Supplemental Data. Integrating omics and alternative splicing i reveals insights i into grape response to high temperature
|
|
|
- Franklin Henry
- 5 years ago
- Views:
Transcription
1 Supplemental Data Integrating omics and alternative splicing i reveals insights i into grape response to high temperature Jianfu Jiang 1, Xinna Liu 1, Guotian Liu, Chonghuih Liu*, Shaohuah Li*, and Lijun Wang* Zhengzhou Fruit Research Institute (J.J., C.L.), Chinese Academy of Agricultural Sciences, Zhengzhou , China; and Institute of Botany (X.L., G.L., S.L., L.W.), Chinese Academy of Sciences, Beijing , China 1 These authors contributed equally to the article. *Address correspondence to ljwang@ibcas.ac.cn, shhli@ibcas.ac.cn and liuchonghuai@caas.cn
2 Supplemental Figure S1. Cluster analysis for all transcripts in grape leaves under four different temperatures (25 o C, 35 o C, 40 o C and 45 o C). T25_1, T25_2 and T25_3 indicate three replicates of 25 o C treatment. Representations of the other treatments were similar to 25 o C treatment.
3 25 o C 35 o C 40 o C 45 o C 25 o C 35 o C 40 o C 45 o C Supplemental Figure S2. Summary number of differentially expressed transcripts in grape leaves under 35 o C, 40 o C and 45 o C compared to 25 o C at a fold change larger than 2 and false discovery rate (FDR) less than 0.05.
4 Quantitative Proteome Temperature Repeat1/2/ Proteome extract Trypsin digestion Sample Preparation RNA-Sequencing Gene expression Alternative splicing itraq-labeling Combine Data analysis and integration RAW MGF X! Tandem 2D-HPLC-MS/MS MaxQuant Protein Quantitation Uniprot database + 3-frame RefSeq transcripts Proteotranscriptomics analysis Functionally integrated Omics Supplemental Figure S3. Flow chart of RNA-sequencing and quantitative proteome for grape leaves.
5 Supplemental Figure S4. Venn diagram of non-redundant Uniprot annotated proteins identified with at least 2 unique peptides (protein and peptide FDR < 0.01) in grape leaves. EXP1, EXP2 and EXP3 indicate three replicates of each treatments of 25 o C, 35 o C, 40 o C and 45 o C. The overlapping regions correspond to the number of proteins present at more than one temperature treatment.
6 Up-regulation Down-regulation Supplemental Figure S5. Up and down-regulated biological pathways of differentially expressed proteins in grape leaves under 35 o C compared to 25 o C.
7 Up-regulation Down-regulation Supplemental Figure S6. Up and down regulated biological pathways of differentially expressed proteins in grape leaves under 40 o C compared to 25 o C.
8 Supplemental Figure S7a. Up-regulated biological pathways of differentially expressed proteins in grape leaves under 45 o C compared to 25 o C.
9 Supplemental Figure S7b. Down-regulated biological pathways of differentially expressed proteins in grape leaves under 45 o C compared to 25 o C.
10 R² = qrt-pcr R RNA-sequencing Supplemental lfigure S8. Linear correlation analysis (r 2 = ) between qrt-pcr and RNA-sequencing results for 35 genes in grape leaves under four temperatures (25 o C, 35 o C, 40 o C and 45 o C). The X-axis refers to fold change values from RNA-sequencing data; the Y-axis refers to fold change values from qrt-pcr data.
11 25 o C-1 25 o C-1 25 o C-2 25 o C-2 25 o C-3 25 o C-3 40 o C-1 45 o C-1 40 o C-2 45 o C-2 40 o C-3 45 o C-3 Fully spliced transcript Exon Intron Exon Exon Intron Exon IR transcript Supplemental Figure S9. The sashimi plots of a HSP90.1 transcript with an IR event in grape leaves under 40 o Cand 45 o Ccomparedto25 o C. Each treatment has three replicates. 25 o C-1, 25 o C-2 and 25 o C-3 represent three replicates of the control 25 o Cfor2h.40 o C-1, 40 o C-2 and 40 o C-3 represent three replicates of the 40 o Cfor2h.45 o C-1, 45 o C-2 and 45 o C-3 represent three replicates of the 45 o C for 2 h. Sashimi plots (stand-alone) alone) for alternatively spliced exon and flanking exons in samples. Per-base expression is plotted on y-axis of Sashimi plot, genomic coordinates on x-axis. Arcs represents splice junctions connecting exons and displays the number of reads split across the junction (junction depth). mrna isoforms quantified are shown on bottom (exons in black, introns as lines with arrow heads).
12 25 o C-1 25 o C-2 25 o C-3 40 o C-1 40 o C-2 25 o C-1 25 o C-2 25 o C-3 45 o C-1 45 o C-2 40 o C-3 45 o C-3 Exon Intron Exon Exon Intron Exon Fully spliced transcript IR transcript Supplemental Figure S10. The sashimi plots of a HSP25.3 transcript with an IR event in grape leaves under 40 o C and 45 o Ccomparedto25 o C. Each treatment has three replicates. 25 o C-1, 25 o C-2 and 25 o C-3 represent three replicates of the control 25 o Cfor2h.40 o C-1, 40 o C-2 and 40 o C-3 represent three replicates of the 40 o Cfor2h.45 o C-1, 45 o C-2 and 45 o C-3 represent three replicates of the 45 o C for 2 h. Sashimi plots (stand-alone) for alternatively spliced exon and flanking exons in samples. Per-base expression is plotted on y-axis of Sashimi plot, genomic coordinates on x-axis. Arcs represents splice junctions connecting exons and displays the number of reads split across the junction (junction depth). mrna isoforms quantified are shown on bottom (exons in black, introns as lines with arrow heads).
13 25 o C-1 25 o C-2 25 o C-3 40 o C-1 40 o C-2 40 o C-3 25 o C-1 25 o C-2 25 o C-3 45 o C-1 45 o C-2 45 o C-3 Exon Intron Exon Exon Intron Exon Fully spliced transcript IR transcript Supplemental Figure S11. The sashimi plots of a HSP101 transcript with an IR event in grape leaves under 40 o C and 45 o Ccomparedto25 o C. Each treatment has three replicates. 25 o C-1, 25 o C-2 and 25 o C-3 represent three replicates of the control 25 o Cfor2h.40 o C-1, 40 o C-2 and 40 o C-3 represent three replicates of the 40 o Cfor2h.45 o C-1, 45 o C-2 and 45 o C-3 represent three replicates of the 45 o C for 2 h. Sashimi plots (stand-alone) alone) for alternatively spliced exon and flanking exons in samples. Per-base expression is plotted on y-axis of Sashimi plot, genomic coordinates on x-axis. Arcs represents splice junctions connecting exons and displays the number of reads split across the junction (junction depth). mrna isoforms quantified are shown on bottom (exons in black, introns as lines with arrow heads).
14 25 o C-1 25 o C-2 25 o C-3 40 o C-1 40 o C-2 40 o C-3 25 o C-1 25 o C-2 25 o C-3 45 o C-1 45 o C-2 45 o C-3 Exon Intron Exon Exon Intron Exon Fully spliced transcript IR transcript Supplemental Figure S12. The sashimi plots of a HSP70.4 transcript with an IR event in grape leaves under 40 o C and 45 o Ccomparedto25 o C. Each treatment has three replicates. 25 o C-1, 25 o C-2 and 25 o C-3 represent three replicates of the control 25 o Cfor2h.40 o C-1, 40 o C-2 and 40 o C-3 represent three replicates of the 40 o Cfor2h.45 o C-1, 45 o C-2 and 45 o C-3 represent three replicates of the 45 o C for 2 h. Sashimi plots (stand-alone) alone) for alternatively spliced exon and flanking exons in samples. Per-base expression is plotted on y-axis of Sashimi plot, genomic coordinates on x-axis. Arcs represents splice junctions connecting exons and displays the number of reads split across the junction (junction depth). mrna isoforms quantified are shown on bottom (exons in black, introns as lines with arrow heads).
15 VIT_16s0050g (HSP90.1) VIT_16s0098g (HSP25.3) 25 o C 35 o C 40 o C 45 o C 一 361 bp IR transcript 一 239 bp Fully spliced transcript 672 bp IR transcript 一 592 bp Fully spliced transcript VIT_17s0000g (HSP101 ) VIT_08s0007g (HSP70.4) Actin 一 615 bp IR transcript 3 一 505 bp Fully splicedt ranscript5n/ 一 1705 bp IR transcript 一 917 bp Fully spliced transcript 一 82 bp HSP101 25/35/40/45 / / Supplemental Figure S13. RT-PCR analysis of IR splice variants of HSP90.1, HSP25.3, HSP101 and HSP70.4 in grape leaves under 25 o C, 35 o C, 40 o C and 45 o C for 2 h. The forward and reverse primers were designed from the upstream and downstream exons of the retention intron based on each IR event, respectively.
16 Sample preparation and RNA -sequencing Sequencing reads Genome Map to genome and annotated genes Compute reads distribution Alternative splicing ES IR A5S events S Intron Exon A3SS MXE MXE Differential splicing events under 35 o C, 40 o C and 45 o C compared to25 o C were selected Occurrence of splicing events was showed with Sashimi plots generated by MISO Supplemental Figure S14. Flow chart of alternative splicing analysis for grape leaves under different temperatures
17 Supplemental Figure S15. The schematic diagrams illustrating the read counts and effective lengths of different categories of alternative splicing events. The alternative splicing events of skipped exons, alternative 5 splice sites, alternative 3 splice sites, and retained introns have two splice junctions for the inclusion isoform and one splice junction for the skipping isoform. The mutually exclusive exons have two splice junctions for the inclusion isoform of the first exon and two splice junctions for the skipping isoform of the first exon (i.e., the inclusion isoform of the second exon). The exon body reads are RNA-Seq reads mapped to the genomic regions of the target exons. The rmats model allows users to use either the splice junction counts plus the exon body counts or the splice junction counts alone as the input. This figure is from Shen et al. (2014).
18 Supplemental Table S1. Statistics of all AS events in grape leaves under 35 o C, 40 o C and 45 o C compared to 25 o C. 35 o C 40 o C 45 o C IR ES A5SS A3SS MXE Total AS: alternative splicing; IR: intron retention; ES: exon skipping; MXE: mutually exclusive exons; A5SS: alternative 5 splice sites; A3SS: alternative 3 splice sites
19 Supplemental Table S2. Statistics of all genes with significantly differential AS events in grape leaves under 35 o C, 40 o C and 45 o C compared to 25 o C. 35 o C 40 o C 45 o C Upregulated Downregulated Upregulated Downregulated Upregulated Downregulated IR ES A5SS A3SS MXE Total AS: alternative splicing; IR: intron retention; ES: exon skipping; MXE: mutually exclusive exons; A5SS: alternative 5 splice sites; A3SS: alternative 3 splice sites
20 Supplemental Table S3. qrt-pcr primers used in this study. Gene ID Forward primer Reverse primer VIT_10s0003g TCACACAACCACAGCCTAC CACCCATCTTCTGCTTTGCT VIT_12s0035g AGCCAAGCATCATCCCAATC GGTTTCTGGTGTAGGGCAT VIT_13s0019g CGCATTGATTGGAAGGAGAC TCGGTGCCACTTGTCATTCT VIT_16s0050g GAAGAAAGGCGAATCAAAGACC GCAAGATAGTCCTCCCAGTCAT VIT_13s0019g CCAAACTTCTTAGGCGGTC TCCTCCCTTCCTCAACCTC VIT_13s0019g CCAAACTTCTTAGGCGGTC TCCTCCCTTCCTCAACCTC VIT_13s0019g CCAAACTTCTTAGGCGGTC TCCTCCCTTCCTCAACCTC VIT_13s0019g CCAAACTTCTTAGGCGGTC TCCTCCCTTCCTCAACCTC VIT_18s0041g ACAAGATGAAGGCTGCTCACT AGAACAAACCGCAAACCCTC VIT_19s0090g GCTTTCATTGCCCGTATTTCT GGCTCTTCTTTCCATTCCTCTG VIT_19s0015g TAACCCACCTCCCTTCTCAC GGCACGCAGGAAACAAGAT VIT_02s0154g TGCTTCTCGCTCCTTCAATACC CTGGCTCAAACTTCTCGTCCG VIT_06s0004g TCAAGGCAACAGGACTACGC CCTTCCAATCAAACGCTTCGC VIT_18s0089g CTCTCTTGTTTCTTCTTTGCTGC ACCTCCTCCTTCCTCAGACC VIT_09s0002g GCGTTTCTCATTTCTTCGTTGTC TCTTGGCAGGGTCGGTGAT VIT_00s1490g TTGGCTGTGACCTCCTCTTC TTGCTCATAGTCCTCCACCTC VIT_07s0005g ATCGGGTCTTCTCCTTGGC GGGTTTCACATCCTCTGTTCGT VIT_06s0004g GGTATTCTCGCTCACCTTCCc GATTCACGACTCCTTGACCTGC VIT_08s0007g CGCCGTCTTATGTTGCGTT GCTTCTCCTCGCCCTTGTAG VIT_08s0007g ATCCTGCTGACGGGCTTAG CGTTGTGAACCGAGTCTTTAGG VIT_01s0011g GCCTATTCAGTACTATCAGACCAG TCCTCCCTAGTGTAGATCTTACC VIT_04s0008g CTTCATCATCGACATGCCGG TTCCTCATAAACTTCCCCACC VIT_04s0008g CTTCATCATCGACATGCCGG TTCCTCATAAACTTCCCCACC VIT_04s0008g CTTCATCATCGACATGCCGG TTCCTCATAAACTTCCCCACC VIT_04s0008g CTTCATCATCGACATGCCGG TTCCTCATAAACTTCCCCACC VIT_04s0008g CTTCATCATCGACATGCCGG TTCCTCATAAACTTCCCCACC VIT_04s0008g CTTCATCATCGACATGCCGG TTCCTCATAAACTTCCCCACC VIT_16s0022g TTCAACACCAACGCCATCC GATCGAACACATCTGAGAAGGAG VIT_17s0000g CATTGAAGACTTATGGGCGTG TGATGACCCTCCGAATCTC VIT_11s0037g GATGTCACGCCTCTCAGTCTC AGTCTTCCCTTGTCGTTGGTG VIT_11s0016g GTTGATACAGAAAGCGAGGTTGG GAGCGACGGACAAGACACT VIT_00s0181g AGGGTTTGTTCCAGTCACGC CTGCTTTCTCCTCCACCATTTC VIT_08s0058g GTGACGGTTGAGGTTGAAGAG CCATCTTTGCATTTTCAGGAAGTC VIT_13s0019g GACCTCTGCCTTCACCAAC CAACCTCAACCTTCACCTCC VIT_19s0085g AGAATGAGGTGAAACTGGAGGT CTGAACTGCCTGGAGAAACTG
21 Supplemental Table S4. The primers of RT-PCR splicing analysis used in this study. Gene ID discription Forward primer Reverse primer VIT_16s0050g HSP90.1 GCCTTCCAGGCTGAGATCAATC TGGTCATTCCGATGCCACTG VIT_16s0098g Hsp25.3 CAGTTATCAGGTAGCTGCAG ACCAGTGTCTATGGCTTCTC VIT_17s0000g HSP101 CATGATGTTAACGGAGACTG TGGAGGAGGGTATTGAATAC VIT_08s0007g HSP70.4 TTGGCGTTTATTCTGACACC CAATTTCAATGGTGGTCTGG VIT_04s0008g HsfA2-I, III TCTCTGATTCAATACCCGAC TTCTTCCCAGGTACTTCAAG VIT_04s0008g HsfA2-I, III AGAACCCTTCTTTCGAGTCTGG GACTGGGTGATCATCATGAACC
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control
Proteogenomic analysis of alternative splicing: the search for novel biomarkers for colorectal cancer Gosia Komor
Proteogenomic analysis of alternative splicing: the search for novel biomarkers for colorectal cancer Gosia Komor Translational Gastrointestinal Oncology Collect clinical samples (Tumor) tissue Blood Stool
Multi-omics data integration colon cancer using proteogenomics approach
Dept. of Medical Oncology Multi-omics data integration colon cancer using proteogenomics approach DTL Focus meeting, 29 August 2016 Thang Pham OncoProteomics Laboratory, Dept. of Medical Oncology VU University
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Frequency of alternative-cassette-exon engagement with the ribosome is consistent across data from multiple human cell types and from mouse stem cells. Box plots showing AS frequency
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological
RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays
Supplementary Materials RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Junhee Seok 1*, Weihong Xu 2, Ronald W. Davis 2, Wenzhong Xiao 2,3* 1 School of Electrical Engineering,
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Effect of HSP90 inhibition on expression of endogenous retroviruses. (a) Inducible shrna-mediated Hsp90 silencing in mouse ESCs. Immunoblots of total cell extract expressing the
7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
Variant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
Analyse de données de séquençage haut débit
Analyse de données de séquençage haut débit Vincent Lacroix Laboratoire de Biométrie et Biologie Évolutive INRIA ERABLE 9ème journée ITS 21 & 22 novembre 2017 Lyon https://its.aviesan.fr Sequencing is
Package IMAS. March 10, 2019
Type Package Package IMAS March 10, 2019 Title Integrative analysis of Multi-omics data for Alternative Splicing Version 1.6.1 Author Seonggyun Han, Younghee Lee Maintainer Seonggyun Han
Ambient temperature regulated flowering time
Ambient temperature regulated flowering time Applications of RNAseq RNA- seq course: The power of RNA-seq June 7 th, 2013; Richard Immink Overview Introduction: Biological research question/hypothesis
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
Introduction. Introduction
Introduction We are leveraging genome sequencing data from The Cancer Genome Atlas (TCGA) to more accurately define mutated and stable genes and dysregulated metabolic pathways in solid tumors. These efforts
Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
Supplemental Information For: The genetics of splicing in neuroblastoma
Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,
Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.
Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data
Computational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project
Computational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project Introduction RNA splicing is a critical step in eukaryotic gene
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
Annotation of Chimp Chunk 2-10 Jerome M Molleston 5/4/2009
Annotation of Chimp Chunk 2-10 Jerome M Molleston 5/4/2009 1 Abstract A stretch of chimpanzee DNA was annotated using tools including BLAST, BLAT, and Genscan. Analysis of Genscan predicted genes revealed
MATS: a Bayesian framework for flexible detection of differential alternative splicing from RNA-Seq data
Nucleic Acids Research Advance Access published February 1, 2012 Nucleic Acids Research, 2012, 1 13 doi:10.1093/nar/gkr1291 MATS: a Bayesian framework for flexible detection of differential alternative
Metabolomic and Proteomics Solutions for Integrated Biology. Christine Miller Omics Market Manager ASMS 2015
Metabolomic and Proteomics Solutions for Integrated Biology Christine Miller Omics Market Manager ASMS 2015 Integrating Biological Analysis Using Pathways Protein A R HO R Protein B Protein X Identifies
SUPPLEMENTARY INFORMATION
doi: 1.138/nature8645 Physical coverage (x haploid genomes) 11 6.4 4.9 6.9 6.7 4.4 5.9 9.1 7.6 125 Neither end mapped One end mapped Chimaeras Correct Reads (million ns) 1 75 5 25 HCC1187 HCC1395 HCC1599
H3K4 demethylase KDM5B regulates global dynamics of transcription elongation and alternative splicing in embryonic stem cells
Nucleic Acids Research, 2017 1 doi: 10.1093/nar/gkx251 H3K4 demethylase KDM5B regulates global dynamics of transcription elongation and alternative splicing in embryonic stem cells Runsheng He 1,2 and
MODULE 3: TRANSCRIPTION PART II
MODULE 3: TRANSCRIPTION PART II Lesson Plan: Title S. CATHERINE SILVER KEY, CHIYEDZA SMALL Transcription Part II: What happens to the initial (premrna) transcript made by RNA pol II? Objectives Explain
Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
Protein SD Units (P-value) Cluster order
SUPPLEMENTAL TABLE AND FIGURES Table S1. Signature Phosphoproteome of CD22 E12 Transgenic Mouse BPL Cells. T-test vs. Other Protein SD Units (P-value) Cluster order ATPase (Ab-16) 1.41 0.000880 1 mtor
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis
A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis Jian Xu, Ph.D. Children s Research Institute, UTSW Introduction Outline Overview of genomic and next-gen sequencing technologies
Simple, rapid, and reliable RNA sequencing
Simple, rapid, and reliable RNA sequencing RNA sequencing applications RNA sequencing provides fundamental insights into how genomes are organized and regulated, giving us valuable information about the
Predominant contribution of cis-regulatory divergence in the evolution of mouse alternative splicing
Molecular Systems Biology Peer Review Process File Predominant contribution of cis-regulatory divergence in the evolution of mouse alternative splicing Mr. Qingsong Gao, Wei Sun, Marlies Ballegeer, Claude
Data mining with Ensembl Biomart. Stéphanie Le Gras
Data mining with Ensembl Biomart Stéphanie Le Gras (slegras@igbmc.fr) Guidelines Genome data Genome browsers Getting access to genomic data: Ensembl/BioMart 2 Genome Sequencing Example: Human genome 2000:
MODULE 4: SPLICING. Removal of introns from messenger RNA by splicing
Last update: 05/10/2017 MODULE 4: SPLICING Lesson Plan: Title MEG LAAKSO Removal of introns from messenger RNA by splicing Objectives Identify splice donor and acceptor sites that are best supported by
V23 Regular vs. alternative splicing
Regular splicing V23 Regular vs. alternative splicing mechanistic steps recognition of splice sites Alternative splicing different mechanisms how frequent is alternative splicing? Effect of alternative
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
Supplemental Material for:
Supplemental Material for: Transcriptional silencing of γ-globin by BCL11A involves long-range interactions and cooperation with SOX6 Jian Xu, Vijay G. Sankaran, Min Ni, Tobias F. Menne, Rishi V. Puram,
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
Nature Structural & Molecular Biology: doi: /nsmb.2419
Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb
RNA sequencing of cancer reveals novel splicing alterations
RNA sequencing of cancer reveals novel splicing alterations Jeyanthy Eswaran, Anelia Horvath, Sucheta Godbole, Sirigiri Divijendra Reddy, Prakriti Mudvari, Kazufumi Ohshiro, Dinesh Cyanam, Sujit Nair,
BIMM 143. RNA sequencing overview. Genome Informatics II. Barry Grant. Lecture In vivo. In vitro.
RNA sequencing overview BIMM 143 Genome Informatics II Lecture 14 Barry Grant http://thegrantlab.org/bimm143 In vivo In vitro In silico ( control) Goal: RNA quantification, transcript discovery, variant
iclip Predicts the Dual Splicing Effects of TIA-RNA Interactions
iclip Predicts the Dual Splicing Effects of TIA-RNA Interactions Zhen Wang 1., Melis Kayikci 1., Michael Briese 1, Kathi Zarnack 2, Nicholas M. Luscombe 2,3, Gregor Rot 4, Blaž Zupan 4, Tomaž Curk 4, Jernej
Studying Alternative Splicing
Studying Alternative Splicing Meelis Kull PhD student in the University of Tartu supervisor: Jaak Vilo CS Theory Days Rõuge 27 Overview Alternative splicing Its biological function Studying splicing Technology
Transcript reconstruction
Transcript reconstruction Summary I Data types, file formats and utilities Annotation: Genomic regions Genes Peaks bedtools Alignment: Map reads BAM/SAM Samtools Aggregation: Summary files Wig (UCSC) TDF
Computational Modeling and Inference of Alternative Splicing Regulation.
University of Miami Scholarly Repository Open Access Dissertations Electronic Theses and Dissertations 2013-04-17 Computational Modeling and Inference of Alternative Splicing Regulation. Ji Wen University
fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
Supplemental Information. Derivation of Human Trophoblast Stem Cells
Cell Stem Cell, Volume 22 Supplemental Information Derivation of Human Trophoblast Stem Cells Hiroaki Okae, Hidehiro Toh, Tetsuya Sato, Hitoshi Hiura, Sota Takahashi, Kenjiro Shirane, Yuka Kabayama, Mikita
Lecture 8 Understanding Transcription RNA-seq analysis. Foundations of Computational Systems Biology David K. Gifford
Lecture 8 Understanding Transcription RNA-seq analysis Foundations of Computational Systems Biology David K. Gifford 1 Lecture 8 RNA-seq Analysis RNA-seq principles How can we characterize mrna isoform
An Analysis of MDM4 Alternative Splicing and Effects Across Cancer Cell Lines
An Analysis of MDM4 Alternative Splicing and Effects Across Cancer Cell Lines Kevin Hu Mentor: Dr. Mahmoud Ghandi 7th Annual MIT PRIMES Conference May 2021, 2017 Outline Introduction MDM4 Isoforms Methodology
SUPPLEMENTARY INFORMATION. Intron retention is a widespread mechanism of tumor suppressor inactivation.
SUPPLEMENTARY INFORMATION Intron retention is a widespread mechanism of tumor suppressor inactivation. Hyunchul Jung 1,2,3, Donghoon Lee 1,4, Jongkeun Lee 1,5, Donghyun Park 2,6, Yeon Jeong Kim 2,6, Woong-Yang
Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR Fig. S2. Transactivation potential of PPAR
Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR ChIP-PCR was performed on PPARγ and RXR-enriched chromatin harvested during adipocyte differentiation at day and day 6 as described
The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
Supplementary Table S1. List of PTPRK-RSPO3 gene fusions in TCGA's colon cancer cohort. Chr. # of Gene 2. Chr. # of Gene 1
Supplementary Tale S1. List of PTPRK-RSPO3 gene fusions in TCGA's colon cancer cohort TCGA Case ID Gene-1 Gene-2 Chr. # of Gene 1 Chr. # of Gene 2 Genomic coordiante of Gene 1 at fusion junction Genomic
IPA Advanced Training Course
IPA Advanced Training Course October 2013 Academia sinica Gene (Kuan Wen Chen) IPA Certified Analyst Agenda I. Data Upload and How to Run a Core Analysis II. Functional Interpretation in IPA Hands-on Exercises
Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.
Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated
Inference of Isoforms from Short Sequence Reads
Inference of Isoforms from Short Sequence Reads Tao Jiang Department of Computer Science and Engineering University of California, Riverside Tsinghua University Joint work with Jianxing Feng and Wei Li
Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.
Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,
In search for hypoallergenic trees: Screening for genetic diversity in birch pollen allergens, a multigene family of Bet v 1 (PR 10) proteins MJM
In search for hypoallergenic trees: Screening for genetic diversity in birch pollen allergens, a multigene family of Bet v 1 (PR 10) proteins MJM Smulders, MF Schenk, LJWJ Gilissen Hay fever Hay fever
Accessing and Using ENCODE Data Dr. Peggy J. Farnham
1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000
ddm1a (PFG_3A-51065) ATG ddm1b (PFG_2B-60109) ATG osdrm2 (PFG_3A-04110) osdrm2 osdrm2 osdrm2
Relative expression.6.5.4.3.2.1 OsDDM1a OsDDM1b OsDRM2 TG TG TG ddm1a (PFG_3-5165) P1 P3 ddm1b (PFG_2-619) P2 531bp 5233bp P1 P4 P3 P2 F1 R1 F1 TG TG TG F1 R1 C ddm1a -/- -/- ddm1b -/- +/- +/- -/- D (PFG_3-411)
REGULATED SPLICING AND THE UNSOLVED MYSTERY OF SPLICEOSOME MUTATIONS IN CANCER
REGULATED SPLICING AND THE UNSOLVED MYSTERY OF SPLICEOSOME MUTATIONS IN CANCER RNA Splicing Lecture 3, Biological Regulatory Mechanisms, H. Madhani Dept. of Biochemistry and Biophysics MAJOR MESSAGES Splice
V24 Regular vs. alternative splicing
Regular splicing V24 Regular vs. alternative splicing mechanistic steps recognition of splice sites Alternative splicing different mechanisms how frequent is alternative splicing? Effect of alternative
RNA-Seq guided gene therapy for vision loss. Michael H. Farkas
RNA-Seq guided gene therapy for vision loss Michael H. Farkas The retina is a complex tissue Many cell types Neural retina vs. RPE Each highly dependent on the other Graw, Nature Reviews Genetics, 2003
The Emergence of Alternative 39 and 59 Splice Site Exons from Constitutive Exons
The Emergence of Alternative 39 and 59 Splice Site Exons from Constitutive Exons Eli Koren, Galit Lev-Maor, Gil Ast * Department of Human Molecular Genetics, Sackler Faculty of Medicine, Tel Aviv University,
Unsupervised Identification of Isotope-Labeled Peptides
Unsupervised Identification of Isotope-Labeled Peptides Joshua E Goldford 13 and Igor GL Libourel 124 1 Biotechnology institute, University of Minnesota, Saint Paul, MN 55108 2 Department of Plant Biology,
Nature Genetics: doi: /ng.3731
Supplementary Figure 1 Circadian profiles of Adarb1 transcript and ADARB1 protein in mouse tissues. (a) Overlap of rhythmic transcripts identified in the previous transcriptome analyses. The mouse liver
Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the
Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the deep dermis. (b) The melanocytes demonstrate abundant
GENOME-WIDE DETECTION OF ALTERNATIVE SPLICING IN EXPRESSED SEQUENCES USING PARTIAL ORDER MULTIPLE SEQUENCE ALIGNMENT GRAPHS
GENOME-WIDE DETECTION OF ALTERNATIVE SPLICING IN EXPRESSED SEQUENCES USING PARTIAL ORDER MULTIPLE SEQUENCE ALIGNMENT GRAPHS C. GRASSO, B. MODREK, Y. XING, C. LEE Department of Chemistry and Biochemistry,
Mechanisms of alternative splicing regulation
Mechanisms of alternative splicing regulation The number of mechanisms that are known to be involved in splicing regulation approximates the number of splicing decisions that have been analyzed in detail.
MapSplice: Accurate Mapping of RNA-Seq Reads for Splice Junction Discovery
University of Kentucky UKnowledge Computer Science Faculty Publications Computer Science 0-200 MapSplice: Accurate Mapping of RNA-Seq Reads for Splice Junction Discovery Kai Wang University of Kentucky
Digitizing the Proteomes From Big Tissue Biobanks
Digitizing the Proteomes From Big Tissue Biobanks Analyzing 24 Proteomes Per Day by Microflow SWATH Acquisition and Spectronaut Pulsar Analysis Jan Muntel 1, Nick Morrice 2, Roland M. Bruderer 1, Lukas
Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes
Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes Kaifu Chen 1,2,3,4,5,10, Zhong Chen 6,10, Dayong Wu 6, Lili Zhang 7, Xueqiu Lin 1,2,8,
Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
Hao D. H., Ma W. G., Sheng Y. L., Zhang J. B., Jin Y. F., Yang H. Q., Li Z. G., Wang S. S., GONG Ming*
Comparison of transcriptomes and gene expression profiles of two chilling- and drought-tolerant and intolerant Nicotiana tabacum varieties under low temperature and drought stress Hao D. H., Ma W. G.,
Bio 111 Study Guide Chapter 17 From Gene to Protein
Bio 111 Study Guide Chapter 17 From Gene to Protein BEFORE CLASS: Reading: Read the introduction on p. 333, skip the beginning of Concept 17.1 from p. 334 to the bottom of the first column on p. 336, and
Identification and characterization of multiple splice variants of Cdc2-like kinase 4 (Clk4)
Identification and characterization of multiple splice variants of Cdc2-like kinase 4 (Clk4) Vahagn Stepanyan Department of Biological Sciences, Fordham University Abstract: Alternative splicing is an
EXPression ANalyzer and DisplayER
EXPression ANalyzer and DisplayER Tom Hait Aviv Steiner Igor Ulitsky Chaim Linhart Amos Tanay Seagull Shavit Rani Elkon Adi Maron-Katz Dorit Sagir Eyal David Roded Sharan Israel Steinfeld Yossi Shiloh
Supplementary Figure 1. Linkage analysis of Family 7. Red arrow, position of SRRM2 gene in chromosome16.
A germline mutation in SRRM2, a splicing factor gene, is implicated in papillary thyroid carcinoma predisposition Jerneja Tomsic 1, Huiling He 1, Keiko Akagi 1, Sandya Liyanarachchi 1, Qun Pan 2, Blake
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,
An EMT Driven Alternative Splicing Program Occurs in Human Breast Cancer and Modulates Cellular Phenotype
An EMT Driven Alternative Splicing Program Occurs in Human Breast Cancer and Modulates Cellular Phenotype Irina M. Shapiro 1., Albert W. Cheng 2., Nicholas C. Flytzanis 1, Michele Balsamo 1, John S. Condeelis
Proteomics of body liquids as a source for potential methods for medical diagnostics Prof. Dr. Evgeny Nikolaev
Proteomics of body liquids as a source for potential methods for medical diagnostics Prof. Dr. Evgeny Nikolaev Institute for Biochemical Physics, Rus. Acad. Sci., Moscow, Russia. Institute for Energy Problems
Table S1. Total and mapped reads produced for each ChIP-seq sample
Tale S1. Total and mapped reads produced for each ChIP-seq sample Sample Total Reads Mapped Reads Col- H3K27me3 rep1 125662 1334323 (85.76%) Col- H3K27me3 rep2 9176437 7986731 (87.4%) atmi1a//c H3K27m3
Expanded View Figures
Solip Park & Ben Lehner Epistasis is cancer type specific Molecular Systems Biology Expanded View Figures A B G C D E F H Figure EV1. Epistatic interactions detected in a pan-cancer analysis and saturation
Mouse Clec9a ORF sequence
Mouse Clec9a gene LOCUS NC_72 13843 bp DNA linear CON 1-JUL-27 DEFINITION Mus musculus chromosome 6, reference assembly (C57BL/6J). ACCESSION NC_72 REGION: 129358881-129372723 Mouse Clec9a ORF sequence
Hands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
starbase Pan-Cancer Tutorial
starbase Pan-Cancer Tutorial 2010-2013, Jianhua Yang at Sun Yat-sen University For comments, suggestions on the starbase platform, please contact us: lsp03yjh@gmail.com On commercial use, contact: yangjh7@mail.sysu.edu.cn
SUPPLEMENTARY FIGURES: Supplementary Figure 1
SUPPLEMENTARY FIGURES: Supplementary Figure 1 Supplementary Figure 1. Glioblastoma 5hmC quantified by paired BS and oxbs treated DNA hybridized to Infinium DNA methylation arrays. Workflow depicts analytic
Pre-mRNA has introns The splicing complex recognizes semiconserved sequences
Adding a 5 cap Lecture 4 mrna splicing and protein synthesis Another day in the life of a gene. Pre-mRNA has introns The splicing complex recognizes semiconserved sequences Introns are removed by a process
Transcriptome Analysis
Transcriptome Analysis Data Preprocessing Sample Preparation Illumina Sequencing Demultiplexing Raw FastQ Reference Genome (fasta) Reference Annotation (GTF) Reference Genome Analysis Tophat Accepted hits
Protein Reports CPTAC Common Data Analysis Pipeline (CDAP)
Protein Reports CPTAC Common Data Analysis Pipeline (CDAP) v. 05/03/2016 Summary The purpose of this document is to describe the protein reports generated as part of the CPTAC Common Data Analysis Pipeline
Targeting Kinases Critical for TMPRSS2-ERG Function in Prostate Cancer
Targeting Kinases Critical for TMPRSS2-ERG Function in Prostate Cancer Kyle Nakatsuka David Takeda, MD, PhD Lab of William Hahn, M.D., Ph.D. Broad Institute Summer Research Program in Genomics TMPRSS2-ERG
Aliccia Bollig-Fischer, PhD Department of Oncology, Wayne State University Associate Director Genomics Core Molecular Therapeutics Program Karmanos
Aliccia Bollig-Fischer, PhD Department of Oncology, Wayne State University Associate Director Genomics Core Molecular Therapeutics Program Karmanos Cancer Institute Development of a multiplexed assay to
Received 26 January 1996/Returned for modification 28 February 1996/Accepted 15 March 1996
MOLECULAR AND CELLULAR BIOLOGY, June 1996, p. 3012 3022 Vol. 16, No. 6 0270-7306/96/$04.00 0 Copyright 1996, American Society for Microbiology Base Pairing at the 5 Splice Site with U1 Small Nuclear RNA
STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells
CAMDA 2009 October 5, 2009 STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells Guohua Wang 1, Yadong Wang 1, Denan Zhang 1, Mingxiang Teng 1,2, Lang Li 2, and Yunlong Liu 2 Harbin
ESCs were lysed with Trizol reagent (Life technologies) and RNA was extracted according to
Supplemental Methods RNA-seq ESCs were lysed with Trizol reagent (Life technologies) and RNA was extracted according to the manufacturer's instructions. RNAse free DNaseI (Sigma) was used to eliminate
Supplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
Supplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded
Supplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded from TCGA and differentially expressed metabolic genes
Supplementary Figure 1: Features of IGLL5 Mutations in CLL: a) Representative IGV screenshot of first
Supplementary Figure 1: Features of IGLL5 Mutations in CLL: a) Representative IGV screenshot of first intron IGLL5 mutation depicting biallelic mutations. Red arrows highlight the presence of out of phase
RNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB
RNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB CSF-NGS January 22, 214 Contents 1 Introduction 1 2 Experimental Details 1 3 Results And Discussion 1 3.1 ERCC spike ins............................................