mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions
|
|
|
- Shon York
- 5 years ago
- Views:
Transcription
1 Supplementary Information mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions Shyuichiro Matsubara 1, Qiang Ding 1, Yumi Miyazaki 1, Taisaku Kuwahata 2, Koichiro Tsukasa 1 and Sonshin Takao 1 1 Cancer and Regenerative Medicine, Frontier Biomedical Science and Swine Research Center, 2 Department of Digestive Surgery, Kagoshima University Graduate School of Medical and Dental Sciences , Sakuragaoka, Kagoshima, , Japan
2 Supplementary Figure S1. FACS analysis of Capan-1M9 cells (untreated cells).
3 Gated cells (%) Gated cells (%) Gated cells (%) Gated cells (%) S phase a b CD133+ CD133- GEM G -G 1 phase CD133+ CD133- Apoptosis CD133+ CD133- GEM GEM Supplementary Figure S2. CD133 + cells from the pancreatic cancer cell line Capan-1 show cancer stem cell-like properties. (a) The tumorigenicity of CD133 + and CD133 cells in NOD/SCID mice. (b) Comparison of the distribution of CD133 + and CD133 cells in the G/G1 phase and the S phase. Apoptosis was also analyzed by the BrdU assay after gemcitabine (GEM) treatment ( ng/ml). (c) Gemcitabine treatment ( ng/ml) increases the percentage of CD133 + cells in Capan-1.
4 CD133 + cell content (% control) Supplementary figure S2 c Gemcitabine treatment (hr)
5 Cell viability (MTT A 57, % control) Cell viability (MTT A 57, % control) CD133 + cell content (% control) CD133 + cell content (% control) mm XVA939 (Wnt pathway inhibitor) mm GSI (g-secretase inhibitor) IX (Notch pathway inhibitor) Supplementary Figure S3. Inhibition of Wnt or Notch did not significantly affect either the percentage of CD133 + cells or the viability of Capan-1M9 cells. The effects of the Wnt pathway inhibitor XVA939 and the Notch inhibitor GSI IX on CD133 + cell percentage and cell viability were determined and presented as Figure 1 (a).
6 (kda) * CD133 b-actin Anti-CD133 Anti-b-actin Supplementary Figure S4. Full size blots of the immunoblot detection shown in Figure 2a.
7 a b c d (kda) (kda) 4E-BP P85 S6k P7 S6k 4E-BP1 * phospho-4e-bp1 (T37/46) Total 4E-BP1 phospho-s6 kinase (T389) total S6 kinase Supplementary Figure S5. Full size blots of the immunoblot detection shown in Figure 6. * indicates non-specific bands. The same filters were used several times with different antibodies, therefore the signal in the previous detection was appeared in (c), (d), (e), (f) and (k).
8 Supplementary figure S5 (continued) e f g h i (kda) (kda) 2 2 Akt Erk 1/2 S6 * Akt E-BP phospho-s6 (S24/S244) total S6 phospho-akt (T38) phospho-akt (S473) total Akt
9 Supplementary figure S5 (continued) j k (kda) 2 Akt Erk 1/ phospho-erk 1/2 (T24) Total Erk 1/2
10 Number of spheres Cell viability (MTT A 57, % control) Cell viability (MTT A 57, % control) a b nm inhibitors 1 nm KU (mtorc1 & mtorc2 inhibitor) c everolimus KU Supplementary Figure S6. mtorc1/mtorc2 dual inhibitor KU reduces the cell viability and sphere formation of Capan-1M9 cells but the inhibition kinetics is different from. Rapamycin and its derivatives directly inhibit mtorc1 and their effects on mtorc2 assembly are reported in some cell lines. (a) Effects of (closed circle) and everolimus (open circle) and (b) of KU (closed triangle) on cell viability were determined and presented as Figure 1 (a). (c) Effects of, everolimus and KU on sphere formation were determined and presented as Figure 2 (e).
11 CD133 + cell content (% total cells) body weight (g) a b treatment c vehicle 1 mg/kg/day 5 mg/kg/day NS days after transplantation 2 NS NS 1 Supplementary Figure S7. Effect of on the xenografted Capan-1M9 tumor in nude mice. (a) Xenograft tumors with treatment were smaller than those with controls in nude mice. (b) Body weight of nude mice were not significantly different among the three treatments, vehicle (open circle), 1 mg/kg/day (closed circle), or 5 mg/kg/day (closed triangle). (c) The flow cytometric analysis of xenograft cells after enzyme dissociation. NS P >.5.
12 p11 GF apotosis actin cytoskeleton ROS ACL SOS RTK IRS p85 PI3K Pten Akt P Akt is activated by Feedback loop. P S6kinase mtor S6 P Translation 4E-BP1 P Canonical signal downstream of mtor (mtorc1) is blocked by Rapamycin. Ribosome production mrna translation (protein synthesis) HIF-1 PGC-1 PPARg Supplementary Figure S8. Signaling output from the PI3K/Akt/mTOR pathway after treatment.
P ancreatic cancer is a lethal disease because current chemotherapies such as gemcitabine provide negligible
OPEN SUBJECT AREAS: GROWTH SIGNALLING PANCREATIC CANCER TARGETED THERAPIES CANCER STEM CELLS mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions Shyuichiro
Efficient elimination of pancreatic cancer stem cells by hedgehog/gli inhibitor GANT61 in combination with mtor inhibition
Miyazaki et al. Molecular Cancer (2016) 15:49 DOI 10.1186/s12943-016-0534-2 RESEARCH Open Access Efficient elimination of pancreatic cancer stem cells by hedgehog/gli inhibitor GANT61 in combination with
Supplementary Material
Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC
A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive
Supplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/271/ra25/dc1 Supplementary Materials for Phosphoproteomic Analysis Implicates the mtorc2-foxo1 Axis in VEGF Signaling and Feedback Activation of Receptor Tyrosine
Plasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent
Title page. Title: MicroRNA-155 Controls Exosome Synthesis and Promotes Gemcitabine Resistance in
Title page Title: MicroRNA- Controls Synthesis and Promotes Gemcitabine Resistance in Pancreatic Ductal Adenocarcinoma Authors Manabu Mikamori, Daisaku Yamada, Hidetoshi Eguchi, Shinichiro Hasegawa, Tomoya
Appendix Figure S1 A B C D E F G H
ppendix Figure S1 C D E F G H ppendix Figure S1. RT and chemotherapy alter PD-L1 expression in PDC cells. Flow cytometric analysis of PD-L1 expression in () KPC and () Pan02 cells following treatment with
AACR 101st Annual Meeting 2010, Washington D.C. Experimental and Molecular Therapeutics Section 29; Abstract #3855
Investigation of the Growth Inhibitory Activity of the MEK Inhibitor ARRY-162 in Combination with Everolimus in a Variety of KRas and PI3K Pathway Mutant Cancers Brian Tunquist, Tyler Risom, Debbie Anderson,
Signal Transduction Pathway Smorgasbord
Molecular Cell Biology Lecture. Oct 28, 2014 Signal Transduction Pathway Smorgasbord Ron Bose, MD PhD Biochemistry and Molecular Cell Biology Programs Washington University School of Medicine Outline 1.
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan
Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors
Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
gliomas. Fetal brain expected who each low-
Supplementary Figure S1. Grade-specificity aberrant expression of HOXA genes in gliomas. (A) Representative RT-PCR analyses of HOXA gene expression in human astrocytomas. Exemplified glioma samples include
Trehalose, sucrose and raffinose are novel activators of autophagy in human. keratinocytes through an mtor-independent pathway
Title page Trehalose, sucrose and raffinose are novel activators of autophagy in human keratinocytes through an mtor-independent pathway Xu Chen 1*, Min Li 1*, Li Li 1, Song Xu 1, Dan Huang 1, Mei Ju 1,
Rationale Design of Combination Therapy in Prostate Cancer: Targeting the AR and PI3K pathways
Rationale Design of Combination Therapy in Prostate Cancer: Targeting the AR and PI3K pathways Brett S Carver, MD Assistant Attending, Department of Surgery/Urology Prostate Cancer Therapeutics: A Changed
William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin
Molecular Cell, Volume 45 Supplemental Information p85 SH2 Domain Phosphorylation by IKK Promotes Feedback Inhibition of PI3K and Akt in Response to Cellular Starvation William C. Comb, Jessica E. Hutti,
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating
Tbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
Supplementary Materials and Methods
Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis
Supplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
MANTLE CELL LYMPHOMA MTOR-INHIBITION
MANTLE CELL LYMPHOMA MTOR-INHIBITION Rome, 23. March 2017 Prof. Dr. med. Georg Heß III. Med. Klinik Universitäres Centrum für Tumorerkrankungen Universitätsmedizin der Johannes Gutenberg-Universität Mainz
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
NOTCH1 promotes T cell leukemia-initiating activity by RUNXmediated. regulation of PKC-θ and reactive oxygen species
NOTCH1 promotes T cell leukemia-initiating activity by RUNXmediated regulation of PKC-θ and reactive oxygen species Vincenzo Giambra, Christopher R. Jenkins, Hongfang Wang, Sonya Lam, Olena O. Shevchuk,
TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer
AD Award Number: TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Linda A. degraffenried, PhD CONTRACTING ORGANIZATION: University
A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy se
A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy serves as a defence mechanism that prevents or retards
mtor e le altre vie di trasduzione del segnale: Implicazioni cliniche Giampaolo Tortora
mtor e le altre vie di trasduzione del segnale: Implicazioni cliniche Giampaolo Tortora Cattedra di Oncologia Medica UOC Oncologia Medica du Facoltà di Medicina e Chirurgia e Azienda Ospedaliera Universitaria
Nature Genetics: doi: /ng Supplementary Figure 1. Phenotypic characterization of MES- and ADRN-type cells.
Supplementary Figure 1 Phenotypic characterization of MES- and ADRN-type cells. (a) Bright-field images showing cellular morphology of MES-type (691-MES, 700-MES, 717-MES) and ADRN-type (691-ADRN, 700-
TITLE: Overcoming Resistance to Inhibitors of the Akt Protein Kinase by Modulation of the Pim Kinase Pathway
AWARD NUMBER: W81XWH-12-1-0560 TITLE: Overcoming Resistance to Inhibitors of the Akt Protein Kinase by Modulation of the Pim Kinase Pathway PRINCIPAL INVESTIGATOR: Andrew S. Kraft, MD CONTRACTING ORGANIZATION:
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
The PI3K/AKT axis. Dr. Lucio Crinò Medical Oncology Division Azienda Ospedaliera-Perugia. Introduction
The PI3K/AKT axis Dr. Lucio Crinò Medical Oncology Division Azienda Ospedaliera-Perugia Introduction Phosphoinositide 3-kinase (PI3K) pathway are a family of lipid kinases discovered in 1980s. They have
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/430/ra57/dc1 Supplementary Materials for The 4E-BP eif4e axis promotes rapamycinsensitive growth and proliferation in lymphocytes Lomon So, Jongdae Lee, Miguel
Contents. Preface XV Acknowledgments XXI List of Abbreviations XXIII About the Companion Website XXIX
Contents Preface XV Acknowledgments XXI List of Abbreviations XXIII About the Companion Website XXIX 1 General Aspects of Signal Transduction and Cancer Therapy 1 1.1 General Principles of Signal Transduction
Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with
Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with Coomassie brilliant blue. One µg/ml recombinant human (rh) apo-e
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
Regulation of the IGF axis by TGF-b during periosteal chondrogenesis: implications for articular cartilage repair
Regulation of the IGF axis by TGF-b during periosteal chondrogenesis: implications for articular cartilage repair Chapter 04 Boek 1_Gie.indb 55 21-05-2007 12:27:33 Chapter 04 Abstract Goal: TGF-b and IGF-I
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences
Supplementary Figure 1: Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points
A. B. 8 4 Supplementary Figure : Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points Examined. A) Venn diagram analysis of kinases significantly
Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al
Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al Suppl. Fig. 1 Tissue DN C Proteins kd TSC1-17 TSC 1 loxp bp -48-285 ctin PEMs Neutrophils
Revolutionizing the Treatment of Cancer
Revolutionizing the Treatment of Cancer March 2014 Safe Harbor Statement The statements that follow (including projections and business trends) are forward-looking statements. Rexahn's actual results may
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao
Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods
Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
Antitumor activity of the ERK inhibitor SCH against BRAF mutant, NRAS mutant and wild-type melanoma
Wong et al. Molecular Cancer 2014, 13:194 RESEARCH Open Access Antitumor activity of the ERK inhibitor SCH722984 against BRAF mutant, NRAS mutant and wild-type melanoma Deborah JL Wong 1, Lidia Robert
Targeting the PIM protein kinases for the treatment of a T-cell acute lymphoblastic leukemia subset
Targeting the PIM protein kinases for the treatment of a T-cell acute lymphoblastic leukemia subset The Harvard community has made this article openly available. Please share how this access benefits you.
Supplemental Figure S1A Notch1
Supplemental Figure S1A Notch1 erage) epth of Cove ormalized De Log1(No Notch exons Figure S1: A) Relative coverage of Notch1 and Notch 2 exons in HCC2218, HCC1187, MB157, MDA-MB157 cell lines. Blue color
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
Endothelial PGC 1 - α 1 mediates vascular dysfunction in diabetes
Endothelial PGC-1α mediates vascular dysfunction in diabetes Reporter: Yaqi Zhou Date: 04/14/2014 Outline I. Introduction II. Research route & Results III. Summary Diabetes the Epidemic of the 21st Century
Marine Streptomyces sp. derived antimycin analogues. suppress HeLa cells via depletion HPV E6/E7 mediated by
Marine Streptomyces sp. derived antimycin analogues suppress HeLa cells via depletion HPV E6/E7 mediated by ROS-dependent ubiquitin proteasome system Weiyi Zhang 1, +, Qian Che 1, 2, +, Hongsheng Tan 1,
Introduction: 年 Fas signal-mediated apoptosis. PI3K/Akt
Fas-ligand (CD95-L; Fas-L) Fas (CD95) Fas (apoptosis) 年 了 不 度 Fas Fas-L 力 不 Fas/Fas-L T IL-10Fas/Fas-L 不 年 Fas signal-mediated apoptosis 度降 不 不 力 U-118, HeLa, A549, Huh-7 MCF-7, HepG2. PI3K/Akt FasPI3K/Akt
Enzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors
Enzyme-coupled Receptors Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Cell-surface receptors allow a flow of ions across the plasma
Methylseleninic Acid Elevates REDD1 and Inhibits Prostate Cancer Cell Growth Despite AKT Activation and mtor Dysregulation in Hypoxia
Touro College and University System Touro Scholar NYMC Faculty Publications Faculty 2-7-2014 Methylseleninic Acid Elevates REDD1 and Inhibits Prostate Cancer Cell Growth Despite AKT Activation and mtor
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-14-1-0505 TITLE: Targeting the Neural Microenvironment in Prostate Cancer PRINCIPAL INVESTIGATOR: Michael Ittmann MD PhD CONTRACTING ORGANIZATION: BAYLOR COLLEGE OF MEDICINE HOUSTON,
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
Resistance to anti-her2 therapies. Service d Oncologie Médicale
Resistance to anti-her2 therapies Pr David Khayat Service d Oncologie Médicale Groupe Hospitalier Pitié Salpêtrière -Paris Disclosure statment Trastuzumab in HER2+ MBC A major impact but resistance will
Supplementary Figures
Supplementary Figures Figure S1. Validation of kinase regulators of ONC201 sensitivity. Validation and screen results for changes in cell viability associated with the combination of ONC201 treatment (1
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
Mitotic Raptor Promotes mtorc1 Activity, G 2 /M Cell Cycle Progression, and Internal Ribosome Entry Site-Mediated mrna Translation
MOLECULAR AND CELLULAR BIOLOGY, July 2010, p. 3151 3164 Vol. 30, No. 13 0270-7306/10/$12.00 doi:10.1128/mcb.00322-09 Copyright 2010, American Society for Microbiology. All Rights Reserved. Mitotic Raptor
La via del segnale PI3K/AKT/mTOR Inibitori di mtor nel carcinoma mammario
La via del segnale PI3K/AKT/mTOR Inibitori di mtor nel carcinoma mammario Alessandra Modena U.O.C. Oncologia Medica Direttore: Dott.ssa Stefania Gori Ospedale Sacro Cuore - Don Calabria 29 novembre 2016
Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization
Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
ras Multikinase Inhibitor Multikinase Inhibitor 0.1
a ras ** * ** * ** ** ** ** un in et m lu Se ib SL G 32 W 7 So 50 ra 74 fe ni b LY W 294 or 0 tm 02 R an ap n a in Ev my er cin ol im BE us Z2 3 En P 5 za I13 st 0 au rin D as SP ati 60 nib C 012 is 5
The role of Hepatitis C Virus in hepatocarcinogenesis
The role of Hepatitis C Virus in hepatocarcinogenesis Laura Beretta Fred Hutchinson Cancer Research Center l8 Incidence and mortality of the five most common cancers worldwide, 2000 Incidence Lung Breast
Supplemental Materials. Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in. Pancreatic Cancer.
Supplemental Materials Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in Pancreatic Cancer Jun Zhao 1, Zhilan Xiao 2, 3, Tingting Li 1, 4, Huiqin Chen 5, Ying Yuan 5, Alan
TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge
a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the
Combined targeting of mtor and c-met signaling pathways for effective management of epithelioid sarcoma
Imura et al. Molecular Cancer 2014, 13:185 RESEARCH Open Access Combined targeting of mtor and c-met signaling pathways for effective management of epithelioid sarcoma Yoshinori Imura 1, Hirohiko Yasui
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3311 A B TSC2 -/- MEFs C Rapa Hours WCL 0 6 12 24 36 pakt.s473 AKT ps6k S6K CM IGF-1 Recipient WCL - + - + - + pigf-1r IGF-1R pakt ps6 AKT D 1 st SILAC 2 nd SILAC E GAPDH FGF21 ALKPGVIQILGVK
Supplementary Information
Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6
Ketone Bodies and Signaling in Pancreatic Cancer Cell Lines
University of Nebraska at Omaha DigitalCommons@UNO Theses/Capstones/Creative Projects University Honors Program 5-2018 Ketone Bodies and Signaling in Pancreatic Cancer Cell Lines Kyla B. Buettner University
ABSTRACT INTRODUCTION. Kalin Narov 1,*, Jian Yang 1,*, Paulina Samsel 1, Ashley Jones 1, Julian R. Sampson 1, Ming Hong Shen 1
/, Advance Publications 2017 The dual PI3K/mTOR inhibitor GSK2126458 is effective for treating solid renal tumours in Tsc2 +/- mice through suppression of cell proliferation and induction of apoptosis
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
Targeting the Notch Pathway: Killing Cancer Stem Cells
Targeting the Notch Pathway: Killing Cancer Stem Cells 1 Celeste Alverez Frontiers of Chemistry January 2, 2016 Outline 2 Background Cancer Stem Cells The Notch Pathway Targeting agents Drugs Antibodies
mtorc2 controls actin polymerization required for consolidation of long-term memory
CORRECTION NOTICE Nat. Neurosci.; doi:1.138/nn.3351 mtorc2 controls actin polymerization required for consolidation of long-term memory Wei Huang, Ping Jun Zhu, Shixing Zhang, Hongyi Zhou, Loredana Stoica,
RayBio KinaseSTAR TM Akt Activity Assay Kit
Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll
ABSTRACT INTRODUCTION. Ulises D. Orlando 1,*, Ana F. Castillo 1,*, Melina A. Dattilo 1, Angela R. Solano 1, Paula M. Maloberti 1, Ernesto J.
/, Vol. 6, No. 40 Acyl-CoA synthetase-4, a new regulator of mtor and a potential therapeutic target for enhanced estrogen receptor function in receptor-positive and -negative breast cancer Ulises D. Orlando
Cell cycle-dependent activity of the novel dual PI3K-MTORC1/2 inhibitor NVP-BGT226 in acute leukemia
Kampa-Schittenhelm et al. Molecular Cancer 2013, 12:46 RESEARCH Open Access Cell cycle-dependent activity of the novel dual PI3K-MTORC1/2 inhibitor NVP-BGT226 in acute leukemia Kerstin Maria Kampa-Schittenhelm
Mechanisms of Calorie Restriction- Mediated Inhibition of Epithelial Carcinogenesis: Identifying Targets for Cancer Prevention
Mechanisms of Calorie Restriction- Mediated Inhibition of Epithelial Carcinogenesis: Identifying Targets for Cancer Prevention John DiGiovanni, Ph.D. Professor and Coulter R. Sublett Endowed Chair Division
SUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.
WNT5A enhances resistance of melanoma cells to targeted BRAF inhibitors
Research article WNT5A enhances resistance of melanoma cells to targeted BRAF inhibitors Jamie N. Anastas, 1,2 Rima M. Kulikauskas, 3 Tigist Tamir, 4 Helen Rizos, 5 Georgina V. Long, 5 Erika M. von Euw,
W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +
F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses
18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
The mir-199a/brm/egr1 axis is a determinant of anchorage-independent growth in epithelial tumor cell lines
Supplementary information Supplementary Figure -9 Supplementary Table -4 The mir-99a/brm/egr axis is a determinant of anchorage-independent growth in epithelial tumor cell lines Kazuyoshi Kobayashi, Kouhei
Award Number: W81XWH TITLE: Synthetic Lethal Gene for PTEN as a Therapeutic Target. PRINCIPAL INVESTIGATOR: Kounosuke Watabe, Ph.D.
AD Award Number: W81XWH-12-1-0151 TITLE: Synthetic Lethal Gene for PTEN as a Therapeutic Target PRINCIPAL INVESTIGATOR: Kounosuke Watabe, Ph.D. CONTRACTING ORGANIZATION: University of Mississippi Medical
Mighty RapaLink-1 vanquishes undruggable mutant mtor in glioblastoma
Editorial Mighty RapaLink-1 vanquishes undruggable mutant mtor in glioblastoma Meena Jhanwar-Uniyal Department of Neurosurgery, New York Medical College, Valhalla, New York, USA Correspondence to: Meena
PREP Course # 2 Optimizing Poster Presentations. Presented by: Bettie M. Steinberg, PhD Chief Scientific Officer
PREP Course # Optimizing Poster Presentations Presented by: Bettie M. Steinberg, PhD Chief Scientific Officer CME Disclosure Statement The North Shore LIJ Health System adheres to the ACCME s new Standards
TITLE: A Genetically Engineered Mouse Model of Neuroblastoma Driven by Mutated ALK and MYCN
AWARD NUMBER: W81XWH-13-1-0220 TITLE: A Genetically Engineered Mouse Model of Neuroblastoma Driven by Mutated ALK and MYCN PRINCIPAL INVESTIGATOR: Rani E. George, MD, PhD CONTRACTING ORGANIZATION: Dana-Farber
CD133 facilitates epithelial-mesenchymal transition through interaction with the ERK pathway in pancreatic cancer metastasis
Ding et al. Molecular Cancer 2014, 13:15 RESEARCH Open Access CD133 facilitates epithelial-mesenchymal transition through interaction with the ERK pathway in pancreatic cancer metastasis Qiang Ding 1,
BIO360 Fall 2013 Quiz 1
BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.
Supplementary Figure 1
Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1
Diabetes Mellitus and Breast Cancer
Masur K, Thévenod F, Zänker KS (eds): Diabetes and Cancer. Epidemiological Evidence and Molecular Links. Front Diabetes. Basel, Karger, 2008, vol 19, pp 97 113 Diabetes Mellitus and Breast Cancer Ido Wolf
Supplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by