A dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma
|
|
- Abraham Gilbert
- 6 years ago
- Views:
Transcription
1 Supplemental data A dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma Qi-Wen Fan, Zachary A. Knight, David D. Goldenberg, Wei Yu, Keith E. Mostov, David Stokoe, Kevan M. Shokat, and William A. Weiss Figure S1. fails to induce targets associated with DNA damage check-points A and B: U87MG cells were treated with (0.5 µm, 24h), exposed to UVC (20 J/m 2 ) or treated with both agents as shown. A: Cells were fixed and stained with antisera against p-γh2ax (red staining) and counterstained with To- Pro-3 iodide (blue). In contrast to cells treated with UVC, control cells and cells treated with showed little activation of p-γh2ax. Scale bar corresponds to 100 µm. B: Lysates were subjected to immunoblot analysis with antisera indicated. UVC treatment resulted in activation of both p53 and p-γh2ax. In contrast, failed to activate either of these DNA check-point markers, either as monotherapy, or when combined with UVC. These data suggest that does not significantly activate DNA-repair dependent check-points associated with increasing the mutation rate. A Control UVC B p-p53(ser15) p53 p-γh2ax(ser139) UVC + H2AX + + +
2 Figure S2. Flow cytometry using isoform-selective inhibitors of p110α against a glioma cell line U373M glioma cells were treated with isoform-selective inhibitors shown (0.5 µm) or with (10 µm) for 24h. Nuclei from trypsinized cells were stained with propidium iodide, and analyzed by FACScan. Numbers represent percentages in G 0 G 1, S, and G 2 M phases of the cell cycle. G 0 G 1 : 52 G 2 M: 17 G 0 G 1 : 59 S: 19 G 2 M: 22 PIK-64 S: 32 PIK-85 G 0 G 1 : 52 S: 34 G 2 M: 13 PIK-90 G 0 G 1 : 60 G 2 M: 10 PIK-93 G 0 G 1 : 50 S: 36 G 2 M: 14 PIK-112 G 0 G 1 : 55 S: 27 G 2 M: 18 G 0 G 1 : 70 S: 22 G 2 M: 8 PIK-124 TGX-115 S: 32 PIK-73 TGX-286 PIK-108 G 0 G 1 : 55 S: 30 PIK-39 S: 32 Rapamycin G 0 G 1 : 48 S: 36
3 Figure S3. Comparison of isoform-selective inhibition and sirna directed against p110α or p110β U87MG glioma cell lines were treated with isoform-selective inhibitors PIK-90 (p110α) or TGX-286 (p110β) at 0.5 µm, with sirna directed against p110α (Czauderna et al., 2003), p110β (Santa Cruz), or with a control scrambled sirna (Elbashir et al., 2001). A: Lysates were immunoblotted for signaling intermediates shown. Whereas all active agents blocked p- Akt, sirna against p110β was unique in reducing levels of p85α, a result also observed by others interrogating the impact of p110β loss genetically (Brachmann et al., 2005). B: Nuclei from trypsinized cells were stained with propidium iodide, and analyzed by FACScan. Numbers represent percentages in G 0 G 1, S, and G 2 M phases of the cell cycle. In contrast to results using small molecule inhibitors of p110β, sirna directed against p110β led to proliferative arrest. Although this arrest could in-part be attributable to decreased levels of p110β, other variables contributing to this arrest include decreased levels of free p85, and alterations in the ratio of p110:p85, both of which are key regulators of PI3-kinase signaling (reviewed in (Hennessy et al., 2005)).
4 Figure S4. inhibits phosphorylation of Akt in a dose dependent manner, and induces cell cycle arrest in a panel of human glioma cell lines irrespective of p53 or PTEN status A and B: U87MG (PTEN mutant) and LN229 cells (PTEN wild-type) were treated with ( µm) for 24h. Lysates were subjected to immunoblot analysis with antisera indicated. C and D: Proliferation was visualized by crystal-violet staining of cells after treatment with for 48h (top panels) Cell cycle distribution was analyzed by flow cytometric analysis after treatment for 24h (bottom panels). Percentage of cells in G 0 /G 1, S, and G 2 M phases of the cell cycle are indicated. Although levels of p-akt were increased in the PTEN mutant cell line, both cell lines showed similar dose-response to, irrespective of PTEN status. E: Human glioma cell lines indicated were treated with (0.5 µm) or (10 µm) for 24h. Cells were harvested, lysed and subjected to immunoblot analysis with antisera indicated.
5 Figure S5. Isoform-selective inhibitors of p110α show activity against a panel of glioma cell lines Glioma cell lines indicated were treated with isoform-selective inhibitors shown (0.5 µm) or with (10 µm) for 24h. Nuclei from trypsinized cells were stained with propidium iodide, and analyzed by FACScan. Numbers represent percentages in G 0 G 1, S, and G 2 M phases of the cell cycle.
6 Table S1. G 0 G 1 arrest in glioma cell lines, irrespective of p53 Cell line U87 P53 status PTEN Treatment or PTEN status Cell Cycle Distribution G 0 G 1 S G 2 M U87:² EGFR U87:EGFR U373 LN299 SF188 LN-Z308 A1207 SF763 SF Cells were treated with (control), (0.5 µm), or (10 µm) for 24 h. There are no known glioma cell lines that carry gain of function mutations in p110α. The frequency of these mutations in glioma is currently uncertain. Abbreviations;, Wild type;, Mutant.
Validation & Assay Performance Summary
Validation & Assay Performance Summary CellSensor DBE-bla MDA-MB-468 Cell Line Cat. no. K1814 Pathway Description The phosphatidylinositol-3-kinase (PI3K) signaling cascade is essential for cell growth
More informationSupplementary Figure 1
Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationA chemical screen in diverse breast cancer cell lines reveals genetic enhancers and suppressors of sensitivity to PI3K isoform-selective inhibition
Biochem. J. (2008) 415, 97 110 (Printed in Great Britain) doi:10.1042/bj20080639 97 A chemical screen in diverse breast cancer cell lines reveals genetic enhancers and suppressors of sensitivity to PI3K
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationSupplementary Information
Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6
More informationSupplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
More informationA dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma
A dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma Qi-Wen Fan, 1,2,3,4 Zachary A. Knight, 5 David D. Goldenberg, 1,2,3,4 Wei Yu, 6 Keith E. Mostov, 6 David Stokoe, 7 Kevan M. Shokat,
More informationEffects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
More informationSUPPLEMENTARY INFORMATION
Figure S1 Treatment with both Sema6D and Plexin-A1 sirnas induces the phenotype essentially identical to that induced by treatment with Sema6D sirna alone or Plexin-A1 sirna alone. (a,b) The cardiac tube
More informationSamali A Figure S1.
Deegan S, Saveljeva S, Logue SE, Pakos-Zebrucka K, Gupta S, Vandenabeele P, Bertrand MJ,Samali A. (2014) Deficiency in the mitochondrial apoptotic pathway reveals the toxic potential of autophagy under
More informationSupplementary Figure 1
Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes
More informationSUPPLEMENTAL EXPERIMENTAL PROCEDURES
SUPPLEMENTAL EXPERIMENTAL PROCEDURES Crystal violet assay Cells were seeded in 24-well plates and cultured in media supplemented with % FBS for 7 days. Media were then removed, plates were briefly washed
More informationEGFR Signals to mtor Through PKC and Independently of Akt in Glioma
CANCER EGFR Signals to mtor Through PKC and Independently of Akt in Glioma Qi-Wen Fan, 1,2,3,4 Christine Cheng, 1,2,3,4 Zachary A. Knight, 5,6,7 Daphne Haas-Kogan, 3,4 David Stokoe, 3,4 C. David James,
More information(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
More informationAP VP DLP H&E. p-akt DLP
A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationSupplementary Figure 1. Successful excision of genes from WBM lysates and
Supplementary Information: Supplementary Figure 1. Successful excision of genes from WBM lysates and survival of mice with different genotypes. (a) The proper excision of Pten, p110α, p110α and p110δ was
More informationSupplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
More informationSUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies
More informationSupplemental information
Supplemental information PI(3)K p11δ controls the sucellular compartmentalization of TLR4 signaling and protects from endotoxic shock Ezra Aksoy, Salma Taoui, David Torres, Sandrine Delauve, Aderrahman
More information(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
More informationThe PI3K/AKT axis. Dr. Lucio Crinò Medical Oncology Division Azienda Ospedaliera-Perugia. Introduction
The PI3K/AKT axis Dr. Lucio Crinò Medical Oncology Division Azienda Ospedaliera-Perugia Introduction Phosphoinositide 3-kinase (PI3K) pathway are a family of lipid kinases discovered in 1980s. They have
More informationQuantitative PPARγ expression affects the balance between tolerance and immunity
Quantitative PPARγ expression affects the balance between tolerance and immunity Ya-Hui Liu 1, Yau-Sheng Tsai 1,2,3, Shih-Chieh Lin 4, Nan-Shih Liao 5, Ming-Shiou Jan 6, Chung-Tiang Liang 7, Shih-Wen Hsu
More informationPharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma
Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
More informationSUPPLEMENT. Materials and methods
SUPPLEMENT Materials and methods Cell culture and reagents Cell media and reagents were from Invitrogen unless otherwise indicated. Antibiotics and Tet-certified serum were from Clontech. In experiments
More informationEasy50 PI3K Inhibitor Array*
Easy50 PI3K Inhibitor Array* Catalog # IAP001 Instruction Manual For Research Use Only *Patent pending Introduction This Easy50 PI3K Inhibitor Array is a panel of serial dilutions of inhibitors that are
More informationSupplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent
More informationDescription of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables
Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were
More informationSupplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with
Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with Coomassie brilliant blue. One µg/ml recombinant human (rh) apo-e
More informationSUPPLEMENTARY FIGURE LEGENDS
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Hippocampal sections from new-born Pten+/+ and PtenFV/FV pups were stained with haematoxylin and eosin (H&E) and were imaged at (a) low and (b) high
More information33VASTVNGATSANNHGEPPS51PADARPR58
Pro-rich region Trans-membrane region 214 246 359 381 UL50 1 397 211SSRTAS216PPPPPR222 NLS CR1 CR2 CR3 CR4 UL53 1 376 11RERRS15ALRS19LLRKRRR25 33VASTVNGATSANNHGEPPS51PADARPR58 FIG S1. UL97 phosphorylation
More informationSupplemental Data. Beck et al. (2010). Plant Cell /tpc
Supplemental Figure 1. Phenotypic comparison of the rosette leaves of four-week-old mpk4 and Col-0 plants. A mpk4 vs Col-0 plants grown in soil. Note the extreme dwarfism of the mpk4 plants (white arrows)
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationSupplementary Figure 1
Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationMuse Assays for Cell Analysis
Muse Assays for Cell Analysis Multiple Assay Outputs for Cell Analysis Cell Health Cell Signalling Immunology Muse Count & Viability Kit Muse Cell Cycle Kit Muse Annexin V & Dead Cell Kit Muse Caspase
More informationTRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya
More informationNature Immunology: doi: /ni.3866
Nature Immunology: doi:10.1038/ni.3866 Supplementary Figure 1 The effect of TIPE2 on chemotaxis. a, The expression of TIPE2 in dhl-60c, dhl-60t, TIPE2-expressing and 15/16Q-expressing dhl-60t neutrophils
More informationSupplementary Material
Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental
More informationALM301: Allosteric Isoform selective Akt inhibitor
ALM301: Allosteric Isoform selective Akt inhibitor Background Akt1/2 selective inhibitors ALM301 Back-up compounds Akt2 selective inhibitors Approaches to Akt Inhibition Both ATP competitive and allosteric
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationLeucine Deprivation Reveals a Targetable Liability
Cancer Cell, 19 Supplemental Information Defective Regulation of Autophagy upon Leucine Deprivation Reveals a Targetable Liability of Human Melanoma Cells In Vitro and In Vivo Joon-Ho Sheen, Roberto Zoncu,
More informationSupplementary figure legends
Supplementary figure legends Supplementary Figure 1. Exposure of CRT occurs independently from the apoptosisassociated loss of the mitochondrial membrane potential (MMP). (A) HeLa cells treated with MTX
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Reagents and antibodies was purchased from iaffin GmbH & Co KG. Cisplatin (ristol-myers Squibb Co.) and etoposide (Sandoz Pharma Ltd.) were used. Antibodies recognizing
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More information- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)
Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of
More informationSupplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods
Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary
More informationmtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-
Supplementary Material for mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- XL Inhibition by Suppressing MCL-1 Anthony C. Faber 1,2 *, Erin M. Coffee
More informationSupplementary Figure 1
Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2
More informationArticle. Reference. A pharmacological map of the PI3-K family defines a role for p110alpha in insulin signaling. KNIGHT, Zachary A, et al.
Article A pharmacological map of the PI3-K family defines a role for p110alpha in insulin signaling KNIGHT, Zachary A, et al. Abstract Phosphoinositide 3-kinases (PI3-Ks) are an important emerging class
More informationSupplementary Figure 1. MAT IIα is Acetylated at Lysine 81.
IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag
More informationSupplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A)
Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A) Cells over-expressing hfgfr1-pcdna3 (+) or pcdna3 (-) were stimulated for 10 minutes with 50ng/ml FGF2 and lysates immunoblotted
More informationProlonged mitotic arrest induces a caspase-dependent DNA damage
SUPPLEMENTARY INFORMATION Prolonged mitotic arrest induces a caspase-dependent DNA damage response at telomeres that determines cell survival Karolina O. Hain, Didier J. Colin, Shubhra Rastogi, Lindsey
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/385/ra70/dc1 Supplementary Materials for The interaction of heparan sulfate proteoglycans with endothelial transglutaminase-2 limits VEGF 165 -induced angiogenesis
More informationTumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death Supplementary
More informationSupplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.
Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue
More informationDownregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes
Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes Armen Petrosyan 1*, Pi-Wan Cheng 1,3, Dahn L. Clemens 2,3 & Carol A. Casey 2,3 1 Department
More informationa Control IgG Intestine c Testis b Thymus 1 3 2 S S 2 1 3 4 4 Figure S1 The wild-type mouse (C57BL/6J) organs (intestine, thymus and testis) were frozen in liquid nitrogen and sectioned at 5 µm on a cryostat.
More informationTo determine the effect of over-expression and/or ligand activation of. PPAR / on cell cycle, cell lines were cultured as described above until ~80%
Supplementary Materials and Methods Cell cycle analysis To determine the effect of over-expression and/or ligand activation of PPAR / on cell cycle, cell lines were cultured as described above until ~80%
More informationSupplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
More informationA Kinase Inhibitor Targeted to mtorc1 Drives Regression in Glioblastoma
Article A Kinase Inhibitor Targeted to mtorc1 Drives Regression in Glioblastoma Highlights d The TORKi MLN0128 shows poor residence time, underlying poor in vivo efficacy d d d RapaLink-1 shows improved
More informationExtracellular vesicles are transferred from melanocytes to keratinocytes after UVA irradiation
Supplementary material; Title; Extracellular vesicles are transferred from melanocytes to keratinocytes after UVA irradiation Authors; Petra Wäster 1, Ida Eriksson 1, Linda Vainikka 1, Inger Rosdahl 2,
More informationgliomas. Fetal brain expected who each low-
Supplementary Figure S1. Grade-specificity aberrant expression of HOXA genes in gliomas. (A) Representative RT-PCR analyses of HOXA gene expression in human astrocytomas. Exemplified glioma samples include
More informationSupplementary Figures
Supplementary Figures Figure S1. Validation of kinase regulators of ONC201 sensitivity. Validation and screen results for changes in cell viability associated with the combination of ONC201 treatment (1
More informationEGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,
More informationSupplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) (b) (c) (d) (e) (f) (g) .
Supplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) The inhibitory effects of new antibodies (Mab17 and Mab18). They were investigated in in vitro fertilization
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationTable S1. New colony formation 7 days after stimulation with doxo and VCR in JURKAT cells
Table S1. New colony formation 7 days after stimulation with and in JURKAT cells drug co + number of colonies 7±14 4±7 48±11 JURKAT cells were stimulated and analyzed as in Table 1. Drug concentrations
More informationRCPA Research Award Final Progress Review
RCPA Research Award 2010-2011 Final Progress Review Name: Dr Craig Wallington-Beddoe Degree/Institution/Year: PhD, The University of Sydney, Year 2 Research Project Title: New Therapeutic Strategies for
More informationNIH Public Access Author Manuscript Nat Chem Biol. Author manuscript; available in PMC 2010 June 3.
NIH Public Access Author Manuscript Published in final edited form as: Nat Chem Biol. 2008 November ; 4(11): 691 699. doi:10.1038/nchembio.117. Targeted polypharmacology: Discovery of dual inhibitors of
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3076 Supplementary Figure 1 btrcp targets Cep68 for degradation during mitosis. a) Cep68 immunofluorescence in interphase and metaphase. U-2OS cells were transfected with control sirna
More informationSupplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
More informationhexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationPart-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death
Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated
More informationSupplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
More informationTargeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from
Supplementary Methods: Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from mouse tumor samples and analyzed as
More informationCombination of PI3K/mTOR Inhibition Demonstrates Efficacy in Human Chordoma
Combination of PI3K/mTOR Inhibition Demonstrates Efficacy in Human Chordoma JOSEPH SCHWAB 1, CRISTINA ANTONESCU 2, PATRICK BOLAND 3, JOHN HEALEY 3, ANDREW ROSENBERG 4, PETUR NIELSEN 4, JOHN IAFRATE 4,
More informationChapter 2. Aims & Objectives
2.1. Statement of the problem: Earlier reports have shown ambiguous alteration of histone marks in response to DNA damage in asynchronized population of cells. These histone marks not only undergo dynamic
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Díaz et al., http://www.jcb.org/cgi/content/full/jcb.201209151/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Hypoxia induces invadopodia formation in different epithelial
More informationa 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80
a 10 4 WT 10 4 TRPV2KO 10 3 10 3 anti-gr1 10 2 10 1 anti-gr1 10 2 10 1 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 42.3 45.2 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 10 4 10 4 40 42.5 anti-cd11b 10 3 10 2
More informationSupplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION
Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny
More informationSupporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis
1 2 Supporting Information 3 4 5 FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce apoptosis 6 7 Kishu Ranjan and Chandramani Pathak* 8 9 Department of Cell Biology, School
More informationFOXO Reporter Kit PI3K/AKT Pathway Cat. #60643
Data Sheet FOXO Reporter Kit PI3K/AKT Pathway Cat. #60643 Background The PI3K/AKT signaling pathway is essential for cell growth and survival. Disruption of this pathway or its regulation has been linked
More informationmarker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
More informationp = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
More informationSUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure S1: Tumor grades in Ras G12D ; p53 / lung tumors. Representative histology (H&E) of K-Ras G12D ; p53 / lung tumors 13 weeks after tumor initiation. Grade
More informationPI3K/mTOR Dual Inhibitor
PI3K/mTOR Dual Inhibitor LY3023414 Courtney KD, et al 1 Drug Discovery Platform: Cancer Cell Signaling A Double-Blinded, Placebo-Controlled, Randomized Phase II Study of Enzalutamide With or Without the
More informationThe functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein
THESIS BOOK The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein Orsolya Buzás-Bereczki Supervisors: Dr. Éva Bálint Dr. Imre Miklós Boros University of
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Bredel M, Scholtens DM, Yadav AK, et al. NFKBIA deletion in
More informationHuman recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z.
Intensity % Intensity % A Human recombinat MIF protein (hrmif), MW: 12428.31 Da m/z hrmif (12428.31 Da) + 4-IPP (282 Da) MWtot ~ 12715.21 Da m/z B HTC/C3 DAPI phistone-h3 Merge HTC/C3 DAPI phistone-h3
More informationSupplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5
Supplementary Information Induction of p53-independent apoptosis by ectopic expression of in human liposarcomas Dhong Hyun Lee 1, *, Charles Forscher 1, Dolores Di Vizio 2, 3, and H. Phillip Koeffler 1,
More informationSupplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
More informationSupplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
More information