Table S1: Analysis of Notch gene rearrangements in triple negative breast cancer subtypes
|
|
|
- Peregrine Sydney Roberts
- 5 years ago
- Views:
Transcription
1 Supplemental Tables Table S1: Analysis of Notch gene rearrangements in triple negative breast cancer subtypes NOTCH1 or NOTCH2 Basal Immune Luminal AR Mesenchymal Stem Like WT 27 (87%) 24 (100%) 4 (66%) 5 (100%) Rearranged 4 (13%) 0 2 (33%) 0 Table S2: Genes whose expression correlates with Notch gene-rearrangement status in cancer cell lines Notch Gene wild type (N=603)* Notch-generearranged (N=6) STD_WT STD_GR p value HES E-14 HES E-10 PTCRA E-10 NOTCH E-06 DTX E-05 NOTCH E-05 PSEN *Average log10 expression; STD_WT and STD_GR, standard deviations of wild type and Notch gene-rearranged cell lines, respectively. 1 Stoeck et al
2 Table S3: Genes whose expression correlates with Notch gene-rearrangement in triple negative breast cancer Gene Notch wild type (N=207)* Notch-generearranged (N=13)* STD_WT STD_GR p value 'HES4' E-15 'HES5' E-09 'NRARP' E-07 'NOTCH1' E-06 'HEY2' E-05 'MYC' E-05 'HEY2' 'JAG1' 'HES1' *Average log10 expression; STD_WT and STD_GR, standard deviations of wild type and Notch gene-rearranged cell lines, respectively. 2 Stoeck et al
3 Table S4. Novel mutations identified in the NRR and PEST domains of NOTCH1 in solid tumors (N=4007). NRR, Negative Regulatory Region; PEST, PEST degron domain. Mutations in Breast and adenoid cystic carcinoma are highlighted in bold. H&N, head and neck; RCC, renal cell carcinoma. 3 Stoeck et al
4 Table S5: Notch NRR and PEST domain mutation frequency Cancer types Notch1 Notch2 Notch3 Tumors sequenced Mutation frequency Cutaneous SCC % Mantle cell lymphoma % Adenoid cystic carcinoma % Cervical carcinoma % Gastric carcinoma % Head-Neck SCC % Pancreatic carcinoma % Chronic lymphocytic leukemia % Glioblastoma, Astrocytoma % Endometrial carcinoma % Melanoma % Prostatic carcinoma % Ovarian serous carcinoma % Colonic carcinoma % Ovarian mucinous carcinoma % Triple negative breast carcinoma % SCC, squamous cell carcinoma 4 Stoeck et al
5 Table S6: NOTCH1 mutational status, N1-ICD levels, MYC expression in adenoid cystic carcinoma models ACC model NOTCH1 mutation* Exon Amino acid change Mutated region N1-ICD levels (% positive cells) MYC IHC (% positive cells) ACCX14 WT % 50% ACCX16 WT % 30-40% ACCX5M1 C3011T Exon 19 S1004L EGF domain 30% 60-70% ACCX6 WT % 80-90% ACCX9 T5039A Exon 27 I1680N NRR region 100% 90% POS-0912 G1094A Exon 6 R365H EGF domain 5% 20-30% *Numbers correspond to codons in the NOTCH1 coding sequence; WT, wild type. 5 Stoeck et al
6 Table S7: Primary antibodies and Catalog Numbers Antibody Cell Signaling Technologies Santa Cruz Abcam MYC 9402 p-rb 9307 N1-ICD 4147 p p-erk 4370 CLEAVED PARP 5625 Notch 1 sc-6014 GAPDH 5174 p-pras AKT 9272 β-actin ab8226 Table S8: RT-PCR Primers Gene Cat # CD24 Hs _s1 CD44 E-Cadherin N-Cadherin P-Cadherin DTX1 EGFR EPCAM FN1 FOXC1 Hs _m1 Hs _m1 Hs _m1 Hs _m1 Hs _m1 Hs _m1 Hs _m1 Hs _m1 Hs _s1 GAPDH GSC HES1 HES4 Hs _g1 Hs _m1 Hs _g1 6 Stoeck et al
7 HES5 HEY2 HEYL IL6 KRT14 KRT19 KRT8 MME MYC NOTCH1 NRARP PTCRA SHQ1 SMA4 SNAI1 SNAI2 SNAI3 SOX10 SPARC TGFB1 TP63 TWIST1 VIM ZEB1 Hs _g1 Hs _m1 Hs _m1 Hs _m1 Hs _m1 Hs _s1 Hs _g1 Hs _m1 Hs _m1 Hs _m1 Hs _s1 Hs _m1 Hs _m1 Hs _m1 Hs _m1 Hs _m1 Hs _m1 Hs _m1 Hs _m1 Hs _m1 Hs _m1 Hs _s1 Hs _m1 Hs _m1 7 Stoeck et al
OncoMir Library Cancer Type Target Gene
OncoMir Library Cancer Type Target Gene hsa-let-7a-1 Breast Cancer, Lung Cancer H RAS, HMGA2, CDK6, NRAS hsa-let-7a-2 Breast Cancer, Lung Cancer H RAS, HMGA2, CDK6, NRAS hsa-let-7a-3 Breast Cancer, Lung
Exploring TCGA Pan-Cancer Data at the UCSC Cancer Genomics Browser
Exploring TCGA Pan-Cancer Data at the UCSC Cancer Genomics Browser Melissa S. Cline 1*, Brian Craft 1, Teresa Swatloski 1, Mary Goldman 1, Singer Ma 1, David Haussler 1, Jingchun Zhu 1 1 Center for Biomolecular
The Cancer Genome Atlas Pan-cancer analysis Katherine A. Hoadley
The Cancer Genome Atlas Pan-cancer analysis Katherine A. Hoadley Department of Genetics Lineberger Comprehensive Cancer Center The University of North Carolina at Chapel Hill What is TCGA? The Cancer Genome
Hereditary Cancer Products
Hereditary Products Integrated BRACAnalysis (BRCA1 and BRCA2 sequencing and large rearrangement testing (BART)), covered when: PERSONAL HISTORY of Breast (must meet at least 1) Diagnosed
Applications of IHC. Determination of the primary site in metastatic tumors of unknown origin
Applications of IHC Determination of the primary site in metastatic tumors of unknown origin Classification of tumors that appear 'undifferentiated' by standard light microscopy Precise classification
A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications
A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications Yasuo Urata CEO and President Oncolys BioPharma Inc. February 16, 2013 Telomere Length is a Limiting Factor for Cell Replication
PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65
SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer
Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
FACULTY MEMBERSHIP APPLICATION Tulane Cancer Center
FACULTY MEMBERSHIP APPLICATION Tulane Cancer Center 1430 Tulane Ave., Box SL-68, New Orleans, LA 70112-2699 J. Bennett Johnston Building, Mezzanine (Floor 1A), Suite A102 (504) 988-6060, fax (504) 988-6077,
FGL2 A new biomarker for cancer in a simple blood test
FGL2 A new biomarker for cancer in a simple blood test WHO IS FGL2 Human gene (chromosome 7) is 7 kb long, 2 exons, monomer protein 70 KD, tetramer in solution. Fibrinogen-like protein 2 (Fgl2), a member
Diagnostic IHC in lung and pleura pathology
Diagnostic IHC in lung and pleura pathology Mogens Vyberg Professor of Clinical Pathology Director of NordiQC Aalborg University Hospital, Aalborg, Denmark WHO 2004 and Web Malignant mesothelioma Epithelioid
The Panel Approach to Diagnostics. Lauren Hopson International Product Specialist Cell Marque Corporation
The Panel Approach to Diagnostics Lauren Hopson International Product Specialist Cell Marque Corporation Cell Marque Rocklin, California About Cell Marque: IVD primary antibody manufacturer Distributors
Breast cancer: IHC classification. Mogens Vyberg Professor of Clinical Pathology Director of NordiQC Aalborg University Hospital, Aalborg, Denmark
Breast cancer: IHC classification Mogens Vyberg Professor of Clinical Pathology Director of NordiQC Aalborg University Hospital, Aalborg, Denmark http://upload.wikimedia.org/wikipedia/commons/1/1a/breast.svg
Recent advances in breast cancers
Recent advances in breast cancers Breast cancer is a hetrogenous disease due to distinct genetic alterations. Similar morphological subtypes show variation in clinical behaviour especially in response
Epigenetic inactivation of the CpG demethylase TET1 as a DNA
Epigenetic inactivation of the CpG demethylase TET1 as a DNA methylation feedback loop in human cancers Lili Li 1, Chen Li 1, Haitao Mao 1, Zhenfang Du 1, Wai Yee Chan 2, Paul Murray 3, Bing Luo 4, Anthony
Supplemental Figure S1A Notch1
Supplemental Figure S1A Notch1 erage) epth of Cove ormalized De Log1(No Notch exons Figure S1: A) Relative coverage of Notch1 and Notch 2 exons in HCC2218, HCC1187, MB157, MDA-MB157 cell lines. Blue color
Evolution of Pathology
1 Traditional pathology Molecular pathology 2 Evolution of Pathology Gross Pathology Cellular Pathology Morphologic Pathology Molecular/Predictive Pathology Antonio Benivieni (1443-1502): First autopsy
New Developments in Cancer Treatment. Ian Rabinowitz MD
New Developments in Cancer Treatment Ian Rabinowitz MD Treatment Outline Angiogenesis inhibition Targeted therapy Immunotherapy Personalization of therapy Genomics and cancer Stem cells and cancer Angiogenesis
Supplemental Information. High-Throughput Microfluidic Labyrinth for the. Label-free Isolation of Circulating Tumor Cells
Cell Systems, Volume 5 Supplemental Information High-Throughput Microfluidic Labyrinth for the Label-free Isolation of Circulating Tumor Cells Eric Lin, Lianette Rivera-Báez, Shamileh Fouladdel, Hyeun
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
6/22/2017 TARGETING THE TARGETS IN 2017 TARGETING THE TARGETS IN 2017
TARGETING THE TARGETS IN 2017 Primary Care Focus Symposium July 1, 2017 Grace Wang MD I do not have any relevant financial relationships to disclose at this time TARGETING THE TARGETS IN 2017 What are
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY NFORMATON n format provided by Melero et al. (AUGUST 2015) Supplementary nformation S3 Combinations including two or more immunotherapy agents based on PD-1/PD-L1 blockade. (Source: https://clinicaltrials.gov/
Myriad Financial Assistance Program (MFAP)
Myriad Financial Assistance Program (MFAP) MEDICAL CRITERIA Hereditary Cancer Products The Myriad Financial Assistance Program offers aid to patients who meet specific financial and medical requirements.
Out-Patient Billing CPT Codes
Out-Patient Billing CPT Codes Updated Date: August 3, 08 Client Billed Molecular Tests HPV DNA Tissue Testing 8764 No Medicare Billed - Molecular Tests NeoARRAY NeoARRAY SNP/Cytogenetic No 89 NeoLAB NeoLAB
List of Available TMAs in the PRN
TMA RPCI_BrainCa01 RPCI_BrCa03 RPCI_BrCa04 RPCI_BrCa05 RPCI_BrCa0 RPCI_BrCa07 RPCI_BrCa08 RPCI_BrCa15 RPCI_BrCa1 RPCI_BrCa17 RPCI_BrCa18 RPCI_BrCa19 RPCI_BrCa20 RPCI_BrCa21 RPCI_BrCa24 RPCI_BrCa25 RPCI_BrCa2
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
SUPPLEMENTARY INFORMATION
Supplementary Information S1 Class I PI3K isoform alterations in cancer Alteration Type Cancer Type Frequency of Alteration Sample Size Range Class IA PIK3CA (p110α) Mutation Endometrial 10.3-53.0% 29-232
Nordic Immunohistochemical Quality Control
Nordic Immunohistochemical Quality Control Immunohistochemistry in the classifiation of neoplasias of the alimentary tract & External Quality Assurance of Immunohistochemistry for GI cancer markers Mogens
Supplementary Table 1: Summary of 33 Patients Treated with Abemaciclib in Dose Escalation
Supplementary Table 1: Summary of 33 Patients Treated with Abemaciclib in Dose Escalation Cohort Dose and Frequency Age and Sex Tumor Type Number of Cycles Best Overall Response 4M Colorectal cancer -
SUPPLEMENTARY INFORMATION
doi:10.1038/nature15260 Supplementary Data 1: Gene expression in individual basal/stem, luminal, and luminal progenitor cells. Box plots show expression levels for each gene from the 49-gene differentiation
2018 ICD-O-3 Updates in Table Format with Annotation for Reference
Status Histology Description (this may be preferred term or a synonym) Report Comments New term 8010 3 Urachal carcinoma (C65.9, C66.9, C67._, C68._) New term 8013 3 Combined large cell neuroendocrine
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian
Checkpoint Regulators Cancer Immunotherapy takes centre stage. Dr Oliver Klein Department of Medical Oncology 02 May 2015
Checkpoint Regulators Cancer Immunotherapy takes centre stage Dr Oliver Klein Department of Medical Oncology 02 May 2015 Adjuvant chemotherapy improves outcome in early breast cancer FDA approval of Imatinib
Oncology 101. Cancer Basics
Oncology 101 Cancer Basics What Will You Learn? What is Cancer and How Does It Develop? Cancer Diagnosis and Staging Cancer Treatment What is Cancer? Cancer is a group of more than 100 different diseases
Nature Getetics: doi: /ng.3471
Supplementary Figure 1 Summary of exome sequencing data. ( a ) Exome tumor normal sample sizes for bladder cancer (BLCA), breast cancer (BRCA), carcinoid (CARC), chronic lymphocytic leukemia (CLLX), colorectal
KRAS: ONE ACTOR, MANY POTENTIAL ROLES IN DIAGNOSIS
UNIVERSITÀ DEGLI STUDI DI PALERMO Scuola di Specializzazione in Biochimica Clinica Direttore Prof. Marcello Ciaccio KRAS: ONE ACTOR, MANY POTENTIAL ROLES IN DIAGNOSIS Loredana Bruno KRAS gene Proto-oncogene
Molecular Imaging in the Development of Cancer Therapeutics. Johannes Czernin
Molecular Imaging in the Development of Cancer Therapeutics Johannes Czernin Ahmanson Biological Imaging Division University of California Los Angeles Cancer Statistics Cancer Type 5-year Survival Rate
Immunohistochemical classification of lung carcinomas and mesotheliomas. Prof. Mogens Vyberg NordiQC Institute of Pathology Aalborg, Denmark
Immunohistochemical classification of lung carcinomas and mesotheliomas Prof. Mogens Vyberg NordiQC Institute of Pathology Aalborg, Denmark Endobronchial ultrasound guided transbronchial needle biopsy
Present Role of Immunohistochemistry in the. Subtypes. Beppe Viale European Institute of Oncology University of Milan Milan-Italy
Present Role of Immunohistochemistry in the Classification of Molecular Subtypes Beppe Viale European Institute of Oncology University of Milan Milan-Italy We know it is many diseases Breast cancer is
Cell Cycle and Cancer
142 8. Cell Cycle and Cancer NOTES CELL CYCLE G 0 state o Resting cells may re-enter the cell cycle Nondividing cells (skeletal and cardiac muscle, neurons) o Have left the cell cycle and cannot undergo
The clinically challenging entity of liver metastasis from tumors of unknown primary
The clinically challenging entity of liver metastasis from tumors of unknown primary Xuchen Zhang, MD, PhD Associate Professor of Pathology Department of Pathology Yale University School of Medicine Liver
Objectives. Salivary Gland FNA: The Milan System. Role of Salivary Gland FNA 04/26/2018
Salivary Gland FNA: The Milan System Dr. Jennifer Brainard Section Head Cytopathology Cleveland Clinic Objectives Introduce the Milan System for reporting salivary gland cytopathology Define cytologic
WASHINGTON. Spokane Cheney. Olympia. Tri-Cities. Walla Walla. Portland North Central Oregon City OREGON. Mt. Vernon. Port Angeles
2 3 Mt. Vernon Port Angeles Bremerton Tacoma 5 5 Olympia Everett Edmonds Seattle 90 WASHINGTON 90 Spokane Cheney Pullman Longview 82 Tri-Cities Portland North Central Oregon City 5 84 OREGON Walla Walla
Primary Care Approach to Genetic Cancer Syndromes
Primary Care Approach to Genetic Cancer Syndromes Jason M. Goldman, MD, FACP FAU School of Medicine Syndromes Hereditary Breast and Ovarian Cancer (HBOC) Hereditary Nonpolyposis Colorectal Cancer (HNPCC)
Overview of the immunohistochemical and sequencing results from 35 non-paraganglionic tumors
Supplemental Figure 1. Overview of the immunohistochemical and sequencing results from 35 non-paraganglionic tumors arising in 26 SDH mutation carriers. Abbreviations Supplemental Figure 1: SDH: succinate
11/29/2017. Genetics and Cancer ERICA L SILVER, MS, LCGC GENETIC COUNSELOR. Genetics 101. Transcription vs Translation
Genetics and Cancer ERICA L SILVER, MS, LCGC GENETIC COUNSELOR Genetics 101 Transcription vs Translation 1 Carcinogenesis and Genetics Normal cell First mutation First mutation Second mutation Second mutation
Supplementary Methods: IGFBP7 Drives Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibition in Lung Cancer
S1 of S6 Supplementary Methods: IGFBP7 Drives Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibition in Lung Cancer Shang-Gin Wu, Tzu-Hua Chang, Meng-Feng Tsai, Yi-Nan Liu, Chia-Lang
Clinical Grade Genomic Profiling: The Time Has Come
Clinical Grade Genomic Profiling: The Time Has Come Gary Palmer, MD, JD, MBA, MPH Senior Vice President, Medical Affairs Foundation Medicine, Inc. Oct. 22, 2013 1 Why We Are Here A Shared Vision At Foundation
Genomic Analyses across Six Cancer Types Identify Basal-like Breast Cancer as a Unique Molecular Entity
Genomic Analyses across Six Cancer Types Identify Basal-like Breast Cancer as a Unique Molecular Entity Aleix Prat, Barbara Adamo, Cheng Fan, Vicente Peg, Maria Vidal, Patricia Galván, Ana Vivancos, Paolo
Cutaneous metastases. Thaddeus Mully. University of California, San Francisco Professor, Departments of Pathology and Dermatology
Cutaneous metastases Thaddeus Mully University of California, San Francisco Professor, Departments of Pathology and Dermatology DISCLOSURE OF RELATIONSHIPS WITH INDUSTRY Thaddeus Mully Course C005 Essential
Effective January 1, 2018 ICD O 3 codes, behaviors and terms are site specific
Effective January 1, 2018 codes, behaviors and terms are site specific /N 8551/3 Acinar adenocarcinoma (C34. _) Lung primaries diagnosed prior to 1/1/2018 use code 8550/3 For prostate (all years) see 8140/3
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells
10/15/2012. Biologic Subtypes of TNBC. Topics. Topics. Histopathology Molecular pathology Clinical relevance
Biologic Subtypes of TNBC Andrea L. Richardson M.D. Ph.D. Brigham and Women s Hospital Dana-Farber Cancer Institute Harvard Medical School Boston, MA Topics Histopathology Molecular pathology Clinical
Effective January 1, 2018 ICD O 3 codes, behaviors and terms are site specific
Effective January 1, 2018 codes, behaviors and terms are site specific Status /N 8010/3 Urachal carcinoma (C65.9, C66.9, C67. _, C68._) 8013/3 Combined large cell neuroendocrine carcinoma (C34. _, C37.9)
Test Bank for Robbins and Cotran Pathologic Basis of Disease 9th Edition by Kumar
Link full download: http://testbankair.com/download/test-bank-for-robbins-cotran-pathologic-basis-of-disease-9th-edition-bykumar-abbas-and-aster Test Bank for Robbins and Cotran Pathologic Basis of Disease
Review and Updates of Immunohistochemistry in Selected Salivary Gland and Head and Neck Tumors
Review and Updates of Immunohistochemistry in Selected Salivary Gland and Head and Neck Tumors. Monophasic tumors : myoepithelioma, acinic cell carcinoma, and salivary duct carcinoma. Biphasic tumors includes
Molecular classification of breast cancer implications for pathologists. Sarah E Pinder
Molecular classification of breast cancer implications for pathologists Sarah E Pinder Courtesy of CW Elston Histological types Breast Cancer Special Types 17 morphological special types 25-30% of all
Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3
Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in
MERCK ONCOLOGY OVERVIEW ASCO 2018 JUNE 4, 2018
MERCK ONCOLOGY OVERVIEW ASCO 218 JUNE 4, 218 Forward-Looking Statement of Merck & Co., Inc., Kenilworth, NJ, USA This presentation of Merck & Co., Inc., Kenilworth, N.J., USA (the company ) includes forward
CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing.
Supplementary Figure 1 CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Whole-exome sequencing of six plasmacytoid-variant bladder
Dr. Andres Wiernik. Lung Cancer
Dr. Andres Wiernik Lung Cancer Lung Cancer Facts - Demographics World Incidence: 1 8 million / year World Mortality: 1 6 million / year 5-year survival rates vary from 4 17% depending on stage and regional
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
Head and Neck Squamous Subtypes
1 Head and Neck Squamous Subtypes Adel K. El-Naggar, M.D., Ph.D. The University of Texas MD Anderson Cancer Center, Houston, Texas HNSCC 5 th -6 th most common cancer 400,000/year 50% mortality Considerable
Title: Single Cell Dual Adherent-Suspension Co-Culture Micro-Environment for Studying Tumor- Stromal Interactions
Electronic Supplementary Material (ESI) for Lab on a Chip. This journal is The Royal Society of Chemistry 2016 Title: Single Cell Dual Adherent-Suspension Co-Culture Micro-Environment for Studying Tumor-
performed to help sway the clinician in what the appropriate diagnosis is, which can substantially alter the treatment of management.
Hello, I am Maura Polansky at the University of Texas MD Anderson Cancer Center. I am a Physician Assistant in the Department of Gastrointestinal Medical Oncology and the Program Director for Physician
Contents 1 The Windows of Susceptibility to Breast Cancer 2 The So Called Pre-Neoplastic Lesions and Carcinoma In Situ
Contents 1 The Windows of Susceptibility to Breast Cancer... 1 1.1 Introduction... 1 1.2 Risk Factor and Etiological Agents... 2 1.3 The Concept of the Windows of Susceptibility to Carcinogenesis... 5
Targeted therapy & Tumor molecular profile. Anton Tikhonov V Bioinformatics Summer School, 2017
Targeted therapy & Tumor molecular profile Anton Tikhonov V Bioinformatics Summer School, 2017 What exactly is targeted therapy? It has target It was rationally designed Its target was discovered before
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
AP VP DLP H&E. p-akt DLP
A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy
Supplementary Online Content
Supplementary Online Content Chacón MR, Enrico DH, Burton J, Waisberg FD, Videla VM. Incidence of placebo adverse events in randomized clinical trials of targeted and immunotherapy cancer drugs in the
Current and future applications of Molecular Pathology. Kathy Walsh Clinical Scientist NHS Lothian
Current and future applications of Molecular Pathology Kathy Walsh Clinical Scientist NHS Lothian Molecular Pathology in Solid tumours Cancer type Genes tested Purpose Associated treatments Non small cell
Cell Polarity and Cancer
Cell Polarity and Cancer Pr Jean-Paul Borg Email: jean-paul.borg@inserm.fr Features of malignant cells Steps in Malignant Progression Cell polarity, cell adhesion, morphogenesis and tumorigenesis pathways
Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
Antitumor Activity of CUDC-305, a Novel Oral HSP90 Inhibitor, in Solid and Hematological Tumor Xenograft Models
Antitumor Activity of CUDC-5, a Novel Oral HSP Inhibitor, in Solid and Hematological Tumor Xenograft Models Rudi Bao, MD/PhD April 1, 2 AACR 1th Annual Meeting 2 Experimental and Molecular Therapeutics
Title Cancer Drug Phase Status
Clinical Trial Identifier Title Cancer Drug Phase Status NCT01164995 Study With Wee-1 Inhibitor MK-1775 and Carboplatin to Treat p53 Mutated Refractory and Resistant Ovarian Cancer Epithelial Ovarian Cancer
Management of BRCA Positive Breast Cancer. Archana Ganaraj, MD February 17, 2018 UPDATE ON WOMEN S HEALTH
Management of BRCA Positive Breast Cancer Archana Ganaraj, MD February 17, 2018 UPDATE ON WOMEN S HEALTH The number of American women who have lost their lives to breast cancer outstrips the total number
BRCAplus. genetic testing for hereditary breast cancer
BRCAplus genetic testing for hereditary breast cancer Developed in collaboration with Fox Chase Cancer Center and the Arcadia University Genetic Counseling Program. Causes of Hereditary Breast Cancer familial
Ovarian Clear Cell Carcinoma
Ovarian Clear Cell Carcinoma Rouba Ali-Fehmi, MD Professor of Pathology The Karmanos Cancer Institute, Wayne State University School of Medicine 50 year old woman with chief complaint of shortness of breath
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
Summary of Research and Writing Activities in Oncology
Summary of Research and Writing Activities in Oncology Carole Alison Chrvala, PhD 919.545.2149 (Work) 919.951.5230 (Mobile) cchrvala@centurylink.net www.healthmattersmedwriting.com 1 Manuscripts, Posters,
Fusion Analysis of Solid Tumors Reveals Novel Rearrangements in Breast Carcinomas
Fusion Analysis of Solid Tumors Reveals Novel Rearrangements in Breast Carcinomas Igor Astsaturov Philip Ellis Jeff Swensen Zoran Gatalica David Arguello Sandeep Reddy Wafik El-Deiry Disclaimers Dr. Igor
The Cancer Genome Atlas
The Cancer Genome Atlas July 14, 2011 Kenna M. Shaw, Ph.D. Deputy Director The Cancer Genome Atlas Program TCGA: Core Objectives Launched in 2006 as a pilot and expanded in 2009, the goals of TCGA are
One-two Punch to Deadly Pancreatic Cancer: Targeted Therapy with Mab AR9.6 and Rapamycin Analogue ACP Jan 2016
One-two Punch to Deadly Pancreatic Cancer: Targeted Therapy with Mab AR9.6 and Rapamycin Analogue ACP 2127 Jan 2016 AmrutBio Overview A subsidiary of Quest PharmaTech, a publicly traded (QPT-TSXV), Canadian
Merck Oncology Overview. The Development of MSI-H Cancer Therapy. Development of Anti-Cancer Drugs Forum Tokyo, Japan, 18, February 2017
Merck Oncology Overview The Development of MSI-H Cancer Therapy Development of Anti-Cancer Drugs Forum Tokyo, Japan, 18, February 217 Andrew Joe, MD Executive Director, Late Stage Oncology Merck & Co.,
NOSCAN CLINICAL MANAGEMENT GUIDELINE (CMG) AND NOSCAN CHEMOTHERAPY REVIEW (NCR) STATUS DOCUMENT May Status (G / A / R) Status (G / A / R)
Item 18-13c NOSCAN CLINICAL MANAGEMENT GUIDELINE (CMG) AND NOSCAN CHEMOTHERAPY REVIEW (NCR) STATUS DOCUMENT May 2013 BREAST CANCER MCN: Breast Disease: Breast Document ready to circulate lead to be discussed
Kinome Profiling: The Potential in ER-Negative Patients. Charles M. Perou, Ph.D. Departments of Genetics and Pathology
Kinome Profiling: The Potential in ER-Negative Patients Charles M. Perou, Ph.D. Departments of Genetics and Pathology Lineberger Comprehensive Cancer Center University of North Carolina Chapel Hill, North
Supplemental Information. Integrated Genomic Analysis of the Ubiquitin. Pathway across Cancer Types
Cell Reports, Volume 23 Supplemental Information Integrated Genomic Analysis of the Ubiquitin Pathway across Zhongqi Ge, Jake S. Leighton, Yumeng Wang, Xinxin Peng, Zhongyuan Chen, Hu Chen, Yutong Sun,
CentoCancer STRIVE FOR THE MOST COMPLETE INFORMATION
CentoCancer STRIVE FOR THE MOST COMPLETE INFORMATION CentoCancer our most comprehensive oncogenetics panel for hereditary mutations Hereditary pathogenic variants confer an increased risk of developing
Salivary Gland Cytology
Salivary Gland Cytology Diagnostic challenges and potential pitfalls Tarik M. Elsheikh, MD Professor and Medical Director Anatomic Pathology Cleveland Clinic FNA Salivary Gland Lesions Indications Distinguish
Test Bank for Robbins and Cotran Pathologic Basis of Disease 9th Edition by Kumar
Link full download:https://getbooksolutions.com/download/test-bank-for-robbinsand-cotran-pathologic-basis-of-disease-9th-edition-by-kumar Test Bank for Robbins and Cotran Pathologic Basis of Disease 9th
Development status of OPDIVO (nivolumab) 1
August 1, 2018 Development status of OPDIVO (nivolumab) 1 Target disease JAPAN US/EU KR/TW Melanoma (1 st ) Approved Approved Approved Melanoma (Adjuvant Therapy) Filing Approved (US) Non-small cell lung
Diagnostic test Suggested website label Description Hospitals available
Diagnostic test Suggested website label Description Hospitals available Abbott Molecular Inc, PATHVYSION HER-2 DNA Probe Kit (FISH) PathVysion kit A diagnostic tool used to determine whether a particular
Nature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Finite-element analysis of cell cluster dynamics in different cluster trap architectures. (a) Cluster-Chip (b) Filter (c) A structure identical to the Cluster-Chip except that one
Importancia del patólogo en los tumores de origen desconocido
Importancia del patólogo en los tumores de origen desconocido Dr. Federico Rojo Fundación Jiménez Díaz, Madrid IMIM-Hospital del Mar, Barcelona Cancer unknown primary 3-5 % of diagnosed cancers Variability
High grade triple negative breast cancers. Gary Tse Department of Anatomical and Cellular Pathology Prince of Wales Hospital Hong Kong
High grade triple negative breast cancers Gary Tse Department of Anatomical and Cellular Pathology Prince of Wales Hospital Hong Kong TNBC Heterogeneous group IDC NST high grade Metaplastic carcinoma
Qué hemos aprendido hasta hoy? What have we learned so far?
Qué hemos aprendido hasta hoy? What have we learned so far? Luís Costa Hospital de Santa Maria & Instituto de Medicina Molecular Faculdade de Medicina de Lisboa Disclosures Research Grants: Amgen; Novartis;
Molecular. Oncology & Pathology. Diagnostic, Prognostic, Therapeutic, and Predisposition Tests in Precision Medicine. Liquid Biopsy.
Molecular Oncology & Pathology Hereditary Cancer Somatic Cancer Liquid Biopsy Next-Gen Sequencing qpcr Sanger Sequencing Diagnostic, Prognostic, Therapeutic, and Predisposition Tests in Precision Medicine
USCAP 2012: Companion Meeting of the AAOOP. Update on lacrimal gland neoplasms: Molecular pathology of interest
USCAP 2012: Companion Meeting of the AAOOP Vancouver BC, Canada, March 17, 2012 Update on lacrimal gland neoplasms: Molecular pathology of interest Valerie A. White MD, MHSc, FRCPC Department of Pathology
Commissioning policies agreed by PCTs in Yorkshire and the Humber at Board meeting of YH SCG on December
Commissioning policies agreed by PCTs in Yorkshire and the Humber at Board meeting of YH SCG on December 17 2010. 32/10 Imatinib for gastrointestinal stromal tumours (unresectable/metastatic) (update on