fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
|
|
|
- Louise Tucker
- 5 years ago
- Views:
Transcription
1 KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set enrichment analysis (GSEA) with a false discovery rate (FDR) cut-off of 5%. The set-to-set diagram was created via GSEA leading edge analysis and indicates overlap between the significantly enriched gene-sets. (b) Heatmap of the most significantly enriched genes (leading edge genes) from (a) with a FDR below Z-scores are indicated.
2 Supplementary Figure 2. Histology of Atg5-deficient KRas G12D -driven lung tumors. (a-c) Histological lung sections of KRas;Atg5 fl/+ and KRas;Atg5 fl/fl littermate mice (a) 6 wks, (b) 12 wks and (c) 18 wks after AdCre inhalation. Representative lung images are shown for each genotype at the indicated time points. Insets show typical lung lesions. Scale bars, 2mm for whole lung section; 50 µm for insets.
3 Supplementary Figure S3. Requirement for Atg5 in KRas G12D -driven tumor progression. (a) Logistic growth models, (t)= of 1/(1+exp( rt),of lung tumor proportions, (t), in lungs of KRas;Atg5 fl/+ and KRas;Atg5 fl/fl littermate mice. Mean tumor-tolung area ratios are indicated for individual KRas;Atg5 fl/+ (red) and KRas;Atg5 fl/fl (blue) mice at the indicated time points following AdCre inhalations. Logistic tumor growth curves were inferred for KRas;Atg5 fl/+ (red line) and KRas;Atg5 fl/fl (blue line) mice by applying a Bayesian Markov Chain Monte Carlo approach. (b) Box blots showing the Bayesian posterior parameter distributions of limit proportions, and maximum growth rates, r, of lung tumors in KRas;Atg5 fl/+ and KRas;Atg5 fl/fl littermate mice. The limit proportion of tumor cells for the KRas;Atg5 fl/fl mice is around 40% and thus significantly smaller than the 55% proportion of tumor cells reached in KRas;Atg5 fl/+ controls. At the same time we also find that KRas;Atg5 fl/+ tumors show a significantly slower maximum growth rate, which explains why they reach the stationarity phase later than KRas;Atg5 fl/fl lung tumors. The central horizontal line of each box represents the median. The edges of the boxes are the 25th and 75th percentiles. The whiskers extend to the most extreme data points not considered outliers. Outliers are plotted individually. n=at least 4 mice per genotype.
4 Supplementary Figure 4. Impaired proliferation and enhanced sensescence of Atg5 mutant lung tumor cells. (a) Representative immunohistochemisty and quantitative assessment of the proliferation marker Ki67 in lung tumors from KRas;Atg5 fl/+ and KRas;Atg5 fl/fl littermates 6 wks after AdCre inhalation. Data are shown as mean percentages (±SEM) of positive cells per total tumor cell numbers. Of note, only cells inside the tumors were counted. At least 6 mice per genotype and time point were analyzed. Scale bars, 50µm. (b, c) Representative immunohistochemisty and quantitative assessment of (b) the proliferation marker Ki67 and (c) the senescence marker PML in lung tumors from KRas;Atg5 fl/+ and KRas;Atg5 fl/fl littermates 18 wks after AdCre inhalation. Sections were scored independently in a double-blinded fashion. Data are shown as mean percentages (±SEM) of positive cells per total cell numbers. Only cells inside the tumors were counted. At least 6 mice per genotype and time point were analyzed. 50 m. * P < 0.05, *** P < (Chi-square test of a generalised linear model with logit link assessing the genotype effect).
5 Supplementary Figure 5. Enhanced cell death of Atg5 mutant lung tumor cells. (a) Western blot analysis of Atg5, p62, cleaved caspase3, and cleaved caspase8 in tumor tissues 18 wks after AdCre inhalation. Data from two different KRas;Atg5 fl/+ and KRas;Atg5 fl/fl mice are shown. GAPDH is shown as a loading control. (b) Representative immunohistochemisty and quantitative assessment of cleaved caspase3 and Tunel-positive cells in lung tumors from KRas;Atg5 fl/+ and KRas;Atg5 fl/fl littermates 18 wks after AdCre inhalation. Sections were scored independently in a double-blinded fashion. Data are shown as mean percentages (±SEM) of positive cells per total cell numbers. Only cells within tumors were counted. At least 6 mice per genotype and time point were analyzed. Size bars, 50µm. ** P < 0.01; *** P < (Chi-square tests of a generalised linear model with logit link assessing the genotype effect).
6 Supplementary Figure 6. Gene expression profiling and network mapping. (a) Heatmap visualization of genes showing a higher than twofold difference in expression between KRas;Atg5 fl/+ and KRas;Atg5 fl/fl tumors (false discovery rate (FDR); P < 0.05). Functional classification for these differentially expressed transcripts was performed using Ingenuity pathway Analysis (IPA) and indicates significant enrichment of the categories Inflammatory Response (P=8.7E-12), Glutathione Metabolism (P=6.24E-08), and NRF2-mediated Oxidative Stress Response (P=1.69E-05). Genes assigned to these processes are highlighted using purple and blue circles. (b) An interaction network generated using STRING 9.0 shows known and predicted links of proteins within the enriched categories "Inflammatory Response" and "Glutathione Metabolism/NOS" (gene names are also highlighted in the heatmap). (c,d) qpcr analyses to confirm deregulated mrna expression of the (c) inflammatory genes Cxcl5, Egr1, and Cxcl3, and (d) the oxidative stress genes Gstm1 and Gstm2. Data are shown as mean relative upregulation (±SEM) of mrna expression in KRas;Atg5 fl/fl tumors as compared to tumors from KRas;Atg5 fl/+ mice (set to 1). Values were normalized to -actin mrna expression. Three different tumors from 3 individual mice/per group were analysed.
7 Supplementary Figure 7. Blood vessel formation and macrophage infiltration in lung tumors. (a) ELISA analysis of Cxcl5 in sera of lung tumor bearing KRas;Atg5 fl/+ and KRas;Atg5 fl/fl mice 18 wks after tumor induction. Data are shown as mean percentages (± SEM). n = 6 per group. * P < 0.05 (Chi-square tests of a generalised linear model with log link assessing the genotype effect). (b) Representative immunohistochemistry of Von Willebrand Factor positive blood vessels (arrows) in lung tumors from KRas;Atg5 fl/+ and KRas;Atg5 fl/fl littermates 18 wks after AdCre inhalation. Size bars, 50µm. (c) Representative immunohistochemisty and quantitative assessment of F4/80 positive macrophages in lung tumors from KRas;Atg5 fl/+ and KRas;Atg5 fl/fl littermates 18 wks after AdCre inhalation. Sections were scored independently in a double-blinded fashion. Data are shown as mean percentages (±SEM) of positive cells per total cell numbers. Only cells within tumors were counted. Six mice were analyzed for each genotype. Size bars, 50µm. *** P < (Chi-square tests of a generalised linear model with logit link assessing the genotype effect).
8 Supplementary Figure 8. RNAseq data for genes involved in inflammation and oxidative stress responses. RNA-seq fragment coverage is shown as UCSC multiexperiment overlap track for the inflammatory gene Il1β (upper), Nrf2(middle) and Nqo1(lower), both key genes in the oxidative stress response. polya-mrna of KRas;Atg5 fl/+ and KRas;Atg5 fl/fl pneumocytes after 96 hrs of culture and virus infection was isolated and the generated libraries were sequenced by 50-bp single-end Illumina mrna sequencing. Reads were aligned using Tophat v2.0.6 and bowtie v0.12.9; genomecoveragebed was run on the resulting BAM files for the quantification of genomic coverage scaled using DESeq estimatesizefactors. Exons and introns are indicated for each gene.
9 Supplementary Figure 9. Activation of the DNA damage response in autophagy deficient lung tumors. (a,b) Representative immunohistochemisty and quantitative assessment of (a) γh2ax and (b) phospho-chk2 in lung tumors from KRas;Atg5 fl/+ and KRas;Atg5 fl/fl littermates 6 wks after AdCre inhalation. At least 6 mice per genotype were analyzed. Quantifications are shown as mean percentages (± SEM) of positive cells per total cell numbers. Only cells within tumors were counted. Scale bars, 50µm. *** P < (Chi-square tests of a generalised linear model with logit link assessing the genotype effect).
10 Supplementary Figure 10. Loss of p53 in autophagy deficient KRas-driven lung tumors. (a) Absolute numbers of hyperplastic lesions, adenomas, and adenocarcinomas in KRas;Atg5 fl/+ ;p53 fl/fl and KRas;Atg5 fl/fl ;p53 fl/fl littermates 16 wks post-adcre infection (n=4 per genotype). (b) Histological analyses of lung carcinomas in KRas;Atg5 fl/+ ;p53 fl/fl and KRas;Atg5 fl/fl ;p53 fl/fl littermates 16 wks after AdCre inhalation. Representative H&E stainings are shown to demonstrate mitotic figures, irregular chromatin structures, and cellular and nuclear pleomorphism in lung tumors with the indicated genotypes. Size bars, 50µm. (c) Representative histological sections at 2 wks after AdCre inhalation are shown in the left panels. Scale bars, 2mm. Right panel shows quantification of numbers of hyperplastic lesions/per lung (mean values ± SEM) in KRas;Atg5 fl/+ ;p53 fl/fl and KRas;Atg5 fl/fl ;p53 fl/fl littermates 2 wks after AdCre inhalation. n = 4 per group. (d) γh2ax in lung tumors from KRas;Atg5 fl/+ ;p53 fl/fl and KRas;Atg5 fl/fl ;p53 fl/fl littermates 2 and 16 wks after AdCre inhalation. For γh2ax and phospho- Chk2 staining, sections were scored independently in a double-blinded fashion. Quantifications are shown as mean percentages (± SEM) of positive cells per total cell numbers. Only cells within tumors were counted. n=4 per group. Scale bars, 50µm.
11 Supplementary Figure 11. Treg accumulation in late lung tumors. Representative immunohistochemisty and quantitative assessment of FoxP3 + regulatory T cells in lung tumors from KRas;Atg5 fl/+ and KRas;Atg5 fl/fl littermates 18 wks after AdCre inhalation. Data are shown as mean percentages (± SEM) of FoxP3 + cells among total cell numbers in the tumor areas. Only cells within tumors were scored. At least 6 mice per genotype were analyzed. Size bars, 50 µm. *** P < (Chi-square tests of a generalised linear model with logit link assessing the genotype effect).
12 Supplementary Figure 12. In vivo Treg cell depletion. (a) FACS analyses to detect FoxP3 + Treg and CD4 + T cells in mediastinal lymph nodes from KRas;Atg5 fl/+ (fl/+) and KRas;Atg5 fl/fl (fl/fl) littermates 2 wks after AdCre inhalation that either received control isotype antibodies (isotype) or depleting anti-cd25 Abs ( CD25). Cells were gated on CD4 + populations and percentages of FoxP3 + Tregs among CD4 + T cells are shown for individual mice. Mean values (± SEM) are indicated. (b) Representative FACS analyses of lymphocytes incubated with antibodies specific for CD8, CD4, CD25, and FoxP3. Cells were isolated from blood of KRas;Atg5 fl/+ and KRas;Atg5 fl/fl littermates 2 wks after AdCre inhalation that either received control isotype antibodies or depleting anti-cd25 Abs. Numbers in dot blots indicate percentages of positive cells. Note the marked reduction in CD25 + FoxP3 + Treg numbers after injection of CD25, confirming the efficacy of the depletion protocol.
13 Supplementary Figure 13. Images of the immunoblot results shown in the manuscript. Red boxes indicate the cropped areas displayed in the indicated figures.
Supplemental Figure S1. RANK expression on human lung cancer cells.
Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression
Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time
stability and tumor suppression
Supplementary information The stress kinase MKK7 couples oncogenic stress to p53 stability and tumor suppression Daniel Schramek 1, Athanassios Kotsinas 2, Arabella Meixner 1, Teiji Wada 1, Ulrich Elling
Supplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded
Supplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded from TCGA and differentially expressed metabolic genes
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
Transcription factor Foxp3 and its protein partners form a complex regulatory network
Supplementary figures Resource Paper Transcription factor Foxp3 and its protein partners form a complex regulatory network Dipayan Rudra 1, Paul deroos 1, Ashutosh Chaudhry 1, Rachel Niec 1, Aaron Arvey
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding
Nature Genetics: doi: /ng Supplementary Figure 1. SEER data for male and female cancer incidence from
Supplementary Figure 1 SEER data for male and female cancer incidence from 1975 2013. (a,b) Incidence rates of oral cavity and pharynx cancer (a) and leukemia (b) are plotted, grouped by males (blue),
a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining
SUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure S1: Tumor grades in Ras G12D ; p53 / lung tumors. Representative histology (H&E) of K-Ras G12D ; p53 / lung tumors 13 weeks after tumor initiation. Grade
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
Supplementary Figure 1. Example of gating strategy
Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte
Supplementary Materials and Methods
Supplementary Materials and Methods Whole Mount X-Gal Staining Whole tissues were collected, rinsed with PBS and fixed with 4% PFA. Tissues were then rinsed in rinse buffer (100 mm Sodium Phosphate ph
Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.
Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized
Supplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows
Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the
SUPPLEMENTARY INFORMATION
Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
Supplementary information
Supplementary information High fat diet-induced changes of mouse hepatic transcription and enhancer activity can be reversed by subsequent weight loss Majken Siersbæk, Lyuba Varticovski, Shutong Yang,
T H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III
Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor
Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.
Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated
A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.
pstat3 75 Pan CK A A263 A352 A24 B Columns 1-6 Positive control A195 A22 A24 A183 Rectal Nodule STAT3 pstat3 STAT3 pstat3 Columns 7-12 Omentum Rectosigmoid Left Ovary Right Ovary Omentum Uterus Uterus
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice
Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547
Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living
Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-
Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells
Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
A dual role for autophagy in a murine model of lung cancer
Received 16 Sep 213 Accepted 3 Dec 213 Published 2 Jan 214 DOI: 1.138/ncomms456 A dual role for autophagy in a murine model of lung cancer Shuan Rao 1, Luigi Tortola 1, Thomas Perlot 1, Gerald Wirnsberger
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
Supplementary. presence of the. (c) mrna expression. Error. in naive or
Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated
Figure S1: Effects on haptotaxis are independent of effects on cell velocity A)
Supplemental Figures Figure S1: Effects on haptotaxis are independent of effects on cell velocity A) Velocity of MV D7 fibroblasts expressing different GFP-tagged Ena/VASP family proteins in the haptotaxis
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
SUPPLEMENTARY FIGURE 1
SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T
SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.
s1 A Pten flox/flox () SOPten flox/flox () flox allele 6. kb B Pten flox/flox () SOPten flox/flox () Pten Actin! allele 2.3 kb Supplementary Figure S1. Yanagi, et al. A B BrdU BrdU positive cells ( ) 3
Supplementary Figure 1
Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.
Supplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN
B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification
Supplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression
Molecular Cell, Volume 68 Supplemental Information NRF2 Is a Major Target of ARF in p53-independent Tumor Suppression Delin Chen, Omid Tavana, Bo Chu, Luke Erber, Yue Chen, Richard Baer, and Wei Gu Figure
genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2535 Figure S1 SOX10 is expressed in human giant congenital nevi and its expression in human melanoma samples suggests that SOX10 functions in a MITF-independent manner. a, b, Representative
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
Nature Immunology: doi: /ni Supplementary Figure 1. RNA-Seq analysis of CD8 + TILs and N-TILs.
Supplementary Figure 1 RNA-Seq analysis of CD8 + TILs and N-TILs. (a) Schematic representation of the tumor and cell types used for the study. HNSCC, head and neck squamous cell cancer; NSCLC, non-small
Supplementary Figure 1: Features of IGLL5 Mutations in CLL: a) Representative IGV screenshot of first
Supplementary Figure 1: Features of IGLL5 Mutations in CLL: a) Representative IGV screenshot of first intron IGLL5 mutation depicting biallelic mutations. Red arrows highlight the presence of out of phase
Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.
Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.32 PCOS locus after conditioning for the lead SNP rs10993397;
RNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB
RNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB CSF-NGS January 22, 214 Contents 1 Introduction 1 2 Experimental Details 1 3 Results And Discussion 1 3.1 ERCC spike ins............................................
ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10866 a b 1 2 3 4 5 6 7 Match No Match 1 2 3 4 5 6 7 Turcan et al. Supplementary Fig.1 Concepts mapping H3K27 targets in EF CBX8 targets in EF H3K27 targets in ES SUZ12 targets in ES
Reason for Dissection. Pleomorphic adenoma. Tongue base adenocarcinoma
Supplementary Table S1 Human Patients Patient Sample No. Gender Age Additional Medication Treatment 1 Reason for Dissection Total Irradiation Dose Estimated Irradiation Dose to SG Gland Time of Resection
marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
Expanded View Figures
PEX13 functions in selective autophagy Ming Y Lee et al Expanded View Figures Figure EV1. PEX13 is required for Sindbis virophagy. A, B Quantification of mcherry-capsid puncta per cell (A) and GFP-LC3
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
Supplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
Nature Medicine: doi: /nm.4324
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression
a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,
Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors
Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA
Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.
Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic
SUPPLEMENTAL INFORMATIONS
1 SUPPLEMENTAL INFORMATIONS Figure S1 Cumulative ZIKV production by testis explants over a 9 day-culture period. Viral titer values presented in Figure 1B (viral release over a 3 day-culture period measured
MODULE 4: SPLICING. Removal of introns from messenger RNA by splicing
Last update: 05/10/2017 MODULE 4: SPLICING Lesson Plan: Title MEG LAAKSO Removal of introns from messenger RNA by splicing Objectives Identify splice donor and acceptor sites that are best supported by
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well
Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well plate at cell densities ranging from 25-225 cells in
Figure S1A. Blood glucose levels in mice after glucose injection
## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose
sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge
a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the
Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2
Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 activity. Upper panel: Representative histograms for FACS
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Quantification of myelin fragments in the aging brain (a) Electron microscopy on corpus callosum is shown for a 18-month-old wild type mice. Myelin fragments (arrows) were detected
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'
Supplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase
Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez
SUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
Irf1 fold changes (D) 24h 48h. p-p65. t-p65. p-irf3. t-irf3. β-actin SKO TKO 100% 80% 60% 40% 20%
Irf7 Fold changes 3 1 Irf1 fold changes 3 1 8h h 8h 8h h 8h p-p6 p-p6 t-p6 p-irf3 β-actin p-irf3 t-irf3 β-actin TKO TKO STKO (E) (F) TKO TKO % of p6 nuclear translocation % % 1% 1% % % p6 TKO % of IRF3
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±
a surface permeabilized
a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected
pplementary Figur Supplementary Figure 1. a.
pplementary Figur Supplementary Figure 1. a. Quantification by RT-qPCR of YFV-17D and YFV-17D pol- (+) RNA in the supernatant of cultured Huh7.5 cells following viral RNA electroporation of respective
Spleen. mlns. E Spleen 4.1. mlns. Spleen. mlns. Mock 17. Mock CD8 HIV-1 CD38 HLA-DR. Ki67. Spleen. Spleen. mlns. Cheng et al. Fig.
C D E F Mock 17 Mock 4.1 CD38 57 CD8 23.7 HLA-DR Ki67 G H I Cheng et al. Fig.S1 Supplementary Figure 1. persistent infection leads to human T cell depletion and hyper-immune activation. Humanized mice
Supplementary Information
Supplementary Information Supplementary Figure 1! a! b! Nfatc1!! Nfatc1"! P1! P2! pa1! pa2! ex1! ex2! exons 3-9! ex1! ex11!!" #" Nfatc1A!!" Nfatc1B! #"!" Nfatc1C! #" DN1! DN2! DN1!!A! #A!!B! #B!!C! #C!!A!