Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014

Size: px
Start display at page:

Download "Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014"

Transcription

1 Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014

2 Epigenetics in Mainstream Media

3 Epigenetics *Current definition: The study of mitotically and meiotically heritable changes in gene function that cannot be explained by changes in DNA sequence *This definition is being actively debated within the scientific community. What does this mean? And why should we care?

4 Regulation of gene expression in eukaryotic cells Transcription factor Marmorstein, Nature Reviews Mol Cell Bio (2001) Is this version of gene regulation over-simplified?

5 Direct cell reprogramming Vierbuchen and Wernig (2012)

6

7 Ramen Noodles and Chromatin? 4 x 5 x 1

8 Ramen Noodles and Chromatin? 4 x 5 x of noodles!

9

10

11 Histones can be modified, and these modifications can affect gene expression

12 A Histone Code

13 Regulation of gene expression - transcription factors + epigenetics Berger, Nature (2000)

14 Epigenetics Nova ScienceNow, July 2007 Histone modifications Acetylation, methylation, phosphorylation, arginylation, ubiquitination DNA methylation

15 Epigenetics Nova ScienceNow, July 2007 Histone modifications Acetylation, methylation, phosphorylation, arginylation, ubiquitination DNA methylation

16 How are these epigenetic modifications established? There are a host of proteins whose function is to write, erase, or read epigenetic modifications HATs - histone acetyltransferases HDACs - histone deacetylases HMTs - histone methyltransferases DNMTs - DNA methyltransferases

17 How do are cells know which regions should have open or closed chromatin? And how are these regions marked?

18 ChIP experimental workflow PCR Band or no band?

19 Human Genome Sequencing Using traditional Sanger sequencing, it took an international team 11 years and $3 billion to sequence the human genome (about $1 per base pair) Advances in sequencing technology have dramatically reduced the time and cost - currently about $5000 and can be completed in a week - expected to drop to below $1000 in the next months

20 NGS is not just for whole genome sequencing! ChIP-seq - chromatin immunoprecipitation + seq Methyl-seq - DNA methylation sequencing RNA-seq - capture RNA and sequence (vs. microarray) Small RNA-seq - focus on mirnas, snorna, trnas, etc. RIP-seq - RNA immunoprecipitation + seq (to identify RNAs associated with specific proteins) A common thread throughout all of these strategies is to first use another technique to enrich the samples for a given type of analysis, followed by NGS

21 Illumina Next-Generation Sequencing Metzker, Nat Rev Genetics (2010) Allows tens of millions of sequencing reactions to be performed simultaneously Also referred to as massively parallel sequencing

22 Illumina Next-Generation Sequencing Metzker, Nat Rev Genetics (2010) 51x --> 51 bp reads

23 How does next-generation sequencing work? Another name for next-generation sequencing is massively parallel sequencing Illumina

24 Analyzing NGS data requires the assistance of bioinformatics (topic of future Mini-STEM lecture) Mortazavi, et al, Nature Methods (2008)

25 ChIP-seq experimental workflow

26 Mapping the precise locations of histone modifications throughout the entire genome Specific histone modifications have previously had functions ascribed to them, such as facilitating gene expression (H3K4me3) or suppressing gene expression (H3K27me3) H3K4me3 = trimethylation of lysine 4 on histone H3 H3K27me3 = trimethylation of lysine 27 on histone H3

27 ENCODE Encyclopedia of DNA Elements Project that aims to delineate all of the functional elements encoded in the human genome Identification and quantification of RNA species in whole cells and sub cellular compartments Analysis of RNA binding proteins Mapping of noncoding and proteincoding genes Delineation of chromatin and DNA accessibility Mapping of histone modifications and transcription factor-binding sites by ChIP Measurement of DNA methylation Performed 1,640 sequencing studies on 147 different human cell types Examination of long-range chromatin interactions

28 Summary of ENCODE findings The vast majority of the human genome (80.4%) participates in at least one biochemical RNA- and/or chromatin-associated event in at least one cell type 95% of the genome lies within 8 kb of a DNA-protein interaction, and 99% is within 1.7 kb of at least one biochemical event Classifying the genome into seven chromatin states indicates 399,124 regions with enhancer-like features and 70,292 regions with promoter-like features It is possible to correlate quantitatively RNA production and processing with both chromatin marks and transcription factor binding at promoters, indicating that promoter functionality can explain most of the variation in RNA expression Many non-coding variants in individual genome sequences lie in ENCODE-annotated functional regions; this number is at least as large as those that lie in protein-coding regions Single-nucleotide polymorphisms (SNPs) associated with disease by GWAS are enriched within non-coding functional elements, with a majority residing in or near ENCODE-defined regions that are outside of protein coding genes. In many cases, the disease phenotypes can be associated with a specific cell type or transcription factor.

29 Green, et al, Nature (2011)

30 Correlating ChIP-seq data with GWAS SNP studies GWAS = genome-wide association studies SNP = single nucleotide polymorphisms ENCODE Consortium, Nature (2012)

31 Drugs that modify epigenetic modifications DeWoskin and Million, Nature Reviews Drug Discovery (2013)

32 Lithium and valproic acid are both use to treat bipolar disorder - do they work the same way?

33 VPA is an HDAC inhibitor VPA = valproic acid Because of our discovery, VPA has been successfully used clinically in the treatment of different leukemias

34 DNA Methylation Simple modification of cytosine bases, mediated by enzymes called DNA methyltransferases! Approximately 5% of the genome is methylated! The pattern of DNA methylation can overlap, but is distinct for each cell type in our bodies

35 Glycogen Synthase Kinase-3 (Gsk-3) Applies the Brakes to Many Signaling Pathways Cohen, Nature Rev Mol Cell Bio (2006) Barker and Clevers, Nature Rev Drug Discovery (2006)

36 Gsk-3-Deficient Mouse Embryonic Stem Cells WT ESCs Gsk-3 DKO ESCs

37 Whole-Genome Expression Analysis via Microarray 1. Isolate RNA samples. Synthesize DNA copies. RNA population or probes Clinical sample 4. Analyze data and correlate with histoclinical data 2. Hybridize labeled probe with DNA microarray on a chip 8x4x2 2x4x8 3. Scan the chip We recently found that cells deficient in Gsk-3 also have reduced DNA methylation at specific regions of the genome

38 Genome-wide DNA Methylation Sequencing Tony D Ippolito Gavin Meredith, Ph.D. The Ohio State University Major - Molecular Genetics! *Currently - Duke University Ph.D. Program in Genetics Life Technologies R&D Manager

39 Genome-wide DNA Methylation Sequencing Tony D Ippolito Gavin Meredith, Ph.D. The Ohio State University Major - Molecular Genetics! *Currently - Duke University Ph.D. Program in Genetics Life Technologies R&D Manager Which genomic regions in Gsk-3 DKO ESCs are hypomethylated compared to WT ESCs?

40 Genome-wide DNA Methylation Sequencing Tony D Ippolito Gavin Meredith, Ph.D. The Ohio State University Major - Molecular Genetics! *Currently - Duke University Ph.D. Program in Genetics Life Technologies R&D Manager Which genomic regions in Gsk-3 DKO ESCs are hypomethylated compared to WT ESCs?

41 Understanding How DNA Methylation Differences Are Determined via NGS Peaks are built up by aligning sequences to reference genome WT Each box represents a 51 bp fragment of DNA DKO

42 Methyl-Seq Data in Genome Viewer WT DKO

43 Genomic Imprinting, DNA Methylation, and Dnmt3a2 Mammals inherit one copy of each gene from both parents However, not all genes are equally expressed Imprinted genes are those in which one inherited copy is silenced by DNA methylation There have been approximately 100 imprinted genes identified in mice IMPORTANT - these are parent-of-origin effects, not gender effects

44 Genomic Imprinting, DNA Methylation, and Dnmt3a2 Mammals inherit one copy of each gene from both parents However, not all genes are equally expressed Imprinted genes are those in which one inherited copy is silenced by DNA methylation There have been approximately 100 imprinted genes identified in mice IMPORTANT - these are parent-of-origin effects, not gender effects Igf2 - Insulin-like growth factor 2 = methylation

45 Genomic Imprinting, DNA Methylation, and Dnmt3a2 Mammals inherit one copy of each gene from both parents However, not all genes are equally expressed Imprinted genes are those in which one inherited copy is silenced by DNA methylation There have been approximately 100 imprinted genes identified in mice IMPORTANT - these are parent-of-origin effects, not gender effects Igf2 - Insulin-like growth factor 2 = methylation

46 Genomic Imprinting, DNA Methylation, and Dnmt3a2 Mammals inherit one copy of each gene from both parents However, not all genes are equally expressed Imprinted genes are those in which one inherited copy is silenced by DNA methylation There have been approximately 100 imprinted genes identified in mice IMPORTANT - these are parent-of-origin effects, not gender effects Igf2 - Insulin-like growth factor 2 = methylation Human imprinting disorders Beckwith-Wiedemann syndrome/wilm s tumor, Prader-Willi syndrome/angelman syndrome

47 Genomic Imprinting, DNA Methylation, and Dnmt3a2 Mammals inherit one copy of each gene from both parents However, not all genes are equally expressed Imprinted genes are those in which one inherited copy is silenced by DNA methylation There have been approximately 100 imprinted genes identified in mice IMPORTANT - these are parent-of-origin effects, not gender effects Igf2 - Insulin-like growth factor 2 = methylation Human imprinting disorders Beckwith-Wiedemann syndrome/wilm s tumor, Prader-Willi syndrome/angelman syndrome **Dnmt3a/3a2 is the DNA methyltransferase that is responsible for methylating imprinted loci**

48 Genomic Imprinting, DNA Methylation, and Dnmt3a2 Methylated loci Methylation re-established Most of genome demethylated

49 Example of an Imprinted Locus H19/Igf2 Differentially methylated region (DMR)

50 DNA Methylation at the H19 DMR is Reduced in Gsk-3 DKO ESCs 303 bp fragment with 15 CpGs WT % Sequence of 13 clones from WT ESCs DKO % Sequence of 11 clones from DKO ESCs = Unmethylated CpG = Methylated CpG

51 Model for the Regulation of Igf2/H19 Gene Expression in Gsk-3 DKO ESCs

52 Constitutive Activation of Insulin Signaling in Wild-Type Embryonic Stem Cells WT p110* 100 kd 75 kd 75 kd 50 kd 75 kd 50 kd 50 kd PI3K p-akt Akt p-gsk-3 50 kd 50 kd GSK-3 Tubulin Western blots (protein) CST antibodies Cohen, Nature Rev Mol Cell Bio (2006) Phosphorylation of Gsk-3α and Gsk-3β by Akt results in inhibition of Gsk-3 activity

53 Increasing DNA methylation in pregnant Agouti mice results in reduced obesity in the offspring Jirtle and Skinner, Nature Reviews Genetics (2007)

54 The fungicide viclozolin has been reported to cause transgenerational effects in rats Kaiser, Science (2014)

55 Activation of Insulin Signaling via Activated PI3K Results in Reduced DNA Methylation Igf2/H19 DMD WT 81.3% p110* 52.9%

56 Connecting Food Availability to Epigenetics and Disease

57 Connecting Food Availability to Epigenetics and Disease Pembrey, et al, Eur J Med Gen (2006)

58 Could altered insulin signaling be the mechanism behind this effect?? (Insulin signaling & Gsk-3 inhibition)

Epigenetics. Lyle Armstrong. UJ Taylor & Francis Group. f'ci Garland Science NEW YORK AND LONDON

Epigenetics. Lyle Armstrong. UJ Taylor & Francis Group. f'ci Garland Science NEW YORK AND LONDON ... Epigenetics Lyle Armstrong f'ci Garland Science UJ Taylor & Francis Group NEW YORK AND LONDON Contents CHAPTER 1 INTRODUCTION TO 3.2 CHROMATIN ARCHITECTURE 21 THE STUDY OF EPIGENETICS 1.1 THE CORE

More information

Epigenetics Armstrong_Prelims.indd 1 04/11/2013 3:28 pm

Epigenetics Armstrong_Prelims.indd 1 04/11/2013 3:28 pm Epigenetics Epigenetics Lyle Armstrong vi Online resources Accessible from www.garlandscience.com, the Student and Instructor Resource Websites provide learning and teaching tools created for Epigenetics.

More information

Genetics and Genomics in Medicine Chapter 6 Questions

Genetics and Genomics in Medicine Chapter 6 Questions Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions

More information

Epigenetics 101. Kevin Sweet, MS, CGC Division of Human Genetics

Epigenetics 101. Kevin Sweet, MS, CGC Division of Human Genetics Epigenetics 101 Kevin Sweet, MS, CGC Division of Human Genetics Learning Objectives 1. Evaluate the genetic code and the role epigenetic modification plays in common complex disease 2. Evaluate the effects

More information

R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS

R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS EPIGENETICS THE STUDY OF CHANGES IN GENE EXPRESSION THAT ARE POTENTIALLY HERITABLE AND THAT DO NOT ENTAIL A

More information

Lecture 27. Epigenetic regulation of gene expression during development

Lecture 27. Epigenetic regulation of gene expression during development Lecture 27 Epigenetic regulation of gene expression during development Development of a multicellular organism is not only determined by the DNA sequence but also epigenetically through DNA methylation

More information

Imprinting. Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821

Imprinting. Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821 Imprinting Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821 Learning Objectives 1. To understand the basic concepts of genomic imprinting Genomic imprinting is an epigenetic phenomenon that causes

More information

Fragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype

Fragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype Fragile X Syndrome Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype A loss of function of the FMR-1 gene results in severe learning problems, intellectual disability

More information

Histones modifications and variants

Histones modifications and variants Histones modifications and variants Dr. Institute of Molecular Biology, Johannes Gutenberg University, Mainz www.imb.de Lecture Objectives 1. Chromatin structure and function Chromatin and cell state Nucleosome

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Epigenetics and Chromatin Remodeling

Epigenetics and Chromatin Remodeling Epigenetics and Chromatin Remodeling Bradford Coffee, PhD, FACMG Emory University Atlanta, GA Speaker Disclosure Information Grant/Research Support: none Salary/Consultant Fees: none Board/Committee/Advisory

More information

EPIGENOMICS PROFILING SERVICES

EPIGENOMICS PROFILING SERVICES EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation

More information

Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3

Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3 Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3 1 Department of Biotechnology, JMIT, Radaur, Haryana, India 2 KITM, Kurukshetra, Haryana, India 3 NIDDK, National Institute of Health,

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Accessing and Using ENCODE Data Dr. Peggy J. Farnham

Accessing and Using ENCODE Data Dr. Peggy J. Farnham 1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000

More information

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq) RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome

More information

Gene Expression DNA RNA. Protein. Metabolites, stress, environment

Gene Expression DNA RNA. Protein. Metabolites, stress, environment Gene Expression DNA RNA Protein Metabolites, stress, environment 1 EPIGENETICS The study of alterations in gene function that cannot be explained by changes in DNA sequence. Epigenetic gene regulatory

More information

Epigenetic Inheritance

Epigenetic Inheritance (2) The role of Epigenetic Inheritance Lamarck Revisited Lamarck was incorrect in thinking that the inheritance of acquired characters is the main mechanism of evolution (Natural Selection more common)

More information

Are you the way you are because of the

Are you the way you are because of the EPIGENETICS Are you the way you are because of the It s my fault!! Nurture Genes you inherited from your parents? Nature Experiences during your life? Similar DNA Asthma, Autism, TWINS Bipolar Disorders

More information

Epigenetics: Basic Principals and role in health and disease

Epigenetics: Basic Principals and role in health and disease Epigenetics: Basic Principals and role in health and disease Cambridge Masterclass Workshop on Epigenetics in GI Health and Disease 3 rd September 2013 Matt Zilbauer Overview Basic principals of Epigenetics

More information

Today. Genomic Imprinting & X-Inactivation

Today. Genomic Imprinting & X-Inactivation Today 1. Quiz (~12 min) 2. Genomic imprinting in mammals 3. X-chromosome inactivation in mammals Note that readings on Dosage Compensation and Genomic Imprinting in Mammals are on our web site. Genomic

More information

An epigenetic approach to understanding (and predicting?) environmental effects on gene expression

An epigenetic approach to understanding (and predicting?) environmental effects on gene expression www.collaslab.com An epigenetic approach to understanding (and predicting?) environmental effects on gene expression Philippe Collas University of Oslo Institute of Basic Medical Sciences Stem Cell Epigenetics

More information

Allelic reprogramming of the histone modification H3K4me3 in early mammalian development

Allelic reprogramming of the histone modification H3K4me3 in early mammalian development Allelic reprogramming of the histone modification H3K4me3 in early mammalian development 张戈 Method and material STAR ChIP seq (small-scale TELP-assisted rapid ChIP seq) 200 mouse embryonic stem cells PWK/PhJ

More information

Epigenomics. Ivana de la Serna Block Health Science

Epigenomics. Ivana de la Serna Block Health Science Epigenomics Ivana de la Serna Block Health Science 388 383-4111 ivana.delaserna@utoledo.edu Outline 1. Epigenetics-definition and overview 2. DNA methylation/hydroxymethylation 3. Histone modifications

More information

Back to the Basics: Methyl-Seq 101

Back to the Basics: Methyl-Seq 101 Back to the Basics: Methyl-Seq 101 Presented By: Alex Siebold, Ph.D. October 9, 2013 Field Applications Scientist Agilent Technologies Life Sciences & Diagnostics Group Life Sciences & Diagnostics Group

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.

Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells. Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized

More information

Stem Cell Epigenetics

Stem Cell Epigenetics Stem Cell Epigenetics Philippe Collas University of Oslo Institute of Basic Medical Sciences Norwegian Center for Stem Cell Research www.collaslab.com Source of stem cells in the body Somatic ( adult )

More information

Results. Abstract. Introduc4on. Conclusions. Methods. Funding

Results. Abstract. Introduc4on. Conclusions. Methods. Funding . expression that plays a role in many cellular processes affecting a variety of traits. In this study DNA methylation was assessed in neuronal tissue from three pigs (frontal lobe) and one great tit (whole

More information

An Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice

An Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice An Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice Mei-Yi Wu 1 *, Ming Jiang 1, Xiaodong Zhai 2, Arthur L. Beaudet 2, Ray-Chang Wu 1 * 1 Department of

More information

Chromatin-Based Regulation of Gene Expression

Chromatin-Based Regulation of Gene Expression Chromatin-Based Regulation of Gene Expression.George J. Quellhorst, Jr., PhD.Associate Director, R&D.Biological Content Development Topics to be Discussed Importance of Chromatin-Based Regulation Mechanism

More information

DNA methylation & demethylation

DNA methylation & demethylation DNA methylation & demethylation Lars Schomacher (Group Christof Niehrs) What is Epigenetics? Epigenetics is the study of heritable changes in gene expression (active versus inactive genes) that do not

More information

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological

More information

DNA methylation: a potential clinical biomarker for the detection of human cancers

DNA methylation: a potential clinical biomarker for the detection of human cancers DNA methylation: a potential clinical biomarker for the detection of human cancers Name: Tong Samuel Supervisor: Zigui CHEN Date: 1 st December 2016 Department: Microbiology Source: cited from Jakubowski,

More information

Eukaryotic transcription (III)

Eukaryotic transcription (III) Eukaryotic transcription (III) 1. Chromosome and chromatin structure Chromatin, chromatid, and chromosome chromatin Genomes exist as chromatins before or after cell division (interphase) but as chromatids

More information

Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017

Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017 Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of

More information

Nature Structural & Molecular Biology: doi: /nsmb.2419

Nature Structural & Molecular Biology: doi: /nsmb.2419 Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb

More information

Session 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology

Session 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology Session 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology Bhaskar Gollapudi, Ph.D The Dow Chemical Company Workshop: Genetic Toxicology: Opportunities to Integrate New Approaches

More information

Session 6: Integration of epigenetic data. Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016

Session 6: Integration of epigenetic data. Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016 Session 6: Integration of epigenetic data Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016 Utilizing complimentary datasets Frequent mutations in chromatin regulators

More information

Epigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation

Epigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation Epigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation Robert FEIL Director of Research CNRS & University of Montpellier, Montpellier, France. E-mail:

More information

Transcriptional and Epigenetic Mechanisms of Addiction

Transcriptional and Epigenetic Mechanisms of Addiction Transcriptional and Epigenetic Mechanisms of Addiction Eric J. Nestler Mount Sinai School of Medicine New York, NY Dr. Ray Fuller There is every reason to be optimistic that in the future we will find

More information

Joanna Hillman Michael Higgins Lab Oncology for Scientists I 10/29/2015

Joanna Hillman Michael Higgins Lab Oncology for Scientists I 10/29/2015 Joanna Hillman Michael Higgins Lab Oncology for Scientists I 10/29/2015 ! Define Epigenetics & Genomic Imprinting! Discovery! What is the imprint! Lifecycle of an Imprint DMRs and ICEs! 2 main mechanisms

More information

The Epigenome Tools 2: ChIP-Seq and Data Analysis

The Epigenome Tools 2: ChIP-Seq and Data Analysis The Epigenome Tools 2: ChIP-Seq and Data Analysis Chongzhi Zang zang@virginia.edu http://zanglab.com PHS5705: Public Health Genomics March 20, 2017 1 Outline Epigenome: basics review ChIP-seq overview

More information

GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG

GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG Lecture 6 GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG CGTACTGCAACCGGCGGGCCACGCCCCCGTGAAAAGAAGGTTGTT TTCTCCACATTTCGGGGTTCTGGACGTTTCCCGGCTGCGGGGCGG

More information

Transcriptional repression of Xi

Transcriptional repression of Xi Transcriptional repression of Xi Xist Transcription of Xist Xist RNA Spreading of Xist Recruitment of repression factors. Stable repression Translocated Xic cannot efficiently silence autosome regions.

More information

Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc

Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression Chromatin Array of nuc 1 Transcriptional control in Eukaryotes: Chromatin undergoes structural changes

More information

Epigenetics in evolution and disease

Epigenetics in evolution and disease Epigenetics in evolution and disease Manel Esteller We are not our genes. Genes are just part of the story. We cannot fully blame our genome for our behaviour and susceptibility to disease. In Lehninger

More information

AN INTRODUCTION TO EPIGENETICS DR CHLOE WONG

AN INTRODUCTION TO EPIGENETICS DR CHLOE WONG AN INTRODUCTION TO EPIGENETICS DR CHLOE WONG MRC SGDP CENTRE, INSTITUTE OF PSYCHIATRY KING S COLLEGE LONDON Oct 2015 Lecture Overview WHY WHAT EPIGENETICS IN PSYCHIARTY Technology-driven genomics research

More information

Biochemical Determinants Governing Redox Regulated Changes in Gene Expression and Chromatin Structure

Biochemical Determinants Governing Redox Regulated Changes in Gene Expression and Chromatin Structure Biochemical Determinants Governing Redox Regulated Changes in Gene Expression and Chromatin Structure Frederick E. Domann, Ph.D. Associate Professor of Radiation Oncology The University of Iowa Iowa City,

More information

Epigenetic Mechanisms

Epigenetic Mechanisms RCPA Lecture Epigenetic chanisms Jeff Craig Early Life Epigenetics Group, MCRI Dept. of Paediatrics Overview What is epigenetics? Chromatin The epigenetic code What is epigenetics? the interactions of

More information

4/20/2016. Objectives. Epigenetic Definitions. Gene Expression. More Questions. Questions to Consider

4/20/2016. Objectives. Epigenetic Definitions. Gene Expression. More Questions. Questions to Consider Objectives Epigentics: You Might Be What Your Grandmother Ate Lynda Britton, Ph.D., MLS(ASCP) CM Professor LSU Health Shreveport Discuss epigenetics and its role in cancer, imprinting and X chromosome

More information

Lecture 8. Eukaryotic gene regulation: post translational modifications of histones

Lecture 8. Eukaryotic gene regulation: post translational modifications of histones Lecture 8 Eukaryotic gene regulation: post translational modifications of histones Recap.. Eukaryotic RNA polymerases Core promoter elements General transcription factors Enhancers and upstream activation

More information

Genetics and Genomics in Medicine Chapter 6. Questions & Answers

Genetics and Genomics in Medicine Chapter 6. Questions & Answers Genetics and Genomics in Medicine Chapter 6 Multiple Choice Questions Questions & Answers Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the

More information

Statistical Genetics. Matthew Stephens. Statistics Retreat, October 26th 2012

Statistical Genetics. Matthew Stephens. Statistics Retreat, October 26th 2012 Statistical Genetics Statistics Retreat, October 26th 2012 Two stories The two most influential statistical ideas in analysis of genetic association studies. 1 Sequence, sequence, everywhere. 1 With apologies

More information

Yue Wei 1, Rui Chen 2, Carlos E. Bueso-Ramos 3, Hui Yang 1, and Guillermo Garcia-Manero 1

Yue Wei 1, Rui Chen 2, Carlos E. Bueso-Ramos 3, Hui Yang 1, and Guillermo Garcia-Manero 1 Genome-wide CHIP-Seq Analysis of Histone Methylation Reveals Modulators of NF- B Signaling And the Histone Demethylase JMJD3 Implicated in Myelodysplastic Syndrome Yue Wei 1, Rui Chen 2, Carlos E. Bueso-Ramos

More information

FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION. Jude Fitzgibbon

FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION. Jude Fitzgibbon FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION Jude Fitzgibbon j.fitzgibbon@qmul.ac.uk Molecular Predictors of Clinical outcome Responders Alive Non-responders Dead TUMOUR GENETICS Targeted therapy, Prognostic

More information

Epigenetics DNA methylation. Biosciences 741: Genomics Fall, 2013 Week 13. DNA Methylation

Epigenetics DNA methylation. Biosciences 741: Genomics Fall, 2013 Week 13. DNA Methylation Epigenetics DNA methylation Biosciences 741: Genomics Fall, 2013 Week 13 DNA Methylation Most methylated cytosines are found in the dinucleotide sequence CG, denoted mcpg. The restriction enzyme HpaII

More information

Genes, Aging and Skin. Helen Knaggs Vice President, Nu Skin Global R&D

Genes, Aging and Skin. Helen Knaggs Vice President, Nu Skin Global R&D Genes, Aging and Skin Helen Knaggs Vice President, Nu Skin Global R&D Presentation Overview Skin aging Genes and genomics How do genes influence skin appearance? Can the use of Genomic Technology enable

More information

I) Development: tissue differentiation and timing II) Whole Chromosome Regulation

I) Development: tissue differentiation and timing II) Whole Chromosome Regulation Epigenesis: Gene Regulation Epigenesis : Gene Regulation I) Development: tissue differentiation and timing II) Whole Chromosome Regulation (X chromosome inactivation or Lyonization) III) Regulation during

More information

DNA and Histone Methylation in Learning and Memory

DNA and Histone Methylation in Learning and Memory EXPERIMENTAL BIOLOGY ANNUAL MEETING April 2010 DNA and Histone Methylation in Learning and Memory J. David Sweatt Dept of Neurobiology McKnight Brain Institute UAB School of Medicine The Molecular Basis

More information

Epigenetic Reprogramming for Cardiovascular Regeneration Chromatin Remodeling in Cardiovascular Development and Physiology

Epigenetic Reprogramming for Cardiovascular Regeneration Chromatin Remodeling in Cardiovascular Development and Physiology This Review is part of a thematic series on Epigenetics, which includes the following articles: Epigenetic Regulation of the Cardiovascular System: Introduction to a Review Series Epigenome Mapping in

More information

Molecular Cell Biology. Prof. D. Karunagaran. Department of Biotechnology. Indian Institute of Technology Madras

Molecular Cell Biology. Prof. D. Karunagaran. Department of Biotechnology. Indian Institute of Technology Madras Molecular Cell Biology Prof. D. Karunagaran Department of Biotechnology Indian Institute of Technology Madras Module-9 Molecular Basis of Cancer, Oncogenes and Tumor Suppressor Genes Lecture 6 Epigenetics

More information

Epigenetics: A historical overview Dr. Robin Holliday

Epigenetics: A historical overview Dr. Robin Holliday Epigenetics 1 Rival hypotheses Epigenisis - The embryo is initially undifferentiated. As development proceeds, increasing levels of complexity emerge giving rise to the larval stage or to the adult organism.

More information

Long noncoding RNAs in DNA methylation: new players stepping into the old game

Long noncoding RNAs in DNA methylation: new players stepping into the old game DOI 10.1186/s13578-016-0109-3 Cell & Bioscience REVIEW Long noncoding RNAs in DNA methylation: new players stepping into the old game Yu Zhao 1, Hao Sun 1,2* and Huating Wang 1,3* Open Access Abstract

More information

H19 Chromatin Insulator in Development and DiseaseEpigenetic Regulation of the

H19 Chromatin Insulator in Development and DiseaseEpigenetic Regulation of the Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 825 H19 Chromatin Insulator in Development and DiseaseEpigenetic Regulation of the BY CLAES HOLMGREN ACTA UNIVERSITATIS

More information

Bisphenol A Exposure Disrupts Genomic Imprinting in the Mouse

Bisphenol A Exposure Disrupts Genomic Imprinting in the Mouse Bisphenol A Exposure Disrupts Genomic Imprinting in the Mouse Martha Susiarjo 1,2, Isaac Sasson 3, Clementina Mesaros 4, Marisa S. Bartolomei 1,2 * 1 Department of Cell and Developmental Biology, University

More information

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the

More information

Epigenetic mechanisms and the development of asthma

Epigenetic mechanisms and the development of asthma Mechanisms of allergic diseases Series editors: Joshua A. Boyce, MD, Fred Finkelman, MD, and William T. Shearer, MD, PhD Epigenetic mechanisms and the development of asthma Ivana V. Yang, PhD, and David

More information

ChIP-seq data analysis

ChIP-seq data analysis ChIP-seq data analysis Harri Lähdesmäki Department of Computer Science Aalto University November 24, 2017 Contents Background ChIP-seq protocol ChIP-seq data analysis Transcriptional regulation Transcriptional

More information

Epigenetics and Environmental Health A Step-by-Step Tutorial

Epigenetics and Environmental Health A Step-by-Step Tutorial Powerful ideas for a healthier world Epigenetics and Environmental Health A Step-by-Step Tutorial Andrea Baccarelli, MD, PhD, MPH Laboratory of Environmental Epigenetics Objective of my presentation To

More information

Ch. 18 Regulation of Gene Expression

Ch. 18 Regulation of Gene Expression Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate

More information

Epigenetic Principles and Mechanisms Underlying Nervous System Function in Health and Disease Mark F. Mehler MD, FAAN

Epigenetic Principles and Mechanisms Underlying Nervous System Function in Health and Disease Mark F. Mehler MD, FAAN Epigenetic Principles and Mechanisms Underlying Nervous System Function in Health and Disease Mark F. Mehler MD, FAAN Institute for Brain Disorders and Neural Regeneration F.M. Kirby Program in Neural

More information

Epigenetics q&more 01.11

Epigenetics q&more 01.11 Laurie. Knight, istockphoto.com Epigenetics 6 Bookmarks About the reading of genes in the Book of Life Prof. Dr. Manfred Jung, Julia M. Wagner, Institute for Pharmaceutical Sciences, Albert-Ludwig-University

More information

Supplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region

Supplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region Supplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region methylation in relation to PSS and fetal coupling. A, PSS values for participants whose placentas showed low,

More information

L epigenetica si riferisce a tutti i cambiamenti dell espressione genica e dell organizzazione della cromatina che sono indipendenti dalla sequenza

L epigenetica si riferisce a tutti i cambiamenti dell espressione genica e dell organizzazione della cromatina che sono indipendenti dalla sequenza L epigenetica si riferisce a tutti i cambiamenti dell espressione genica e dell organizzazione della cromatina che sono indipendenti dalla sequenza del DNA. Epigenome provides instructions and regulates

More information

Regulation of Gene Expression in Eukaryotes

Regulation of Gene Expression in Eukaryotes Ch. 19 Regulation of Gene Expression in Eukaryotes BIOL 222 Differential Gene Expression in Eukaryotes Signal Cells in a multicellular eukaryotic organism genetically identical differential gene expression

More information

Introduction to Systems Biology of Cancer Lecture 2

Introduction to Systems Biology of Cancer Lecture 2 Introduction to Systems Biology of Cancer Lecture 2 Gustavo Stolovitzky IBM Research Icahn School of Medicine at Mt Sinai DREAM Challenges High throughput measurements: The age of omics Systems Biology

More information

Dedicated to my family

Dedicated to my family Dedicated to my family List of Papers This thesis is based on the following papers, which are referred to in the text by their Roman numerals. I Mohammad F*, Pandey RR*, Nagano T, Chakalova L, Mondal

More information

DNA-seq Bioinformatics Analysis: Copy Number Variation

DNA-seq Bioinformatics Analysis: Copy Number Variation DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq

More information

PRADER WILLI/ANGELMAN

PRADER WILLI/ANGELMAN SALSA MS-MLPA probemix ME028-B2 PRADER WILLI/ANGELMAN Lot B2-0811: As compared to version B1 (lot B1-0609, B1-1108), the 88 and 96 nt control fragments have been replaced (QDX2). PRADER-WILLI SYNDROME

More information

Epigenetic mechanisms and their implications in animal breeding

Epigenetic mechanisms and their implications in animal breeding Epigenetic mechanisms and their implications in animal breeding Klaus Wimmers, Nares Trakooljul, Michael Oster, Eduard Murani, Siriluck Ponsuksili Leibniz Institute for Farm Animal Biology (FBN), Germany

More information

MRC-Holland MLPA. Description version 52; 22 July 2015

MRC-Holland MLPA. Description version 52; 22 July 2015 SALSA MS-MLPA probemix ME028-B2 Prader-Willi/Angelman Lot B2-0413, lot B2-0811. As compared to version B1 (lot B1-0609), the control fragments have been replaced (QDX2). PRADER-WILLI SYNDROME (PWS) and

More information

Breast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data

Breast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing

More information

Epigenetics & cancer. Present by : Sanaz Zebardast Under supervision : Dr. Gheibi. 31 December 2016

Epigenetics & cancer. Present by : Sanaz Zebardast Under supervision : Dr. Gheibi. 31 December 2016 Epigenetics & cancer Present by : Sanaz Zebardast Under supervision : Dr. Gheibi 31 December 2016 1 contents Introduction Epigenetic & signaling pathways Epigenetic & integral protein Epigenetic & apoptosis

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

OVERVIEW OF EPIGENETICS

OVERVIEW OF EPIGENETICS OVERVIEW OF EIENETICS Date: * Time: 9:00 am - 9:50 am * Room: Berryhill 103 Lecturer: Terry Magnuson 4312 MBRB trm4@med.unc.edu 843-6475 *lease consult the online schedule for this course for the definitive

More information

Genome-wide Association Studies (GWAS) Pasieka, Science Photo Library

Genome-wide Association Studies (GWAS) Pasieka, Science Photo Library Lecture 5 Genome-wide Association Studies (GWAS) Pasieka, Science Photo Library Chi-squared test to evaluate whether the odds ratio is different from 1. Corrected for multiple testing Source: wikipedia.org

More information

Epigenetics and Human Disease

Epigenetics and Human Disease Epigenetics and Human Disease May 28, 2014 1 Angelman Syndrome & Prader-Willi Syndrome Sister Syndromes Angelman Syndrome ~1/20,000 births happy disposition smile often bouts of laughter minimal verbal

More information

Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated

Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated with the H3K27me3 mark in chondrocytes (see Table S1,

More information

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study. mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their

More information

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.

Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different

More information

Analysis of shotgun bisulfite sequencing of cancer samples

Analysis of shotgun bisulfite sequencing of cancer samples Analysis of shotgun bisulfite sequencing of cancer samples Kasper Daniel Hansen Postdoc with Rafael Irizarry Johns Hopkins Bloomberg School of Public Health Brixen, July 1st, 2011 The

More information

ChromHMM Tutorial. Jason Ernst Assistant Professor University of California, Los Angeles

ChromHMM Tutorial. Jason Ernst Assistant Professor University of California, Los Angeles ChromHMM Tutorial Jason Ernst Assistant Professor University of California, Los Angeles Talk Outline Chromatin states analysis and ChromHMM Accessing chromatin state annotations for ENCODE2 and Roadmap

More information

Transcription Regulation And Gene Expression in Eukaryotes Cycle G2 (lecture 13709) FS 2014 P Matthias & RG Clerc

Transcription Regulation And Gene Expression in Eukaryotes Cycle G2 (lecture 13709) FS 2014 P Matthias & RG Clerc Transcription Regulation And Gene Expression in Eukaryotes Cycle G2 (lecture 13709) FS 2014 P Matthias & RG Clerc P. Matthias, 16 April 2014 DNA methylation basics Acetylation Acetyltransferases/Deacetylases

More information

Comparative DNA methylome analysis of endometrial carcinoma reveals complex and distinct deregulation of cancer promoters and enhancers

Comparative DNA methylome analysis of endometrial carcinoma reveals complex and distinct deregulation of cancer promoters and enhancers Zhang et al. BMC Genomics 2014, 15:868 RESEARCH ARTICLE Open Access Comparative DNA methylome analysis of endometrial carcinoma reveals complex and distinct deregulation of cancer promoters and enhancers

More information

Chromosome-Wide Analysis of Parental Allele-Specific Chromatin and DNA Methylation

Chromosome-Wide Analysis of Parental Allele-Specific Chromatin and DNA Methylation MOLECULAR AND CELLULAR BIOLOGY, Apr. 2011, p. 1757 1770 Vol. 31, No. 8 0270-7306/11/$12.00 doi:10.1128/mcb.00961-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. Chromosome-Wide

More information

5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits?

5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits? corebio II - genetics: WED 25 April 2018. 2018 Stephanie Moon, Ph.D. - GWAS After this class students should be able to: 1. Compare and contrast methods used to discover the genetic basis of traits or

More information

UKnowledge. University of Kentucky. Matthew Rea University of Kentucky, Meredith Eckstein University of Kentucky,

UKnowledge. University of Kentucky. Matthew Rea University of Kentucky, Meredith Eckstein University of Kentucky, University of Kentucky UKnowledge Molecular and Cellular Biochemistry Faculty Publications Molecular and Cellular Biochemistry 2-2-2017 Genome-Wide DNA Methylation Reprogramming in Response to Inorganic

More information

Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015

Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015 Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a

More information

Epigenetics in Sports

Epigenetics in Sports Sports Med (2013) 43:93 110 DOI 10.1007/s40279-012-0012-y REVIEW ARTICLE Epigenetics in Sports Tobias Ehlert Perikles Simon Dirk A. Moser Published online: 4 January 2013 Ó Springer International Publishing

More information

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.

More information