in animal breeding Klaus Wimmers, Nares Trakooljul, Michael Oster, Eduard Murani, Siriluck Ponsuksili Leibniz Institute for Farm Animal Biology (FBN), Germany
More informationMRC-Holland MLPA. Description version 52; 22 July 2015
SALSA MS-MLPA probemix ME028-B2 Prader-Willi/Angelman Lot B2-0413, lot B2-0811. As compared to version B1 (lot B1-0609), the control fragments have been replaced (QDX2). PRADER-WILLI SYNDROME (PWS) and
More informationBreast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data
Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing
More informationEpigenetics & cancer. Present by : Sanaz Zebardast Under supervision : Dr. Gheibi. 31 December 2016
Epigenetics & cancer Present by : Sanaz Zebardast Under supervision : Dr. Gheibi 31 December 2016 1 contents Introduction Epigenetic & signaling pathways Epigenetic & integral protein Epigenetic & apoptosis
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationOVERVIEW OF EPIGENETICS
OVERVIEW OF EIENETICS Date: * Time: 9:00 am - 9:50 am * Room: Berryhill 103 Lecturer: Terry Magnuson 4312 MBRB trm4@med.unc.edu 843-6475 *lease consult the online schedule for this course for the definitive
More informationGenome-wide Association Studies (GWAS) Pasieka, Science Photo Library
Lecture 5 Genome-wide Association Studies (GWAS) Pasieka, Science Photo Library Chi-squared test to evaluate whether the odds ratio is different from 1. Corrected for multiple testing Source: wikipedia.org
More informationEpigenetics and Human Disease
Epigenetics and Human Disease May 28, 2014 1 Angelman Syndrome & Prader-Willi Syndrome Sister Syndromes Angelman Syndrome ~1/20,000 births happy disposition smile often bouts of laughter minimal verbal
More informationSupplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated
Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated with the H3K27me3 mark in chondrocytes (see Table S1,
More informationSupplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.
mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their
More informationComparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
More informationAnalysis of shotgun bisulfite sequencing of cancer samples
Analysis of shotgun bisulfite sequencing of cancer samples Kasper Daniel Hansen Postdoc with Rafael Irizarry Johns Hopkins Bloomberg School of Public Health Brixen, July 1st, 2011 The
More informationChromHMM Tutorial. Jason Ernst Assistant Professor University of California, Los Angeles
ChromHMM Tutorial Jason Ernst Assistant Professor University of California, Los Angeles Talk Outline Chromatin states analysis and ChromHMM Accessing chromatin state annotations for ENCODE2 and Roadmap
More informationTranscription Regulation And Gene Expression in Eukaryotes Cycle G2 (lecture 13709) FS 2014 P Matthias & RG Clerc
Transcription Regulation And Gene Expression in Eukaryotes Cycle G2 (lecture 13709) FS 2014 P Matthias & RG Clerc P. Matthias, 16 April 2014 DNA methylation basics Acetylation Acetyltransferases/Deacetylases
More informationComparative DNA methylome analysis of endometrial carcinoma reveals complex and distinct deregulation of cancer promoters and enhancers
Zhang et al. BMC Genomics 2014, 15:868 RESEARCH ARTICLE Open Access Comparative DNA methylome analysis of endometrial carcinoma reveals complex and distinct deregulation of cancer promoters and enhancers
More informationChromosome-Wide Analysis of Parental Allele-Specific Chromatin and DNA Methylation
MOLECULAR AND CELLULAR BIOLOGY, Apr. 2011, p. 1757 1770 Vol. 31, No. 8 0270-7306/11/$12.00 doi:10.1128/mcb.00961-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. Chromosome-Wide
More information5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits?
corebio II - genetics: WED 25 April 2018. 2018 Stephanie Moon, Ph.D. - GWAS After this class students should be able to: 1. Compare and contrast methods used to discover the genetic basis of traits or
More informationUKnowledge. University of Kentucky. Matthew Rea University of Kentucky, Meredith Eckstein University of Kentucky,
University of Kentucky UKnowledge Molecular and Cellular Biochemistry Faculty Publications Molecular and Cellular Biochemistry 2-2-2017 Genome-Wide DNA Methylation Reprogramming in Response to Inorganic
More informationComputer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015
Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a
More informationEpigenetics in Sports
Sports Med (2013) 43:93 110 DOI 10.1007/s40279-012-0012-y REVIEW ARTICLE Epigenetics in Sports Tobias Ehlert Perikles Simon Dirk A. Moser Published online: 4 January 2013 Ó Springer International Publishing
More informationSoft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
More information