Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the
|
|
- Sarah Morris
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the deep dermis. (b) The melanocytes demonstrate abundant cytoplasm and clefting around nests of melanocytes and between melanocytes (20x). (c) Towards the base of the melanoma, individual melanocytes are interspersed between collagen bundles and around small nerves (20x, arrow). (d) Whole genome copy number profile demonstrates losses on 6q and 22q, and gains on 7q, 12p and 18. (e) Copy number transitions are present within both fusion partners, with loss of the portion of the genes not participating in the fusions. (f) Integrative genomics viewer demonstrates fusion reads that map to the breakpoints on both genes. Unaligned bases (rainbow-colored) flank the breakpoints. (g) The exon structure of the predicted fusion transcript (top). RT-PCR and sequencing confirmed the sequence and expression of the fusion transcript (bottom).
2 Supplementary Figure 2. Atypical Spitz tumor with complex rearrangement resulting in TRIM4-MET fusion kinase. (a) Histopathology shows a broad compound melanocytic neoplasm (4x, top). Large nests of melanocytes are present within a fibrotic superficial dermis (4x, lower left). Some of the nests of melanocytes appear to contain myxoid stroma (20x, lower right). (b) Stacks of DNA sequencing reads viewed in Integrative Genomics Viewer with unaligned portions (rainbow colored) flanking one side of the fusion junctions on 7q22 (left panel) and MET intron 14 (right panel). Reads whose mate pair maps to the opposite side of the fusion junction are maroon. (c) Kinome RNASeq statistics (top). Expression of the TRIM4-MET transcript was confirmed by RT-PCR (bottom). (d) Copy number profile of the region of 7q that contains TRIM4 and MET. Gains of the 5 portion of TRIM4, the intergenic region on 7q22 and the 3 portion of MET are present with similar amplitudes.
3 Supplementary Figure 3. Aggregate array comparative genomic hybridization profiles of tumors. The top panel shows the aggregate copy number profile of tumors with gain of a distal portion of the long arm of chromosome 7 (n=74). The bottom panel shows the aggregate copy number profile of the remaining tumors in the cohort (n=1128).
4 Supplementary Figure 4. Atypical Spitz Tumor with DCTN1-MET fusion arising from reciprocal translocation. (a) Histopathology demonstrates large nests of spitzoid melanocytes within the epidermis and superficial dermis (left 4x, right 20x). (b) Whole genome acgh profile (top panel) demonstrates gains on chromosomes 2 and 7. Copy number aberrations are present near DCTN1 and MET, but no copy number transitions occur within either gene (bottom panel). (c) Reads spanning both reciprocal fusion junctions map to DCTN1. The unaligned portions (representing sequence from MET, rainbow-colored) flank the breakpoints. Blue reads have mate-pairs that map to MET on chromosome 7.
5 Supplementary Figure 5. Atypical Spitz tumor with EPS15-MET fusion and signs of chromothripsis. (a) Histopathology demonstrates a dome-shaped exophytic papule with a thinned epidermis (4x). The neoplastic melanocytes are arrayed in large nests and sheets with focal dense inflammation (left). The melanocytes are epithelioid with abundant eosinophilic cytoplasm (right). (b) Copy number profile demonstrates regions of gain on the short arm of chromosome 1 and the long arm of chromosome 7 (top). Copy number oscillation between two copy number states is present in these areas (bottom). (c) Four distinct fusion junctions are identified by DNA sequencing within MET. These fusion junctions are arranged in pairs that appear to arise from the same breakpoint (separated by less than 10 bp, involving opposite sides of the inferred breakpoint). The two breakpoints within MET are separated by 1240 bp. The four fusions within MET occur with 3 distinct regions on the short arm of chromosome
6 1. (d) The exon structure of the predicted fusion transcript (top). RT-PCR and sequencing confirmed the sequence and expression of the fusion transcript (bottom).
7 Supplementary Figure 6. Common Nevi have low levels of MET expression and undetectable p-met levels. The MET and p-met immunohistochemistry for 2 common nevi are presented.
8 Supplementary Figure 7. Expression of TRIM4-MET and ZKSCAN1-MET in 293FT cells activates MAP kinase pathway signaling in contrast to overexpression of wild-type MET. Expression of wild-type MET, TRIM4-MET and ZKSCAN1-MET results in bands at expected molecular weights in the MET blot. All three MET constructs lead to increased levels of p-met, but only the MET fusions result in a detectable increase of p-erk.
9 Supplementary Figure 8. Full Western blots from Figure 4a.
10 Supplementary Figure 9. Full Western blots from Figure 4b.
11 Supplementary Table 1. Clinical characteristics of the cohort. Average Age Median Age male female spitzoid Malignant Ambiguous Benign UCSF Array CGH Database (n=1202) TCGA Melanoma Cases Analyzed by Stransky et al. (n=374) NA Supplementary Table 2. RT-PCR primers. Forward Primer Reverse Primer TRIM4-MET GCCAGATACCATTGATGAAGG CTCCATGTTTCATGTATGGTAGG ZKSCAN1-MET CTTCAAACATTCGTCTCGG CTCCATGTTTCATGTATGGTAGG DCTN1-MET CTTCAGGCATTGCTACTCTGG CTCCATGTTTCATGTATGGTAGG PPFIBP1-MET GTTTGCAAGATGAAAGGAGAAGG CTCCATGTTTCATGTATGGTAGG EPS15-MET TGGTGGAACAGTTGTTGC CTCCATGTTTCATGTATGGTAGG
Update on Spitzoid and Blue nevus-like melanocytic lesions Emphasis on molecular studies informing diagnosis, prognosis and therapy
Update on Spitzoid and Blue nevus-like melanocytic lesions Emphasis on molecular studies informing diagnosis, prognosis and therapy Michael T. Tetzlaff MD, PhD Associate Professor Department of Pathology,
More informationDermatopathology. Dr. Rafael Botella Estrada. Hospital La Fe de Valencia
Dermatopathology Dr. Rafael Botella Estrada. Hospital La Fe de Valencia Melanoma and mimics Dr. Martin Mihm Malignant lesions result from the accumulation of mutations Class I lesions (benign) Class II
More informationMolecular Aspects of Melanocytic Neoplasia. Iwei Yeh MD, PhD University of California, San Francisco
Molecular Aspects of Melanocytic Neoplasia Iwei Yeh MD, PhD University of California, San Francisco Thanks to: Boris Bastian Timothy McCalmont Philip LeBoit Beth Ruben Jeff North Laura Pincus Thaddeus
More informationThe Enigmatic Spitz Lesion
The Enigmatic Spitz Lesion The Dawn of Spitz S Spitz Sophie Spitz Melanomas of Childhood ; Am J Pathol 1948 1910-1956 13 children (18 mo - 12 yrs) 12/13 had a benign clinical course Sophie Spitz Born 1910
More informationReviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): In this study the authors analysed 18 deep penetrating nevi for oncogenic genomic changes (single nucleotide variations, insertions/deletions,
More informationMalignant Peripheral Nerve Sheath Tumor
C H A P T E R 120 Malignant Peripheral Nerve Sheath Tumor Currently, malignant peripheral nerve sheath tumor (MPNST) is the most commonly used generic name for the neoplasms known in the past as neurosarcoma,
More informationNature Biotechnology: doi: /nbt.1904
Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is
More informationMelanoma and the genes: Molecular alterations informing the diagnosis of melanocytic tumors
Melanoma and the genes: Molecular alterations informing the diagnosis of melanocytic tumors Michael T. Tetzlaff MD, PhD Associate Professor Department of Pathology, Section of Dermatopathology Department
More information21/07/2017. The «gray zone» of diagnosis is visible. Nevus Atypical nevus Melanoma. Melanoma ex-blue nevus
Update on the Clinico- Pathological and Molecular Diagnosis of Melanocytic Lesions None to declare Conflicts of interest Belfast pathology Arnaud de la Fouchardière MD, PhD Lyon, France What is new? Today
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature8645 Physical coverage (x haploid genomes) 11 6.4 4.9 6.9 6.7 4.4 5.9 9.1 7.6 125 Neither end mapped One end mapped Chimaeras Correct Reads (million ns) 1 75 5 25 HCC1187 HCC1395 HCC1599
More informationMichael T. Tetzlaff MD, PhD
Molecular alterations informing the diagnosis of melanocytic tumors Michael T. Tetzlaff MD, PhD Associate Professor Department of Pathology, Section of Dermatopathology Department of Translational and
More informationBenign and malignant epithelial lesions: Seborrheic keratosis: A common benign pigmented epidermal tumor occur in middle-aged or older persons more
Benign and malignant epithelial lesions: Seborrheic keratosis: A common benign pigmented epidermal tumor occur in middle-aged or older persons more common on the trunk; but extremities, head and neck are
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationp.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11
ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N
More informationالمركب النموذج--- سبيتز وحمة = Type Spitz's Nevus, Compound SPITZ NEVUS 1 / 7
SPITZ NEVUS 1 / 7 Epidemiology An annual incidence rate of 1.4 cases of Spitz nevus per 100,000 individuals has been estimated in Australia, compared with 25.4 per 100,000 individuals for cutaneous melanoma
More information10/2/17. MELTUMP, SAMPUS, AST.An Algorithmic Approach to Challenging (Often Borderline) Melanocytic Tumors. An Introduction to SNP Arrays
MELTUMP, SAMPUS, AST.An Algorithmic Approach to Challenging (Often ) Melanocytic Tumors An Introduction to SNP Arrays Rajiv M. Patel, M.D. RCPA NZ ASM 2017 (11:45-12:30pm, Saturday, 23-09-17) Why do we
More informationMODULE 4: SPLICING. Removal of introns from messenger RNA by splicing
Last update: 05/10/2017 MODULE 4: SPLICING Lesson Plan: Title MEG LAAKSO Removal of introns from messenger RNA by splicing Objectives Identify splice donor and acceptor sites that are best supported by
More informationWhole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes
More information6/22/2015. Original Paradigm. Correlating Histology and Molecular Findings in Melanocytic Neoplasms
6 Correlating Histology and Molecular Findings in Melanocytic Neoplasms Pedram Gerami MD, Associate Professor of Dermatology and Pediatrics at Northwestern University Disclosures: I have been a consultant
More informationMalignant tumors of melanocytes: Part 1. Deba P Sarma, MD., Omaha
Malignant tumors of melanocytes: Part 1 Deba P Sarma, MD., Omaha The melanocytic tumor is one of the most difficult and confusing areas in Dematopathology. It is true that most (95%) of such lesions are
More informationHistopathology of Melanoma
THE YALE JOURNAL OF BIOLOGY AND MEDICINE 48, 409-416 (1975) Histopathology of Melanoma G. J. WALKER SMITH Department ofpathology, Yale University School ofmedicine, 333 Cedar Street, New Haven, Connecticut
More informationSelf assessment case. Dr Saleem Taibjee Dorset County Hospital, Dorchester
Self assessment case Dr Saleem Taibjee saleemtaibjee@gmail.com Dorset County Hospital, Dorchester Clinical details 34-year-old man: Shave excision Skin tag / papilloma left thigh The best diagnosis is:
More informationPage 1 of 3. We suggest the following changes:
Page 1 of 3 Loren E. Clarke, M.D. Myriad Genetic Laboratories, Inc. 320 Wakara Way, Salt Lake City, UT 84108 Phone: 801.883.3470 Email: lclarke@myriad.com Date of Request: June 2017 NCCN Guidelines Panel:
More informationRole of FISH in Hematological Cancers
Role of FISH in Hematological Cancers Thomas S.K. Wan PhD,FRCPath,FFSc(RCPA) Honorary Professor, Department of Pathology & Clinical Biochemistry, Queen Mary Hospital, University of Hong Kong. e-mail: wantsk@hku.hk
More informationCase 26 Male 37. Right jawline 5mm nodule?keloid. The best diagnosis is:
Case 26 Male 37. Right jawline 5mm nodule?keloid. The best diagnosis is: A. Desmoplastic Spitz naevus B. Atypical Spitz Tumour C. Spitzoid melanoma D. Deep penetrating naevus E. Spitz naevus Case 26: M
More informationFinancial disclosures
Mesenchymal Neoplasms with Melanocytic Differentiation By Konstantinos Linos MD, FCAP, FASDP Bone, Soft Tissue and Dermatopathology Assistant Professor of Pathology Dartmouth-Hitchcock Medical Center Geisel
More informationMolecular Methods in the Diagnosis and Prognostication of Melanoma: Pros & Cons
Molecular Methods in the Diagnosis and Prognostication of Melanoma: Pros & Cons Ben J. Friedman, MD Senior Staff Physician Department of Dermatology Department of Pathology and Laboratory Medicine Henry
More informationHistopathology: skin pathology
Histopathology: skin pathology These presentations are to help you identify, and to test yourself on identifying, basic histopathological features. They do not contain the additional factual information
More information21/07/2017. Hobnail endothelial cells are not the same as epithelioid endothelial cells
UPDATE IN CUTANEOUS VASCULAR S DERMATOPATHOLOGY SESSION BELFAST PATHOLOGY JUNE 21/2017 Dr E Calonje St John s Institute of Dermatology, London, United Kingdom THE FAMILY OF VASCULAR S WITH EPITHELIOID
More informationVernon K. Sondak. Department of Cutaneous Oncology Moffitt Cancer Center Tampa, Florida
Vernon K. Sondak Department of Cutaneous Oncology Moffitt Cancer Center Tampa, Florida Australasian Melanoma Conference 2016 Sydney, NSW, Australia October 29, 2016 Disclosures Dr. Sondak is a compensated
More informationgliomas. Fetal brain expected who each low-
Supplementary Figure S1. Grade-specificity aberrant expression of HOXA genes in gliomas. (A) Representative RT-PCR analyses of HOXA gene expression in human astrocytomas. Exemplified glioma samples include
More informationI have no relevant conflicts of interest to disclose. John T. Seykora MD PhD Departments of Dermatology & Pathology and Laboratory Medicine
Molecular Characterization of Stage 1-3 Melanoma: Are we close to accurate prognostication and prediction? I have no relevant conflicts of interest to disclose. John T. Seykora MD PhD Departments of Dermatology
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationMAPK Pathway. CGH Next Generation Sequencing. Molecular Tools in Care of Patients with Pigmented Lesions 7/20/2017
Molecular Tools in Care of Patients with Pigmented Lesions Tammie Ferringer, MD Geisinger Medical Center, Danville, PA tferringer@geisinger.edu DISCLOSURE OF RELATIONSHIPS WITH INDUSTRY Tammie Ferringer,
More informationSimulators of melanoma
Simulators of melanoma Philip E. LeBoit, M.D. Depts. of Pathology and Dermatology University of California, San Francisco Simulators of melanoma Simulators of melanoma in situ Melanocytic Non-melanocytic
More informationSUPPLEMENTARY APPENDIX
SUPPLEMENTARY APPENDIX 1) Supplemental Figure 1. Histopathologic Characteristics of the Tumors in the Discovery Cohort 2) Supplemental Figure 2. Incorporation of Normal Epidermal Melanocytic Signature
More informationBrief Report. Shivanand Gundalli 1, Smita Kadadavar 1, Somil Singhania 1, Rutuja Kolekar 2 INTRODUCTION. Melanocytic Nevus
Our Dermatology Online Histopathological spectrum of benign melanocytic nevi our experience in a tertiary care centre Shivanand Gundalli 1, Smita Kadadavar 1, Somil Singhania 1, Rutuja Kolekar 2 1 Department
More informationAn ultrasensitive method for quantitating circulating tumor DNA with broad patient coverage
An ultrasensitive method for quantitating circulating tumor DNA with broad patient coverage Aaron M Newman1,2,7, Scott V Bratman1,3,7, Jacqueline To3, Jacob F Wynne3, Neville C W Eclov3, Leslie A Modlin3,
More informationFemale 18. Deeply pigmented lesion on trunk.?warty naevus?seborrhoeic keratosis?malignant melanoma. The best diagnosis is:
Female 18. Deeply pigmented lesion on trunk.?warty naevus?seborrhoeic keratosis?malignant melanoma. The best diagnosis is: A. deep penetrating naevus B. naevoid malignant melanoma C. pigment synthesising
More informationPathology of the skin. 2nd Department of Pathology, Semmelweis University
Pathology of the skin 2nd Department of Pathology, Semmelweis University Histology of the skin Epidermis: Stratum corneum Stratum granulosum Stratum spinosum Stratum basale Dermis: papillary and reticular
More informationPrimary Cutaneous CD30-Positive T-cell Lymphoproliferative Disorders
Primary Cutaneous CD30-Positive T-cell Lymphoproliferative Disorders Definition A spectrum of related conditions originating from transformed or activated CD30-positive T-lymphocytes May coexist in individual
More informationSupplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
More informationSUPPLEMENTARY FIGURES: Supplementary Figure 1
SUPPLEMENTARY FIGURES: Supplementary Figure 1 Supplementary Figure 1. Glioblastoma 5hmC quantified by paired BS and oxbs treated DNA hybridized to Infinium DNA methylation arrays. Workflow depicts analytic
More informationSupplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the cardiac glycoside target, ATP1A1. (a) The percentage
More informationSupplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
More informationMRC-Holland MLPA. Description version 06; 23 December 2016
SALSA MLPA probemix P417-B2 BAP1 Lot B2-1216. As compared to version B1 (lot B1-0215), two reference probes have been added and two target probes have a minor change in length. The BAP1 (BRCA1 associated
More informationGenomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
More informationSupplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.
mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their
More informationCopy number and somatic mutations drive tumors
Detection of copy number alterations, ploidy and loss of heterozygosity across the genome in FFPE specimens Utility for diagnosis and treatment with comparison to FISH-based and as a complement to sequencing
More informationVariations in Chromosome Structure & Function. Ch. 8
Variations in Chromosome Structure & Function Ch. 8 1 INTRODUCTION! Genetic variation refers to differences between members of the same species or those of different species Allelic variations are due
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationSharan Goobie, MD, MSc, FRCPC
Sharan Goobie, MD, MSc, FRCPC Chromosome testing in 2014 Presenter Disclosure: Sharan Goobie has no potential for conflict of interest with this presentation Objectives Review of standard genetic investigations
More informationCase 2. Dr. Sathima Natarajan M.D. Kaiser Permanente Medical Center Sunset
Case 2 Dr. Sathima Natarajan M.D. Kaiser Permanente Medical Center Sunset History 24 year old male presented with a 3 day history of right flank pain, sharp in nature Denies fever, chills, hematuria or
More informationLooking after your moles
Who is at increased risk? This leaflet is designed to help you look after your own moles. It is hoped that it will be useful for everyone but it may be especially valuable for people who are at increased
More informationWays to get into trouble, ideas on avoiding trouble, and diagnostic approaches to keep trouble at bay
Pitfalls in the diagnosis of melanocytic tumors Timothy McCalmont, MD University of California, San Francisco Ways to get into trouble, ideas on avoiding trouble, and diagnostic approaches to keep trouble
More informationActivation of cellular proto-oncogenes to oncogenes. How was active Ras identified?
Dominant Acting Oncogenes Eugene E. Marcantonio, M.D. Ph.D. Oncogenes are altered forms of normal cellular genes called proto-oncogenes that are involved in pathways regulating cell growth, differentiation,
More informationAliccia Bollig-Fischer, PhD Department of Oncology, Wayne State University Associate Director Genomics Core Molecular Therapeutics Program Karmanos
Aliccia Bollig-Fischer, PhD Department of Oncology, Wayne State University Associate Director Genomics Core Molecular Therapeutics Program Karmanos Cancer Institute Development of a multiplexed assay to
More informationmir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,
More informationChallenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014
Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical
More informationApplications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns
Applications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns جواد کریمزاد حق PhD of Medical Genetics آزمايشگاه پاتوبيولوژي و ژنتيك پارسه
More informationGenetic Testing: When should it be ordered? Julie Schloemer, MD Dermatology
Genetic Testing: When should it be ordered? Julie Schloemer, MD Dermatology Outline Germline testing CDKN2A BRCA2 BAP1 Somatic testing Gene expression profiling (GEP) BRAF Germline vs Somatic testing
More informationMECHANISMS OF HUMAN DISEASE: LABORATORY SESSION PATHOLOGY OF THE SKIN LAB. Friday, February 13, :30 am 11:00 am
MECHANISMS OF HUMAN DISEASE: LABORATORY SESSION PATHOLOGY OF THE SKIN LAB Friday, February 13, 2009 9:30 am 11:00 am FACULTY COPY GOALS: Describe the basic clinical and morphologic features of various
More informationa) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
More information1/10/2018. Soft Tissue Tumors Showing Melanocytic Differentiation. Overview. Desmoplastic/ Spindle Cell Melanoma
2016 MFMER slide-1 2016 MFMER slide-2 2016 MFMER slide-3 Soft Tissue Tumors Showing Melanocytic Differentiation Andrew L. Folpe, M.D. Professor of Laboratory Medicine and Pathology Mayo Clinic, Rochester,
More informationSelected Pseudomalignant Soft Tissue Tumors of the Skin and Subcutis
Selected Pseudomalignant Soft Tissue Tumors of the Skin and Subcutis Andrew L. Folpe, M.D. Professor of Laboratory Medicine and Pathology Mayo Clinic, Rochester, MN folpe.andrew@mayo.edu 2016 MFMER slide-1
More informationChromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011
Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011 Massive Genomic Rearrangement Acquired in a Single Catastrophic Event during Cancer Development Cell 144,
More informationof TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed.
Supplementary Note The potential association and implications of HBV integration at known and putative cancer genes of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed. Human telomerase
More informationBWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space
Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate
More informationEGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
More informationCanadian College of Medical Geneticists (CCMG) Cytogenetics Examination. May 4, 2010
Canadian College of Medical Geneticists (CCMG) Cytogenetics Examination May 4, 2010 Examination Length = 3 hours Total Marks = 100 (7 questions) Total Pages = 8 (including cover sheet and 2 pages of prints)
More informationZhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
More informationA 25 year old female with a palpable mass in the right lower quadrant of her abdomen
May 2016 A 25 year old female with a palpable mass in the right lower quadrant of her abdomen Contributed by: Paul Ndekwe, MD, Resident Physician, Indiana University School of Department of Pathology and
More informationRNA SEQUENCING AND DATA ANALYSIS
RNA SEQUENCING AND DATA ANALYSIS Length of mrna transcripts in the human genome 5,000 5,000 4,000 3,000 2,000 4,000 1,000 0 0 200 400 600 800 3,000 2,000 1,000 0 0 2,000 4,000 6,000 8,000 10,000 Length
More informationACCME/Disclosures ALK FUSION-POSITIVE MESENCHYMAL TUMORS. Tumor types with ALK rearrangements. Anaplastic Lymphoma Kinase. Jason L.
Companion Meeting of the International Society of Bone and Soft Tissue Pathology The Evolving Concept of Mesenchymal Tumors ALK FUSION-POSITIVE MESENCHYMAL TUMORS Jason L. Hornick, MD, PhD March 13, 2016
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Yatsenko AN, Georgiadis AP, Röpke A, et al. X-linked TEX11
More informationEvening Specialty Conference Bone and Soft Tissue Pathology. Diagnostic pitfalls in bone and soft tissue pathology
Evening Specialty Conference Bone and Soft Tissue Pathology. Case 1 Elizabeth G Demicco, MD, PhD Mount Sinai Hospital, New York Disclosure of Relevant Financial Relationships USCAP requires that all planners
More informationUSCAP 2012: Companion Meeting of the AAOOP. Update on lacrimal gland neoplasms: Molecular pathology of interest
USCAP 2012: Companion Meeting of the AAOOP Vancouver BC, Canada, March 17, 2012 Update on lacrimal gland neoplasms: Molecular pathology of interest Valerie A. White MD, MHSc, FRCPC Department of Pathology
More informationNOD-like receptor signaling and inflammasome-related pathways are highlighted in psoriatic epidermis
Supplementary Information NOD-like receptor signaling and inflammasome-related pathways are highlighted in psoriatic epidermis Mari H. Tervaniemi, Shintaro Katayama, Tiina Skoog, H. Annika Siitonen, Jyrki
More informationThe Genetics of Myoepithelial Tumors: salivary glands, soft tissue and bone
The Genetics of Myoepithelial Tumors: salivary glands, soft tissue and bone Cristina Antonescu, MD Memorial Sloan-Kettering Cancer Center, New York Nothing to declare Disclosure Spectrum of Myoepithelial
More informationDetermination of Genomic Imbalances by Genome-wide Screening Approaches
Overview Determination of Genomic Imbalances by Genome-wide Screening Approaches Károly Szuhai Introduction/Methodologies Applications/Results Conclusion Approaches Introduction/Methodologies Chromosome
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationSupplementary Figures
Supplementary Figures a miel1-2 (SALK_41369).1kb miel1-1 (SALK_978) b TUB MIEL1 Supplementary Figure 1. MIEL1 expression in miel1 mutant and S:MIEL1-MYC transgenic plants. (a) Mapping of the T-DNA insertion
More informationThe Pathology of Neoplasia Part II
The Pathology of Neoplasia Part II February 2018 PAUL BOGNER, MD A S S O C I A T E P R O F E S S O R O F O N C O L O G Y P A T H O L O G Y A N D D E R M A T O L O G Y Clinical goals of cancer pathology
More informationMyxo-inflammatory Fibroblastic sarcoma
AKA Myxo-inflammatory Fibroblastic sarcoma Acral Myxoinflammatory fibroblastic sarcomaam.j.surg.path1998; 22; 911-924 Inflammatory myxoid tumour of soft parts with bizarre giant cells [Pathol.Res.Pract.
More informationDesmoplastic Melanoma R/O BCC. Clinical Information. 74 y.o. man with lesion on left side of neck r/o BCC
R/O BCC Sabine Kohler, M.D. Professor of Pathology and Dermatology Dermatopathology Service Stanford University School of Medicine Clinical Information 74 y.o. man with lesion on left side of neck r/o
More informationSupplementary Tables. Supplementary Figures
Supplementary Files for Zehir, Benayed et al. Mutational Landscape of Metastatic Cancer Revealed from Prospective Clinical Sequencing of 10,000 Patients Supplementary Tables Supplementary Table 1: Sample
More informationUpdate On Lipomatous Tumors: Old Standbys and New Concepts
Update On Lipomatous Tumors: Old Standbys and New Concepts John R. Goldblum, M.D. Chairman, Department of Anatomic Pathology Cleveland Clinic Professor of Pathology Cleveland Clinic Lerner College of Medicine
More informationADx Bone Marrow Report. Patient Information Referring Physician Specimen Information
ADx Bone Marrow Report Patient Information Referring Physician Specimen Information Patient Name: Specimen: Bone Marrow Site: Left iliac Physician: Accession #: ID#: Reported: 08/19/2014 - CHRONIC MYELOGENOUS
More informationConflict of Interest 9/2/2014. Pathogenesis and Comparison of Atypical Spitz Nevi vs Benign Spitz, and Childhood Melanoma
Pathogenesis and Comparison of Atypical Spitz Nevi vs Benign Spitz, and Childhood Melanoma Martin C. Mihm Jr., M.D., F.A.C.P. Harvard Medical School Brigham and Women s Hospital Dana Farber Cancer Center
More informationCellular Neurothekeoma
Cellular Neurothekeoma Scott W Binder, MD Pritzker Professor of Pathology & Dermatology Sr. Vice Chair Director, Pathology Clinical Services Chief, Dermatopathology Geffen/UCLA School of Medicine Clinical
More informationCutaneous Mesenchymal Neoplasms with EWSR1 Rearrangement
Cutaneous Mesenchymal Neoplasms with EWSR1 Rearrangement By Konstantinos Linos MD, FCAP, FASDP Bone, Soft Tissue and Dermatopathology Assistant Professor of Pathology Dartmouth-Hitchcock Medical Center
More informationNature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity.
Supplementary Figure 1 HOX fusions enhance self-renewal capacity. Mouse bone marrow was transduced with a retrovirus carrying one of three HOX fusion genes or the empty mcherry reporter construct as described
More informationBRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information)
BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information) David Dankort, David P. Curley, Robert A. Cartlidge, Betsy Nelson, Anthony N. Karnezis,
More informationGermline mutation analysis in the CYLD gene in Chinese patients with multiple trichoepitheliomas
Germline mutation analysis in the CYLD gene in Chinese patients with multiple trichoepitheliomas Z.L. Li 1,2, H.H. Guan 3, X.M. Xiao 1,2, Y. Hui 3, W.X. Jia 1,2, R.X. Yu 1,2, H. Chen 1,2 and C.R. Li 1,2
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*
More informationNewer soft tissue entities
Newer soft tissue entities Examples among fibroblastic tumors Turku, May 6, 2010 Markku Miettinen, M.D. AFIP, Washington, DC Fibroblastic neoplasms Solitary fibrous tumor /Hemangiopericytoma Low-grade
More informationأملس عضلي غرن = Leiomyosarcoma. Leiomyosarcoma 1 / 5
Leiomyosarcoma 1 / 5 EPIDEMIOLOGY Exact incidence is unknown, but older studies suggest that leiomyosarcomas comprise approximately 3 percent of soft-tissue sarcomas. Superficial leiomyosarcoma occurs
More informationRASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays
Supplementary Materials RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Junhee Seok 1*, Weihong Xu 2, Ronald W. Davis 2, Wenzhong Xiao 2,3* 1 School of Electrical Engineering,
More informationCharacterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
More information