Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the

Size: px
Start display at page:

Download "Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the"

Transcription

1 Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the deep dermis. (b) The melanocytes demonstrate abundant cytoplasm and clefting around nests of melanocytes and between melanocytes (20x). (c) Towards the base of the melanoma, individual melanocytes are interspersed between collagen bundles and around small nerves (20x, arrow). (d) Whole genome copy number profile demonstrates losses on 6q and 22q, and gains on 7q, 12p and 18. (e) Copy number transitions are present within both fusion partners, with loss of the portion of the genes not participating in the fusions. (f) Integrative genomics viewer demonstrates fusion reads that map to the breakpoints on both genes. Unaligned bases (rainbow-colored) flank the breakpoints. (g) The exon structure of the predicted fusion transcript (top). RT-PCR and sequencing confirmed the sequence and expression of the fusion transcript (bottom).

2 Supplementary Figure 2. Atypical Spitz tumor with complex rearrangement resulting in TRIM4-MET fusion kinase. (a) Histopathology shows a broad compound melanocytic neoplasm (4x, top). Large nests of melanocytes are present within a fibrotic superficial dermis (4x, lower left). Some of the nests of melanocytes appear to contain myxoid stroma (20x, lower right). (b) Stacks of DNA sequencing reads viewed in Integrative Genomics Viewer with unaligned portions (rainbow colored) flanking one side of the fusion junctions on 7q22 (left panel) and MET intron 14 (right panel). Reads whose mate pair maps to the opposite side of the fusion junction are maroon. (c) Kinome RNASeq statistics (top). Expression of the TRIM4-MET transcript was confirmed by RT-PCR (bottom). (d) Copy number profile of the region of 7q that contains TRIM4 and MET. Gains of the 5 portion of TRIM4, the intergenic region on 7q22 and the 3 portion of MET are present with similar amplitudes.

3 Supplementary Figure 3. Aggregate array comparative genomic hybridization profiles of tumors. The top panel shows the aggregate copy number profile of tumors with gain of a distal portion of the long arm of chromosome 7 (n=74). The bottom panel shows the aggregate copy number profile of the remaining tumors in the cohort (n=1128).

4 Supplementary Figure 4. Atypical Spitz Tumor with DCTN1-MET fusion arising from reciprocal translocation. (a) Histopathology demonstrates large nests of spitzoid melanocytes within the epidermis and superficial dermis (left 4x, right 20x). (b) Whole genome acgh profile (top panel) demonstrates gains on chromosomes 2 and 7. Copy number aberrations are present near DCTN1 and MET, but no copy number transitions occur within either gene (bottom panel). (c) Reads spanning both reciprocal fusion junctions map to DCTN1. The unaligned portions (representing sequence from MET, rainbow-colored) flank the breakpoints. Blue reads have mate-pairs that map to MET on chromosome 7.

5 Supplementary Figure 5. Atypical Spitz tumor with EPS15-MET fusion and signs of chromothripsis. (a) Histopathology demonstrates a dome-shaped exophytic papule with a thinned epidermis (4x). The neoplastic melanocytes are arrayed in large nests and sheets with focal dense inflammation (left). The melanocytes are epithelioid with abundant eosinophilic cytoplasm (right). (b) Copy number profile demonstrates regions of gain on the short arm of chromosome 1 and the long arm of chromosome 7 (top). Copy number oscillation between two copy number states is present in these areas (bottom). (c) Four distinct fusion junctions are identified by DNA sequencing within MET. These fusion junctions are arranged in pairs that appear to arise from the same breakpoint (separated by less than 10 bp, involving opposite sides of the inferred breakpoint). The two breakpoints within MET are separated by 1240 bp. The four fusions within MET occur with 3 distinct regions on the short arm of chromosome

6 1. (d) The exon structure of the predicted fusion transcript (top). RT-PCR and sequencing confirmed the sequence and expression of the fusion transcript (bottom).

7 Supplementary Figure 6. Common Nevi have low levels of MET expression and undetectable p-met levels. The MET and p-met immunohistochemistry for 2 common nevi are presented.

8 Supplementary Figure 7. Expression of TRIM4-MET and ZKSCAN1-MET in 293FT cells activates MAP kinase pathway signaling in contrast to overexpression of wild-type MET. Expression of wild-type MET, TRIM4-MET and ZKSCAN1-MET results in bands at expected molecular weights in the MET blot. All three MET constructs lead to increased levels of p-met, but only the MET fusions result in a detectable increase of p-erk.

9 Supplementary Figure 8. Full Western blots from Figure 4a.

10 Supplementary Figure 9. Full Western blots from Figure 4b.

11 Supplementary Table 1. Clinical characteristics of the cohort. Average Age Median Age male female spitzoid Malignant Ambiguous Benign UCSF Array CGH Database (n=1202) TCGA Melanoma Cases Analyzed by Stransky et al. (n=374) NA Supplementary Table 2. RT-PCR primers. Forward Primer Reverse Primer TRIM4-MET GCCAGATACCATTGATGAAGG CTCCATGTTTCATGTATGGTAGG ZKSCAN1-MET CTTCAAACATTCGTCTCGG CTCCATGTTTCATGTATGGTAGG DCTN1-MET CTTCAGGCATTGCTACTCTGG CTCCATGTTTCATGTATGGTAGG PPFIBP1-MET GTTTGCAAGATGAAAGGAGAAGG CTCCATGTTTCATGTATGGTAGG EPS15-MET TGGTGGAACAGTTGTTGC CTCCATGTTTCATGTATGGTAGG

Update on Spitzoid and Blue nevus-like melanocytic lesions Emphasis on molecular studies informing diagnosis, prognosis and therapy

Update on Spitzoid and Blue nevus-like melanocytic lesions Emphasis on molecular studies informing diagnosis, prognosis and therapy Update on Spitzoid and Blue nevus-like melanocytic lesions Emphasis on molecular studies informing diagnosis, prognosis and therapy Michael T. Tetzlaff MD, PhD Associate Professor Department of Pathology,

More information

Dermatopathology. Dr. Rafael Botella Estrada. Hospital La Fe de Valencia

Dermatopathology. Dr. Rafael Botella Estrada. Hospital La Fe de Valencia Dermatopathology Dr. Rafael Botella Estrada. Hospital La Fe de Valencia Melanoma and mimics Dr. Martin Mihm Malignant lesions result from the accumulation of mutations Class I lesions (benign) Class II

More information

Molecular Aspects of Melanocytic Neoplasia. Iwei Yeh MD, PhD University of California, San Francisco

Molecular Aspects of Melanocytic Neoplasia. Iwei Yeh MD, PhD University of California, San Francisco Molecular Aspects of Melanocytic Neoplasia Iwei Yeh MD, PhD University of California, San Francisco Thanks to: Boris Bastian Timothy McCalmont Philip LeBoit Beth Ruben Jeff North Laura Pincus Thaddeus

More information

The Enigmatic Spitz Lesion

The Enigmatic Spitz Lesion The Enigmatic Spitz Lesion The Dawn of Spitz S Spitz Sophie Spitz Melanomas of Childhood ; Am J Pathol 1948 1910-1956 13 children (18 mo - 12 yrs) 12/13 had a benign clinical course Sophie Spitz Born 1910

More information

Reviewers' comments: Reviewer #1 (Remarks to the Author):

Reviewers' comments: Reviewer #1 (Remarks to the Author): Reviewers' comments: Reviewer #1 (Remarks to the Author): In this study the authors analysed 18 deep penetrating nevi for oncogenic genomic changes (single nucleotide variations, insertions/deletions,

More information

Malignant Peripheral Nerve Sheath Tumor

Malignant Peripheral Nerve Sheath Tumor C H A P T E R 120 Malignant Peripheral Nerve Sheath Tumor Currently, malignant peripheral nerve sheath tumor (MPNST) is the most commonly used generic name for the neoplasms known in the past as neurosarcoma,

More information

Nature Biotechnology: doi: /nbt.1904

Nature Biotechnology: doi: /nbt.1904 Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is

More information

Melanoma and the genes: Molecular alterations informing the diagnosis of melanocytic tumors

Melanoma and the genes: Molecular alterations informing the diagnosis of melanocytic tumors Melanoma and the genes: Molecular alterations informing the diagnosis of melanocytic tumors Michael T. Tetzlaff MD, PhD Associate Professor Department of Pathology, Section of Dermatopathology Department

More information

21/07/2017. The «gray zone» of diagnosis is visible. Nevus Atypical nevus Melanoma. Melanoma ex-blue nevus

21/07/2017. The «gray zone» of diagnosis is visible. Nevus Atypical nevus Melanoma. Melanoma ex-blue nevus Update on the Clinico- Pathological and Molecular Diagnosis of Melanocytic Lesions None to declare Conflicts of interest Belfast pathology Arnaud de la Fouchardière MD, PhD Lyon, France What is new? Today

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature8645 Physical coverage (x haploid genomes) 11 6.4 4.9 6.9 6.7 4.4 5.9 9.1 7.6 125 Neither end mapped One end mapped Chimaeras Correct Reads (million ns) 1 75 5 25 HCC1187 HCC1395 HCC1599

More information

Michael T. Tetzlaff MD, PhD

Michael T. Tetzlaff MD, PhD Molecular alterations informing the diagnosis of melanocytic tumors Michael T. Tetzlaff MD, PhD Associate Professor Department of Pathology, Section of Dermatopathology Department of Translational and

More information

Benign and malignant epithelial lesions: Seborrheic keratosis: A common benign pigmented epidermal tumor occur in middle-aged or older persons more

Benign and malignant epithelial lesions: Seborrheic keratosis: A common benign pigmented epidermal tumor occur in middle-aged or older persons more Benign and malignant epithelial lesions: Seborrheic keratosis: A common benign pigmented epidermal tumor occur in middle-aged or older persons more common on the trunk; but extremities, head and neck are

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11 ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N

More information

المركب النموذج--- سبيتز وحمة = Type Spitz's Nevus, Compound SPITZ NEVUS 1 / 7

المركب النموذج--- سبيتز وحمة = Type Spitz's Nevus, Compound SPITZ NEVUS 1 / 7 SPITZ NEVUS 1 / 7 Epidemiology An annual incidence rate of 1.4 cases of Spitz nevus per 100,000 individuals has been estimated in Australia, compared with 25.4 per 100,000 individuals for cutaneous melanoma

More information

10/2/17. MELTUMP, SAMPUS, AST.An Algorithmic Approach to Challenging (Often Borderline) Melanocytic Tumors. An Introduction to SNP Arrays

10/2/17. MELTUMP, SAMPUS, AST.An Algorithmic Approach to Challenging (Often Borderline) Melanocytic Tumors. An Introduction to SNP Arrays MELTUMP, SAMPUS, AST.An Algorithmic Approach to Challenging (Often ) Melanocytic Tumors An Introduction to SNP Arrays Rajiv M. Patel, M.D. RCPA NZ ASM 2017 (11:45-12:30pm, Saturday, 23-09-17) Why do we

More information

MODULE 4: SPLICING. Removal of introns from messenger RNA by splicing

MODULE 4: SPLICING. Removal of introns from messenger RNA by splicing Last update: 05/10/2017 MODULE 4: SPLICING Lesson Plan: Title MEG LAAKSO Removal of introns from messenger RNA by splicing Objectives Identify splice donor and acceptor sites that are best supported by

More information

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes

More information

6/22/2015. Original Paradigm. Correlating Histology and Molecular Findings in Melanocytic Neoplasms

6/22/2015. Original Paradigm. Correlating Histology and Molecular Findings in Melanocytic Neoplasms 6 Correlating Histology and Molecular Findings in Melanocytic Neoplasms Pedram Gerami MD, Associate Professor of Dermatology and Pediatrics at Northwestern University Disclosures: I have been a consultant

More information

Malignant tumors of melanocytes: Part 1. Deba P Sarma, MD., Omaha

Malignant tumors of melanocytes: Part 1. Deba P Sarma, MD., Omaha Malignant tumors of melanocytes: Part 1 Deba P Sarma, MD., Omaha The melanocytic tumor is one of the most difficult and confusing areas in Dematopathology. It is true that most (95%) of such lesions are

More information

Histopathology of Melanoma

Histopathology of Melanoma THE YALE JOURNAL OF BIOLOGY AND MEDICINE 48, 409-416 (1975) Histopathology of Melanoma G. J. WALKER SMITH Department ofpathology, Yale University School ofmedicine, 333 Cedar Street, New Haven, Connecticut

More information

Self assessment case. Dr Saleem Taibjee Dorset County Hospital, Dorchester

Self assessment case. Dr Saleem Taibjee Dorset County Hospital, Dorchester Self assessment case Dr Saleem Taibjee saleemtaibjee@gmail.com Dorset County Hospital, Dorchester Clinical details 34-year-old man: Shave excision Skin tag / papilloma left thigh The best diagnosis is:

More information

Page 1 of 3. We suggest the following changes:

Page 1 of 3. We suggest the following changes: Page 1 of 3 Loren E. Clarke, M.D. Myriad Genetic Laboratories, Inc. 320 Wakara Way, Salt Lake City, UT 84108 Phone: 801.883.3470 Email: lclarke@myriad.com Date of Request: June 2017 NCCN Guidelines Panel:

More information

Role of FISH in Hematological Cancers

Role of FISH in Hematological Cancers Role of FISH in Hematological Cancers Thomas S.K. Wan PhD,FRCPath,FFSc(RCPA) Honorary Professor, Department of Pathology & Clinical Biochemistry, Queen Mary Hospital, University of Hong Kong. e-mail: wantsk@hku.hk

More information

Case 26 Male 37. Right jawline 5mm nodule?keloid. The best diagnosis is:

Case 26 Male 37. Right jawline 5mm nodule?keloid. The best diagnosis is: Case 26 Male 37. Right jawline 5mm nodule?keloid. The best diagnosis is: A. Desmoplastic Spitz naevus B. Atypical Spitz Tumour C. Spitzoid melanoma D. Deep penetrating naevus E. Spitz naevus Case 26: M

More information

Financial disclosures

Financial disclosures Mesenchymal Neoplasms with Melanocytic Differentiation By Konstantinos Linos MD, FCAP, FASDP Bone, Soft Tissue and Dermatopathology Assistant Professor of Pathology Dartmouth-Hitchcock Medical Center Geisel

More information

Molecular Methods in the Diagnosis and Prognostication of Melanoma: Pros & Cons

Molecular Methods in the Diagnosis and Prognostication of Melanoma: Pros & Cons Molecular Methods in the Diagnosis and Prognostication of Melanoma: Pros & Cons Ben J. Friedman, MD Senior Staff Physician Department of Dermatology Department of Pathology and Laboratory Medicine Henry

More information

Histopathology: skin pathology

Histopathology: skin pathology Histopathology: skin pathology These presentations are to help you identify, and to test yourself on identifying, basic histopathological features. They do not contain the additional factual information

More information

21/07/2017. Hobnail endothelial cells are not the same as epithelioid endothelial cells

21/07/2017. Hobnail endothelial cells are not the same as epithelioid endothelial cells UPDATE IN CUTANEOUS VASCULAR S DERMATOPATHOLOGY SESSION BELFAST PATHOLOGY JUNE 21/2017 Dr E Calonje St John s Institute of Dermatology, London, United Kingdom THE FAMILY OF VASCULAR S WITH EPITHELIOID

More information

Vernon K. Sondak. Department of Cutaneous Oncology Moffitt Cancer Center Tampa, Florida

Vernon K. Sondak. Department of Cutaneous Oncology Moffitt Cancer Center Tampa, Florida Vernon K. Sondak Department of Cutaneous Oncology Moffitt Cancer Center Tampa, Florida Australasian Melanoma Conference 2016 Sydney, NSW, Australia October 29, 2016 Disclosures Dr. Sondak is a compensated

More information

gliomas. Fetal brain expected who each low-

gliomas. Fetal brain expected who each low- Supplementary Figure S1. Grade-specificity aberrant expression of HOXA genes in gliomas. (A) Representative RT-PCR analyses of HOXA gene expression in human astrocytomas. Exemplified glioma samples include

More information

I have no relevant conflicts of interest to disclose. John T. Seykora MD PhD Departments of Dermatology & Pathology and Laboratory Medicine

I have no relevant conflicts of interest to disclose. John T. Seykora MD PhD Departments of Dermatology & Pathology and Laboratory Medicine Molecular Characterization of Stage 1-3 Melanoma: Are we close to accurate prognostication and prediction? I have no relevant conflicts of interest to disclose. John T. Seykora MD PhD Departments of Dermatology

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

More information

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

More information

MAPK Pathway. CGH Next Generation Sequencing. Molecular Tools in Care of Patients with Pigmented Lesions 7/20/2017

MAPK Pathway. CGH Next Generation Sequencing. Molecular Tools in Care of Patients with Pigmented Lesions 7/20/2017 Molecular Tools in Care of Patients with Pigmented Lesions Tammie Ferringer, MD Geisinger Medical Center, Danville, PA tferringer@geisinger.edu DISCLOSURE OF RELATIONSHIPS WITH INDUSTRY Tammie Ferringer,

More information

Simulators of melanoma

Simulators of melanoma Simulators of melanoma Philip E. LeBoit, M.D. Depts. of Pathology and Dermatology University of California, San Francisco Simulators of melanoma Simulators of melanoma in situ Melanocytic Non-melanocytic

More information

SUPPLEMENTARY APPENDIX

SUPPLEMENTARY APPENDIX SUPPLEMENTARY APPENDIX 1) Supplemental Figure 1. Histopathologic Characteristics of the Tumors in the Discovery Cohort 2) Supplemental Figure 2. Incorporation of Normal Epidermal Melanocytic Signature

More information

Brief Report. Shivanand Gundalli 1, Smita Kadadavar 1, Somil Singhania 1, Rutuja Kolekar 2 INTRODUCTION. Melanocytic Nevus

Brief Report. Shivanand Gundalli 1, Smita Kadadavar 1, Somil Singhania 1, Rutuja Kolekar 2 INTRODUCTION. Melanocytic Nevus Our Dermatology Online Histopathological spectrum of benign melanocytic nevi our experience in a tertiary care centre Shivanand Gundalli 1, Smita Kadadavar 1, Somil Singhania 1, Rutuja Kolekar 2 1 Department

More information

An ultrasensitive method for quantitating circulating tumor DNA with broad patient coverage

An ultrasensitive method for quantitating circulating tumor DNA with broad patient coverage An ultrasensitive method for quantitating circulating tumor DNA with broad patient coverage Aaron M Newman1,2,7, Scott V Bratman1,3,7, Jacqueline To3, Jacob F Wynne3, Neville C W Eclov3, Leslie A Modlin3,

More information

Female 18. Deeply pigmented lesion on trunk.?warty naevus?seborrhoeic keratosis?malignant melanoma. The best diagnosis is:

Female 18. Deeply pigmented lesion on trunk.?warty naevus?seborrhoeic keratosis?malignant melanoma. The best diagnosis is: Female 18. Deeply pigmented lesion on trunk.?warty naevus?seborrhoeic keratosis?malignant melanoma. The best diagnosis is: A. deep penetrating naevus B. naevoid malignant melanoma C. pigment synthesising

More information

Pathology of the skin. 2nd Department of Pathology, Semmelweis University

Pathology of the skin. 2nd Department of Pathology, Semmelweis University Pathology of the skin 2nd Department of Pathology, Semmelweis University Histology of the skin Epidermis: Stratum corneum Stratum granulosum Stratum spinosum Stratum basale Dermis: papillary and reticular

More information

Primary Cutaneous CD30-Positive T-cell Lymphoproliferative Disorders

Primary Cutaneous CD30-Positive T-cell Lymphoproliferative Disorders Primary Cutaneous CD30-Positive T-cell Lymphoproliferative Disorders Definition A spectrum of related conditions originating from transformed or activated CD30-positive T-lymphocytes May coexist in individual

More information

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.

More information

SUPPLEMENTARY FIGURES: Supplementary Figure 1

SUPPLEMENTARY FIGURES: Supplementary Figure 1 SUPPLEMENTARY FIGURES: Supplementary Figure 1 Supplementary Figure 1. Glioblastoma 5hmC quantified by paired BS and oxbs treated DNA hybridized to Infinium DNA methylation arrays. Workflow depicts analytic

More information

Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the

Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the cardiac glycoside target, ATP1A1. (a) The percentage

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

MRC-Holland MLPA. Description version 06; 23 December 2016

MRC-Holland MLPA. Description version 06; 23 December 2016 SALSA MLPA probemix P417-B2 BAP1 Lot B2-1216. As compared to version B1 (lot B1-0215), two reference probes have been added and two target probes have a minor change in length. The BAP1 (BRCA1 associated

More information

Genomic structural variation

Genomic structural variation Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural

More information

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study. mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their

More information

Copy number and somatic mutations drive tumors

Copy number and somatic mutations drive tumors Detection of copy number alterations, ploidy and loss of heterozygosity across the genome in FFPE specimens Utility for diagnosis and treatment with comparison to FISH-based and as a complement to sequencing

More information

Variations in Chromosome Structure & Function. Ch. 8

Variations in Chromosome Structure & Function. Ch. 8 Variations in Chromosome Structure & Function Ch. 8 1 INTRODUCTION! Genetic variation refers to differences between members of the same species or those of different species Allelic variations are due

More information

Structural Variation and Medical Genomics

Structural Variation and Medical Genomics Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,

More information

Sharan Goobie, MD, MSc, FRCPC

Sharan Goobie, MD, MSc, FRCPC Sharan Goobie, MD, MSc, FRCPC Chromosome testing in 2014 Presenter Disclosure: Sharan Goobie has no potential for conflict of interest with this presentation Objectives Review of standard genetic investigations

More information

Case 2. Dr. Sathima Natarajan M.D. Kaiser Permanente Medical Center Sunset

Case 2. Dr. Sathima Natarajan M.D. Kaiser Permanente Medical Center Sunset Case 2 Dr. Sathima Natarajan M.D. Kaiser Permanente Medical Center Sunset History 24 year old male presented with a 3 day history of right flank pain, sharp in nature Denies fever, chills, hematuria or

More information

Looking after your moles

Looking after your moles Who is at increased risk? This leaflet is designed to help you look after your own moles. It is hoped that it will be useful for everyone but it may be especially valuable for people who are at increased

More information

Ways to get into trouble, ideas on avoiding trouble, and diagnostic approaches to keep trouble at bay

Ways to get into trouble, ideas on avoiding trouble, and diagnostic approaches to keep trouble at bay Pitfalls in the diagnosis of melanocytic tumors Timothy McCalmont, MD University of California, San Francisco Ways to get into trouble, ideas on avoiding trouble, and diagnostic approaches to keep trouble

More information

Activation of cellular proto-oncogenes to oncogenes. How was active Ras identified?

Activation of cellular proto-oncogenes to oncogenes. How was active Ras identified? Dominant Acting Oncogenes Eugene E. Marcantonio, M.D. Ph.D. Oncogenes are altered forms of normal cellular genes called proto-oncogenes that are involved in pathways regulating cell growth, differentiation,

More information

Aliccia Bollig-Fischer, PhD Department of Oncology, Wayne State University Associate Director Genomics Core Molecular Therapeutics Program Karmanos

Aliccia Bollig-Fischer, PhD Department of Oncology, Wayne State University Associate Director Genomics Core Molecular Therapeutics Program Karmanos Aliccia Bollig-Fischer, PhD Department of Oncology, Wayne State University Associate Director Genomics Core Molecular Therapeutics Program Karmanos Cancer Institute Development of a multiplexed assay to

More information

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,

More information

Challenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014

Challenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014 Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical

More information

Applications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns

Applications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns Applications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns جواد کریمزاد حق PhD of Medical Genetics آزمايشگاه پاتوبيولوژي و ژنتيك پارسه

More information

Genetic Testing: When should it be ordered? Julie Schloemer, MD Dermatology

Genetic Testing: When should it be ordered? Julie Schloemer, MD Dermatology Genetic Testing: When should it be ordered? Julie Schloemer, MD Dermatology Outline Germline testing CDKN2A BRCA2 BAP1 Somatic testing Gene expression profiling (GEP) BRAF Germline vs Somatic testing

More information

MECHANISMS OF HUMAN DISEASE: LABORATORY SESSION PATHOLOGY OF THE SKIN LAB. Friday, February 13, :30 am 11:00 am

MECHANISMS OF HUMAN DISEASE: LABORATORY SESSION PATHOLOGY OF THE SKIN LAB. Friday, February 13, :30 am 11:00 am MECHANISMS OF HUMAN DISEASE: LABORATORY SESSION PATHOLOGY OF THE SKIN LAB Friday, February 13, 2009 9:30 am 11:00 am FACULTY COPY GOALS: Describe the basic clinical and morphologic features of various

More information

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted

More information

1/10/2018. Soft Tissue Tumors Showing Melanocytic Differentiation. Overview. Desmoplastic/ Spindle Cell Melanoma

1/10/2018. Soft Tissue Tumors Showing Melanocytic Differentiation. Overview. Desmoplastic/ Spindle Cell Melanoma 2016 MFMER slide-1 2016 MFMER slide-2 2016 MFMER slide-3 Soft Tissue Tumors Showing Melanocytic Differentiation Andrew L. Folpe, M.D. Professor of Laboratory Medicine and Pathology Mayo Clinic, Rochester,

More information

Selected Pseudomalignant Soft Tissue Tumors of the Skin and Subcutis

Selected Pseudomalignant Soft Tissue Tumors of the Skin and Subcutis Selected Pseudomalignant Soft Tissue Tumors of the Skin and Subcutis Andrew L. Folpe, M.D. Professor of Laboratory Medicine and Pathology Mayo Clinic, Rochester, MN folpe.andrew@mayo.edu 2016 MFMER slide-1

More information

Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011

Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011 Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011 Massive Genomic Rearrangement Acquired in a Single Catastrophic Event during Cancer Development Cell 144,

More information

of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed.

of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed. Supplementary Note The potential association and implications of HBV integration at known and putative cancer genes of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed. Human telomerase

More information

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate

More information

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to

More information

Canadian College of Medical Geneticists (CCMG) Cytogenetics Examination. May 4, 2010

Canadian College of Medical Geneticists (CCMG) Cytogenetics Examination. May 4, 2010 Canadian College of Medical Geneticists (CCMG) Cytogenetics Examination May 4, 2010 Examination Length = 3 hours Total Marks = 100 (7 questions) Total Pages = 8 (including cover sheet and 2 pages of prints)

More information

Zhu et al, page 1. Supplementary Figures

Zhu et al, page 1. Supplementary Figures Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior

More information

A 25 year old female with a palpable mass in the right lower quadrant of her abdomen

A 25 year old female with a palpable mass in the right lower quadrant of her abdomen May 2016 A 25 year old female with a palpable mass in the right lower quadrant of her abdomen Contributed by: Paul Ndekwe, MD, Resident Physician, Indiana University School of Department of Pathology and

More information

RNA SEQUENCING AND DATA ANALYSIS

RNA SEQUENCING AND DATA ANALYSIS RNA SEQUENCING AND DATA ANALYSIS Length of mrna transcripts in the human genome 5,000 5,000 4,000 3,000 2,000 4,000 1,000 0 0 200 400 600 800 3,000 2,000 1,000 0 0 2,000 4,000 6,000 8,000 10,000 Length

More information

ACCME/Disclosures ALK FUSION-POSITIVE MESENCHYMAL TUMORS. Tumor types with ALK rearrangements. Anaplastic Lymphoma Kinase. Jason L.

ACCME/Disclosures ALK FUSION-POSITIVE MESENCHYMAL TUMORS. Tumor types with ALK rearrangements. Anaplastic Lymphoma Kinase. Jason L. Companion Meeting of the International Society of Bone and Soft Tissue Pathology The Evolving Concept of Mesenchymal Tumors ALK FUSION-POSITIVE MESENCHYMAL TUMORS Jason L. Hornick, MD, PhD March 13, 2016

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Yatsenko AN, Georgiadis AP, Röpke A, et al. X-linked TEX11

More information

Evening Specialty Conference Bone and Soft Tissue Pathology. Diagnostic pitfalls in bone and soft tissue pathology

Evening Specialty Conference Bone and Soft Tissue Pathology. Diagnostic pitfalls in bone and soft tissue pathology Evening Specialty Conference Bone and Soft Tissue Pathology. Case 1 Elizabeth G Demicco, MD, PhD Mount Sinai Hospital, New York Disclosure of Relevant Financial Relationships USCAP requires that all planners

More information

USCAP 2012: Companion Meeting of the AAOOP. Update on lacrimal gland neoplasms: Molecular pathology of interest

USCAP 2012: Companion Meeting of the AAOOP. Update on lacrimal gland neoplasms: Molecular pathology of interest USCAP 2012: Companion Meeting of the AAOOP Vancouver BC, Canada, March 17, 2012 Update on lacrimal gland neoplasms: Molecular pathology of interest Valerie A. White MD, MHSc, FRCPC Department of Pathology

More information

NOD-like receptor signaling and inflammasome-related pathways are highlighted in psoriatic epidermis

NOD-like receptor signaling and inflammasome-related pathways are highlighted in psoriatic epidermis Supplementary Information NOD-like receptor signaling and inflammasome-related pathways are highlighted in psoriatic epidermis Mari H. Tervaniemi, Shintaro Katayama, Tiina Skoog, H. Annika Siitonen, Jyrki

More information

The Genetics of Myoepithelial Tumors: salivary glands, soft tissue and bone

The Genetics of Myoepithelial Tumors: salivary glands, soft tissue and bone The Genetics of Myoepithelial Tumors: salivary glands, soft tissue and bone Cristina Antonescu, MD Memorial Sloan-Kettering Cancer Center, New York Nothing to declare Disclosure Spectrum of Myoepithelial

More information

Determination of Genomic Imbalances by Genome-wide Screening Approaches

Determination of Genomic Imbalances by Genome-wide Screening Approaches Overview Determination of Genomic Imbalances by Genome-wide Screening Approaches Károly Szuhai Introduction/Methodologies Applications/Results Conclusion Approaches Introduction/Methodologies Chromosome

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

Supplementary Figures

Supplementary Figures Supplementary Figures a miel1-2 (SALK_41369).1kb miel1-1 (SALK_978) b TUB MIEL1 Supplementary Figure 1. MIEL1 expression in miel1 mutant and S:MIEL1-MYC transgenic plants. (a) Mapping of the T-DNA insertion

More information

The Pathology of Neoplasia Part II

The Pathology of Neoplasia Part II The Pathology of Neoplasia Part II February 2018 PAUL BOGNER, MD A S S O C I A T E P R O F E S S O R O F O N C O L O G Y P A T H O L O G Y A N D D E R M A T O L O G Y Clinical goals of cancer pathology

More information

Myxo-inflammatory Fibroblastic sarcoma

Myxo-inflammatory Fibroblastic sarcoma AKA Myxo-inflammatory Fibroblastic sarcoma Acral Myxoinflammatory fibroblastic sarcomaam.j.surg.path1998; 22; 911-924 Inflammatory myxoid tumour of soft parts with bizarre giant cells [Pathol.Res.Pract.

More information

Desmoplastic Melanoma R/O BCC. Clinical Information. 74 y.o. man with lesion on left side of neck r/o BCC

Desmoplastic Melanoma R/O BCC. Clinical Information. 74 y.o. man with lesion on left side of neck r/o BCC R/O BCC Sabine Kohler, M.D. Professor of Pathology and Dermatology Dermatopathology Service Stanford University School of Medicine Clinical Information 74 y.o. man with lesion on left side of neck r/o

More information

Supplementary Tables. Supplementary Figures

Supplementary Tables. Supplementary Figures Supplementary Files for Zehir, Benayed et al. Mutational Landscape of Metastatic Cancer Revealed from Prospective Clinical Sequencing of 10,000 Patients Supplementary Tables Supplementary Table 1: Sample

More information

Update On Lipomatous Tumors: Old Standbys and New Concepts

Update On Lipomatous Tumors: Old Standbys and New Concepts Update On Lipomatous Tumors: Old Standbys and New Concepts John R. Goldblum, M.D. Chairman, Department of Anatomic Pathology Cleveland Clinic Professor of Pathology Cleveland Clinic Lerner College of Medicine

More information

ADx Bone Marrow Report. Patient Information Referring Physician Specimen Information

ADx Bone Marrow Report. Patient Information Referring Physician Specimen Information ADx Bone Marrow Report Patient Information Referring Physician Specimen Information Patient Name: Specimen: Bone Marrow Site: Left iliac Physician: Accession #: ID#: Reported: 08/19/2014 - CHRONIC MYELOGENOUS

More information

Conflict of Interest 9/2/2014. Pathogenesis and Comparison of Atypical Spitz Nevi vs Benign Spitz, and Childhood Melanoma

Conflict of Interest 9/2/2014. Pathogenesis and Comparison of Atypical Spitz Nevi vs Benign Spitz, and Childhood Melanoma Pathogenesis and Comparison of Atypical Spitz Nevi vs Benign Spitz, and Childhood Melanoma Martin C. Mihm Jr., M.D., F.A.C.P. Harvard Medical School Brigham and Women s Hospital Dana Farber Cancer Center

More information

Cellular Neurothekeoma

Cellular Neurothekeoma Cellular Neurothekeoma Scott W Binder, MD Pritzker Professor of Pathology & Dermatology Sr. Vice Chair Director, Pathology Clinical Services Chief, Dermatopathology Geffen/UCLA School of Medicine Clinical

More information

Cutaneous Mesenchymal Neoplasms with EWSR1 Rearrangement

Cutaneous Mesenchymal Neoplasms with EWSR1 Rearrangement Cutaneous Mesenchymal Neoplasms with EWSR1 Rearrangement By Konstantinos Linos MD, FCAP, FASDP Bone, Soft Tissue and Dermatopathology Assistant Professor of Pathology Dartmouth-Hitchcock Medical Center

More information

Nature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity.

Nature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity. Supplementary Figure 1 HOX fusions enhance self-renewal capacity. Mouse bone marrow was transduced with a retrovirus carrying one of three HOX fusion genes or the empty mcherry reporter construct as described

More information

BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information)

BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information) BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information) David Dankort, David P. Curley, Robert A. Cartlidge, Betsy Nelson, Anthony N. Karnezis,

More information

Germline mutation analysis in the CYLD gene in Chinese patients with multiple trichoepitheliomas

Germline mutation analysis in the CYLD gene in Chinese patients with multiple trichoepitheliomas Germline mutation analysis in the CYLD gene in Chinese patients with multiple trichoepitheliomas Z.L. Li 1,2, H.H. Guan 3, X.M. Xiao 1,2, Y. Hui 3, W.X. Jia 1,2, R.X. Yu 1,2, H. Chen 1,2 and C.R. Li 1,2

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*

More information

Newer soft tissue entities

Newer soft tissue entities Newer soft tissue entities Examples among fibroblastic tumors Turku, May 6, 2010 Markku Miettinen, M.D. AFIP, Washington, DC Fibroblastic neoplasms Solitary fibrous tumor /Hemangiopericytoma Low-grade

More information

أملس عضلي غرن = Leiomyosarcoma. Leiomyosarcoma 1 / 5

أملس عضلي غرن = Leiomyosarcoma. Leiomyosarcoma 1 / 5 Leiomyosarcoma 1 / 5 EPIDEMIOLOGY Exact incidence is unknown, but older studies suggest that leiomyosarcomas comprise approximately 3 percent of soft-tissue sarcomas. Superficial leiomyosarcoma occurs

More information

RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays

RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Supplementary Materials RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Junhee Seok 1*, Weihong Xu 2, Ronald W. Davis 2, Wenzhong Xiao 2,3* 1 School of Electrical Engineering,

More information

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why

More information