Figure S1. B % of Phosphorylation 32H. 32ss

Transcription

1 Figure S1 8H 32ss 32H 32Hc % of Phosphorylation 3 32H ss Extract (μg) C % of Phosphorylation H 32Hc 8H 32ss Dbait Figure S1. List of the Dbait molecules and activation of DN-PK kinase activity. () Dbait molecules contain a hairpin loop formed by a hexaethyleneglycol linker [(CH 2 -CH 2 - O) 6 ] tethering two complementary DN strands. In addition, three phosphorothioate nucleotide residues were incorporated at both 5 and 3 ends (in bold) to protect molecules from nucleases. ll Dbait molecules were made by automated solid-phase oligonucleotide synthesis (Eurogentec, elgium). They were purified by denaturing reverse-phase HPLC. Denaturing capillary gel electrophoresis and MLDI-TOF/LC-MS were used for quality control. More than 95% of the molecules are double-strand DN at room temperature in water. The concentrations of Dbait molecules were determined from the absorbance at 26 nm according to the nearest-neighbor model under denaturing conditions (8 C). One nmol of Dbait32H (molecular mass 2,153 g/mol) is about 2 μg. () DN-PK activity was monitored using the kit SignaTECT DN-dependent Protein Kinase ssay System (Promega, Madison, US). The biotinylated peptide substrate, various amounts of nuclear extract (cleaned of endogenous DN by DEE-Sepharose filtration) and 2 nm Dbait molecules were incubated for 5 min at 3 C with (γ- 32 P)TP according to the manufacturer s instructions. The biotinylated substrate was captured on a streptavidin membrane, washed and counted in a scintillation counter. Percentage of phosphorylation is calculated by dividing the bound radioactivity by the total count of (γ - 32 P)TP per sample. (a) DN-PK s kinase activity was monitored in increasing amounts of Hep2 nuclear extract in the presence of Dbait32H (black diamonds) or Dbait32ss molecules (white squares). (C) Stimulation of DN-PK s kinase activity by 2 nm of various Dbait molecules was measured in 1.5 g Hep2 nuclear extract. Data represent the mean value and standard deviation of at least three independent experiments.

2 Figure S2 Non fragmented DN poptotic comets 8 poptotic comet (%) 4 2 SF 8H 32ss 32Hc Figure S2. Dbait molecules do not induce nuclear DN strand breaks in MRC5 cells. Cells were cultured to semiconfluence in 6mm diameter plates. The Dbait molecules (2 μg) were complexed with 2 l Superfect and for transfection diluted in 1.2 ml DMEM containing 1% fetal calf serum. Nuclear DN strand breaks were monitored by comet assay after 3 h (grey), 5 h (white) and 24 h (black) transfection as described in Material and Methods and apoptotic comets were determined as described by Nur-E-Kamal (J. iol. Chem, 23, 278:12475). No significant induction of apoptotic comets was observed in Dbait32Hc transfected cells. SF: treatment with only superfect; 8H: Dbait 8bp long; 32ss: oligonucleotide 32b long; 32Hc: Dbait 32bp long.

3 Figure S3 NT 32Hc Non Irradiated Irradiated min 3 min 6 min Figure S3. Dbait32Hc molecules inhibits repair of DN strand breaks in MRC5 cells. Cells were not transfected (NT) or transfected with 2 g Dbait8H (8H) or with Dbait32Hc (32Hc) for 5 h before 1 Gy irradiation. Nuclear DN strand breaks were monitored by comet assay immediately after irradiation ( min) or let to repair for 3 min and 6 min. () pictures of comets: arrows indicate unrepaired nuclei in the Dbait32Hc transfected population, () tail moment distribution: comet tail moment were measured using the software Comet ssay 2 (Perceptive Instrument, UK) for each condition.

4 Figure S4 Relative Survival (%) NT 32H 32Hc 8H 32ss Dbait (2 μg) Figure S4. Radiosensitivity after transfection with 2 μg of various Dbait. The relative survival after 2 Gy irradiation was calculated by dividing the number of colonyforming units after irradiation by the number of colony-forming units before irradiation for each condition. NT: non transfected.

5 Figure S to 3 min 6 min 3 h 5 h 24 h 12 h C 894 T H L Li H L Li T M P S G K SG St P S K SG St M G 1 h h 12 h Figure S5. Fluorescent imaging of kinetics of Dbait32Hc(cy5)-PEI distribution. ()The mice autofluorescence was imaged before they were injected intratumoraly with Dbait32Hc(cy5)-PEI (to). t various time points after injection, mice were anesthetized and were placed in the imaging setup. Three mice were imaged together lying on three different positions (tumor side up, belly up and back up). The exposure time was 2 ms and grey scale levels before pseudocoloring was adjusted to () t time points 1 h (image belly up), 24 h and 12 h images (three different positions) were also acquired with 75 ms exposure time and grey scale levels before pseudocoloring were adjusted to and , equivalent to 5.4 and 9 increases of the previous contrast setting.(c) Dbait32Hc(Cy5)-PEI injected mouse was sacrificed 48 h after injection (left panel) as well as a non injected mouse (right panel). Organs were removed and imaged by fluorescence: tumor (T), heart (H), lungs (L), liver (Li), muscle (M), brain (), kidney (K), Suprarenal gland (SG), pancreas (P), spleen (S), guts (G), stomach (St). The exposure time was 1 s and grey scale levels before pseudocoloring was adjusted to :

6 Figure S PEI - PEI Hours % of Dbait in Tumor 1 1 Survival % PEI - PEI Days Figure S6. Requirement for PEI excipient () The retention of fluorescent Dbait32Hc(cy5) naked (dotted line) or complexed with PEI (black line) was calculated from fluorescent imaging at various times after intratumoral injection (time zero). The percentage of Dbait retained in tumor (3 tumors per condition) was calculated as the mean intensity at time indicated in abcissa divided by the mean intensity measured immediately after injection. The retention of a mixture of dntps with fluorescent dutp(cy5) complexed with PEI is indicated (grey line). () Kaplan-Meier representation of survival of animal with SK28 tumours treated with radiotherapy alone (grey line) or in association with 6 µg per session of naked Dbait32Hc (dotted line) or complexed with PEI (Dbait32Hc-PEI) (black line).

7 Figure S7 Day Day 17 Day 32 Day 46 Day 6 C Figure S7. Typical tumor growth with different treatments. Pictures of mice with Hep2 xenografted tumors were taken the various time after beginning of treatment (Day ). nimals were mock treated (), Irradiated () or treated with Dbait32Hc-PEI 3 nmol intratumoral injections and Irradiation (C). The schedule of the treatments is indicated above: black arrows (treatment sessions); blue arrows (picture time).

8 Figure S8 Untreated Radiotherapy alone Radiotherapy + Dbait32Hc No Treatment Dbait32Hc Radiotherapy Radiotherapy + Dbait32Hc P MC Figure S8. Imaging of tumors treated with different treatments. () IRM imaging: nimals with large Hep2 xenografted tumors were untreated, treated with 7 sessions of 2 Gy irradiation or with 7 sessions of 2 Gy irradiation combined with Dbait32Hc injections (half treatments) and imaged on a MRI system. White arrows indicate necrosis area within the tumors. () Histological analysis of Hep2 tumors having the various treatments. Two tumors for each treatment protocol were analyzed by microscopy and counted for apoptotic cells (P) and mitotic cells (MC) as described in Material and Methods. Scale bar:1 µm.

9 Figure S9 Survival (%) C NT 32Hc+IR IR Time (Days) Survival (%) NT 32Hc+IR IR Time (Days) Survival (%) NT 32Hc+IR IR Time (Days) week1 week2 week1 week2 week1 week2 Figure S9. Dbait effect in association with various irradiation protocols. SK28 tumours (n>9 for each group) were treated during two weeks with 6 sessions of 6 µg Dbait32Hc associated with various protocols of radiotherapy: () 1 sessions of 3 Gy; () 6 sessions of 5 Gy; (C) 2 sessions of 15 Gy. NT, no treatment (dotted grey line); IR, radiotherapy alone (grey line); 32Hc+IR, Dbait with radiotherapy. The treatment schedule are indicated: irradiation sessions (black arrows), Dbait injections (triangles).

10 Figure S1 Dbait32H Dbait32Hc 5 CGCCGGGTGTTGGGTCGTTTGTTCGGTCT3 3 TGCGTGCCCCCCCGCCGCCTG5 5 GCTGTGCCCCCCCGCCGCCTG3 3 CGCCGGGTGTTGGGTCGTTTGTTCGGTCT5 Cytokines Concentration (pg/ml) IL6 - H Hc H Hc SC IV IL12P7 - H Hc H Hc SC IV Figure S1. Immune response to Dbait molecules. () Sequences of Dbait32Hc and Dbait32H (red circles indicate CpG sequences, grey loop is for the hexaethylenglycol). () IL6 and IL12P7 measured using the multiplex kit Luminex (LinCo, ustin, TX,US ) were in blood samples at various times after repeated injections intravenous (IV) or subcutaneous (SC) of Dbait32Hc-PEI and Dbait32H-PEI in alb/c mice. nimals received seven injections of 12 μg (6 nmol) of Dbait-PEI within 24 days and blood samples were taken the day after each injection. The mean value of maximal concentration of measured cytokines (three animals per treatment) are indicated.