Table S1. qpcr primer list.
|
|
|
- Kevin Parsons
- 6 years ago
- Views:
Transcription
1 Table S1. qpr primer list. Genes Forward primer Reverse primer NANOG AAATGGGAAGAATAGA GGTTAGTGGGTTA PAX6 TTTTGTTGGGAAATG TGGTTAAATTTAG ASL1 AAGATGAAAGAAAG GGAGTTTGATTAA NHLH GTGGATAGATATTT ATATTTTGGAATTT NKX.1 AAAAGGATAATTAAGG TGTGAGAGTGAAGTTTGGTT OTP GGAAAGTTGGTGTTTT TTGAAGATATA SIM1 TTTTGTGTGAAATGAA AATGATGAAAAG SF1 TGTATTGTAGATGGG GATGATGTAAATGG NESTIN GGGATAAGATGT TTGGGGTTGAAAGTG POM GAATGGTGTTAG AGAGTGAGAA AGRP GGATTGTTGAGGAGGTAG TGAAGAAGGGAGTAGAGT GGTTTAAGGAGTTTG AATATAAGGAGAG LEPR ATGTTGAAAAGAAT GGAAATGTATGATG SST AGATGTAGTTTTGA TTAGGGATATTTGT PMH ATTGGGGATGAAGAAAATAGT GATTGAAAAGGTGGTAG PSK1 AAGGTGTGATATTG AAATGATGAGGAGA PSK TTTGGTAAATTTTG TGAAAGGAAGAGAAGA PE TAAATTAGGTAAGG ATAGAGGATTTAAG MR AGTAGGGGTTATTGGGA ATAATGAATTG M3R GGTTGATGAAGATGT TAGAAATGTAATG M4R TTATGATGATAAG GTAGTTTGTTGAT OPRM1 TGGTGGAGTTTATTTG GATATGGTTATA OPRD1 GTAGATGTTGGTGGGTT ATAGGTTATG TP AAAAAGTGATTA GATAAGGATATTGGA M TAGTGTGTGGGTAT TTTGTGGATGAGG 35
2 Table S. List of primary Abs and their concentrations and sources used in this study. Antibody Species Dilution Source atalog No. Sheep 1:1 Millipore A587 POM chicken 1:5 Abcam ab1464 Rabbit 1:15 Novus npb Somatostatin Rat 1:5 Abcam ab3788 MH Rabbit 1:5 Sigma M844 AGRP Rabbit 1: Phoenix Pharmaceuticals H-3-53 AGRP Goat 1:5 Neuromics GT153 TH Rabbit 1:5 Abcam ab7613 GAA Rabbit 1:5 Sigma A5 GAD67 Mouse 1:5 Millipore MA546 Mash1 Rabbit 1: W 1:5 Abcam ab7465 Pax6 Rabbit 1:1 W 1:5 ovance PR-78P Nkx.1(TTF1) Rabbit 1: W 1:1 Abcam ab7613 FoxG1 Rabbit 1: Abcam ab1859 Sox1 Goat 1:5 R&D AF3369 Nestin Mouse 1:5 Stemgent 9-45 β endorphin Rabbit 1: From Sharon Wardlaw PE Goat 1:3 R&D AF3587 MAP hicken 1:1, Abcam A539 Tra-1-6 Mouse 1:3 Millipore MA436 Tra-1-81 Mouse 1:3 Millipore MA4381 Nanog Goat 1:5 R&D Systems AF1997 Sox Rabbit 1:5 Stemgent 9-4 Oct4 Rabbit 1:5 Stemgent 9-3 SSEA4 Mouse 1:3 R&D Systems MA1435 p-stat3 Mouse 1: W 1:1 ell signaling 4113 p-stat3 Rabbit 1: W 1:1 ell signaling 9145 p-akt(t38) Rabbit W 1:1 ell signaling 975 p-akt(s473) Rabbit W 1:1 ell signaling 46 -FOS Rabbit 1: ell signaling 5 STAT3 Rabbit W 1:1 ell signaling 164 AKT Rabbit W 1:1 ell signaling 97 ATIN Rabbit W 1:1 ell signaling
3 OTP ARNT SIM1 POU3F SF1 NKX.1 MASH1 NHLH OTP 3V ME PVH AR VMH GHRH AVP TRH OXT RH LH POM DA GAA AGRP SST GAA SST MH OREXIN F 1k/well,E Rocki LS SHH 1ng/ml PM um a. 7 b. LS/SHH/PM c. 7/DAPT Day KSR bfgf KSR KSR N 7/DNF N NKX.1-GFP+ Day KSR KSR/N N No Tx LS LS+SHH 1ng/ml (Day3-13) LS+SHH 1ng/ml (Day5-13) LS+SHH 1ng/ml (Day7-13) LS+SHH 1ng/ml (Day9-13) LS+SHH 1ng/ml (Day11-13) LS+SHH 1ng/ml (Day3-11) LS+SHH 1ng/ml (Day3-9) LS+SHH 1ng/ml (Day3-7) LS+SHH 1ng/ml (Day3-5) Day 11 cells N/7 GFP+ N/LS/SHH/PM D Day6 E E Day1 Day ** * ** N/7/DAPT % NKX.1-GFP No SHH PM SHH+PM NKX.1-GFP % No SHH SHH+PM ASL1 NHLH NKX.1 OTP SIM1 SF1 FOXG1 PAX6 NESTIN Figure S1. Early activation of SHH signaling and subsequent inhibition of Notch signaling induces the production of hypothalamic NKX.1 progenitors. (A) Illution of the adult medial hypothalamus with region-related gene expression of hypothalamic markers based on published data(1, 16-1). AR: arcuate nucleus, VMN: ventromedial nucleus, PVN: paraventricular nucleus, LH: lateral hypothalamus, ME: median eminence. Markers on the left indicate the transcription factors expressed while markers on the right display the gene expressed in specific hypothalamic nuclei; (-) The timing of SHH influences the expression of NKX.1-GFP in day 6 differntiated Es. 11 conditions and 9 timings of SHH were indicated in while the actual expression of NKX.1-GFP were shown in for each condit; (D-E) FAS analysis of the percentage of NKX.1-GFP cells in day 6 Es treated with no SHH, um Purmorphamine (PM) and SHH 1ng/ml + μm PM from days 3 to 13 (D) and day 1 cells. N=1 for each bar; (E) from monolayer feeder-free differentiation with (n=3) or without (n=1) SHH 1ng/ml + um PM (from days 1-8). LS were used in both cases; (F) qpr of transcription factor genes in day 11 cells from three conditions (only differ from day 8 to day 11). N=3 for each bar.
4 NESTIN SOX1 FOXG1 Tra-1-6 Day 1 Day 4 Day 8 Day 1 Figure S. Temporal expression of transcription factors in early hypothalamic neuron induction and patterning. Immunocytochemical analysis of neuron progenitor markers and stem cell marker in cells of 1, 4, 8 and 1 days of differentiation. Tra-1-6 is a pluripotency marker. FOXG1 is a telencephalon progenitor markers. SOX1 and NESTIN are general markers for neuron progenitors. Scale bar, μm.
5 NKX.1 Day 4 GAD67 Day 46 GAD67 Day 4 Figure S3. -derived neurons express hypothalamic neuron markers. (A) Immunocytochemical analysis of day 4 differentiated neurons with alphamsh and NKX.1; () Immunostaining of day 46 neurons with and GAA; () Immunocytochemical analysis of day 4 neurons with alphamsh and GAD67. Scale bar,1μm.
6 F iotin iotin iotin D E F POM+ + POM- + POM- - mv ms current step Figure S4. Neurons made from hypothalamic NKX.1+ cells fire action potentials. Representative current clamp recordings and post hoc identification of POM+ or + neurons (days 4 to 33). After recording, cultures were fixed and stained for, and recorded cells (biotin+) cells identified with streptavidin-alexa-488.(a) POM++; () POM-+; () POM-- neurons. Left column of images: DI image (4x) of live cells prior to recording. Arrows indicate the recorded neurons.scale bar, 1μm; (D-F) Action potential firing in the neurons identified in (A ). Membrane potential traces in response to a 1s current step, as shown under trace (E), were recorded. The amplitude of the current step was dependent on the individual cell. (D) POM++ (neuron in A), (E) POM- + (neuron in ),(F) POM-- (neuron in ). Dashed lined = -6 mv. Total number of identified cells recorded: POM++ N= 3, POM-+ N=, POM-- N= 4.
7 Day1 Day 7 Day 8 luster1 GOTERM_P_FAT Term ount % P-Value E-15 GO:3595~tube development E E-11 luster gene expression E E-1 GO:45165~cell fate commitment E-8 development E-7 system development E-6 luster3 luster4 GOTERM_P_FAT Term ount % P-Value E-4 GO:749~cell cycle E-4 GO:4~cell cycle process E E : E-34 GO:43~cell cycle phase GO:767~mitosis E-8 GO:5131~cell division E E-3 luster5 luster6 PATHWAY ANALYSIS ategory Term ount % P-Value KEGG_PATHWAY hsa47: Neurotrophin signaling pathway E-4 KEGG_PATHWAY hsa491: GnRH signaling pathway P4379: eta3 adrenergic receptor P4391: Oxytocin receptor mediated P4374:5HT type receptor mediated P5915:Opioid proenkephalin pathway P4385:Histamine H1 receptor mediated luster7 luster8 P4378: eta adrenergic receptor P4386: Histamine H receptor mediated P15: ircadian clock system P5916: Opioid prodynorphin pathway POM AGRP SST Day1 4 6 Day Day4 4 Day36 5 Day OTP PMH 6 4 M3R M4R Figure S5. RNA sequencing of differentiated neurons reveals hypothalamic gene signatures. (A) Heatmap from hierarchical clustering analysis of RNA sequencing results from undifferentiated ; day1 neuron progenitors; days 7 and 8 of neuronal differentiation. Gene Ontology and pathway analysis were performed for genes in eight major clusters defined by the gene expression patterns according to all samples. Data are shown for Gene Ontology results for clusters 1 (highly expressed in day 1 progenitor cells) and 3 (highly expressed in s), and pathway analysis for the top hits in cluster 6 (highly expressed in differentiated neurons); () Temporal expression of hypothalamic transcripts during Nkx.1 GFP/W- neuronal differentiation. qpr analysis of RNA samples from, and cells at 1, 18, 4, 36 and 4 days of neuronal differentiation. N=3 for each bar.
8 -Leptin -Leptin A 15 INSR IRS 6 IRS4 FPKM 1 5 FPKM FPKM 4 Day 1 Day 5-7 Day 8 Day 1 Day 5-7 Day 8 Day 1 Day 5-7 Day 8 D Day 9 neurons E MAP p-stat3 F Normaolized to TP c-fos LEPR SOS3 No leptin 1ug/ml leptin +Leptin Day 35 +Leptin Day 53 G Day 35 Figure S6. Mouse cortical astrocyte co-culture induces leptin responsiveness of differentiated hypothalamic neurons. (A-) RNA-seq data for insulin signaling molecules INSR, IRS and IRS4 expression in, 1 (n=3), 5-7 (n=3) and 8 days of differentiated cells; (D) qpr analysis of LEPR and SOS3 in leptin-treated day 9 differentiated neurons (n=3); (E) Immunostaining for p-stat3 and MAP in leptin treated day 35 neurons. Scale bar, μm; (F) Immunocytochemical analysis for c-fos and in day 53 -derived hypothalamic neurons co-cultured with mouse astrocytes. Scale bar, 1μm; (G) Immunostaining of and in day 35 mouse astrocyte co-cultured neurons. Scale bar, 1μm.
9 SOX OT4 NANOG SSEA4 TRA-1-6 TRA-1-81 ontrol 1 ontrol S1A S1 S1 Ectoderm Mesoderm Endoderm x ontrol 1 ontrol 1 Neural rossett artilage Gut endocrine cells S1A artilage S1A Gut endocrine cells Neural epithelium Epidermis S1 S1 artilage Gut endocrine cells S1 artilage S1 Gut endocrine cells Neural epithelium Figure S7. All control and S ipss are pluripotent and have normal karyotypes. (A) Immunocytochemistry analysis of two control (ontrol 1, ontrol ) and three S (S1A, S1, S1) ipss with pluripotency markers as indicated. Scale bar, μm; () H&E staining of control and S ips-derived teratoma sections. We identified cell types representing all three germ layers in all ips-derived terotomas; Images were taken with x objective lens; () Karyotyping of control and S ips lines. All of these lines had normal karyotypes.
10 ontrol 1 Nkx.1 Hoechst ontrol S1A S1 S1 Day 1 POM POM SST EP ontrol 1 S1 Day 5 Day 5 EP EP ontrol S1 Day 5 Day 5 EP ontrol (day 3) S1 (day 35) S1A mv ms Day 5 urrent step urrent step Figure S8. Efficient generation of hypothalamic neurons from human ipss. (A) Immunostaining of NKX.1 in Day 1 progenitors derived from five independent ips lines: ontrol1, ontrol, S1A, S1 and S1; Scale bar, μm; () Immunostaining of day 5 neurons with hypothalamic neuron markers. Scale bar, 1μm; () Action potential firing in ontrol (day 3) and S1 (day 35) ips-derived neurons. Membrane potential traces in response to a 1s current step, as shown under trace, were recorded. Dashed lined = -6 mv.
SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.
Supplementary Table 2. Antibodies used for Immunofluoresence. Antibody Dilution Source Goat anti-pdx1 1:100 R&D Systems Rabbit anti-hnf6 1:100 Santa Cruz Biotechnology Mouse anti-nkx6.1 1:200 Developmental
Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols
Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols used to differentiate mouse ESCs. (b) Representative
Differentiation of hypothalamic-like neurons from human pluripotent stem cells
Differentiation of hypothalamic-like neurons from human pluripotent stem cells Liheng Wang,, Dieter Egli, Rudolph L. Leibel J Clin Invest. 2015;125(2):796-808. https://doi.org/10.1172/jci79220. Stem cells
Ophthalmology, Radiation Oncology,
Supporting Online Material Journal: Nature Neuroscience Article Title: Corresponding Author: All Authors: Affiliations: Tanycytes of the Hypothalamic Median Eminence Form a Diet- Responsive Neurogenic
Insulin-Leptin Interactions
Insulin-Leptin Interactions Ahmed S., Al-Azzam N., Cao B. Karshaleva B., Sriram S., Vu K. If you understand a system, you can predict it. Agenda - Energy homeostasis Overview of leptin and insulin Signaling
Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids
Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee
Single-cell RNA-Seq profiling of human pre-implantation embryos and embryonic stem cells
Single-cell RNA-Seq profiling of human pre-implantation embryos and embryonic stem cells Liying Yan,2,5, Mingyu Yang,5, Hongshan Guo, Lu Yang, Jun Wu, Rong Li,2, Ping Liu, Ying Lian, Xiaoying Zheng, Jie
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature06310 SUPPLEMENTARY INFORMATION www.nature.com/nature 1 www.nature.com/nature 2 www.nature.com/nature 3 Supplementary Figure S1 Spontaneous duration of wake, SWS and REM sleep (expressed
Supplementary Information
Supplementary Information Astrocytes regulate adult hippocampal neurogenesis through ephrin-b signaling Randolph S. Ashton, Anthony Conway, Chinmay Pangarkar, Jamie Bergen, Kwang-Il Lim, Priya Shah, Mina
Impact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice
Impact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice Shinichi Hosokawa 1,3,Kenichiro Furuyama 1,3, Masashi Horiguchi 1,3,Yoshiki
Hypothalamus. Small, central, & essential.
Hypothalamus Small, central, & essential. Summary: You can t live without a hypothalamus. Located at the junction between the brain stem and the forebrain Medial hypothalamus: interface between the brain
Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4
Fig. S1. Upregulation of K18 and K14 mrna levels during ectoderm specification of hescs. Quantitative real-time PCR analysis of mrna levels of OCT4 (n=3 independent differentiation experiments for each
Supplementary Figure 1
Supplementary Figure 1 Arcuate ChIEF-tdTomato neurons expressed TH These micrographs show that TH-Cre-ChIEF-tdTomato (magenta), expressed by AAV in a TH-Cre mouse, were immunostained with TH (green) in
Application of induced pluripotent stem (ips) cells in intractable childhood disorders
10th Annual World Congress on Pediatrics Application of induced pluripotent stem (ips) cells in intractable childhood disorders Lessons from Dravet synd. patient-derived ipscs Shinichi Hirose, MD, PhD
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11306 Supplementary Figures Supplementary Figure 1. Basic characterization of GFP+ RGLs in the dentate gyrus of adult nestin-gfp mice. a, Sample confocal images
Supplementary Information
Supplementary Information Supplementary Figure 1. Short-term coreceptor and costimulation blockade induces tolerance to pluripotent human ESCs. (A) Schematic diagram showing experimental approaches and
Supplementary Figure 1. Chimeric analysis of inner ears. (A-H) Chimeric inner ears with fluorescent ES cells and (I,J) Rainbow inner ears.
Supplementary Figure 1. himeric analysis of inner ears. (A-H) himeric inner ears with fluorescent ES cells and (I,J) Rainbow inner ears. (A,B) omposite images showing three colors in different vestibular
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
Examination of Thyrotropin-Releasing Hormone (TRH)-synthesizing System in the Rodent Hypothalamus
Examination of Thyrotropin-Releasing Hormone (TRH)-synthesizing System in the Rodent Hypothalamus Ph.D. Thesis Andrea Kádár Semmelweis University János Szentágothai Ph.D. School of Neuroscience Tutor:
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3200 Supplementary Figure 1 Expression analysis of stomach markers in gutlike structure. (a) Differentiation scheme of gut-like structure formation from embryonic stem cells. (b) RT-PCR
Cell Type Nervous System I. Developmental Readout. Foundations. Stem cells. Organ formation. Human issues.
7.72 10.11.06 Cell Type Nervous System I Human issues Organ formation Stem cells Developmental Readout Axes Cell type Axon guidance 3D structure Analysis Model + + organisms Foundations Principles 1 What
mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons
Supplemental Material mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons Antoine de Chevigny, Nathalie Coré, Philipp Follert, Marion Gaudin, Pascal
Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus
Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus a: Expression of Vimentin, GFAP, Sox2 and Nestin in anterior, central and posterior hypothalamus. In the anterior
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Human cerebral cortex development from pluripotent stem cells to functional excitatory synapses Yichen Shi 1,2, Peter Kirwan 1,2, James Smith 1,2, Hugh P.C. Robinson 3 and Frederick
BIOM2010 (till mid sem) Endocrinology. e.g. anterior pituitary gland, thyroid, adrenal. Pineal Heart GI Female
BIOM2010 (till mid sem) Endocrinology Endocrine system Endocrine gland : a that acts by directly into the which then to other parts of the body to act on (cells, tissues, organs) : found at e.g. anterior
Ingestive Behaviors 33. Introduction. Page 1. control and story lines. (a review of general endocrinology) Integration (or the basic reflex arc model)
Ingestive Behaviors 33 (a review of general endocrinology) A neuroendocrine system: components, a reflex arc, the endocrine system, the AN, endocrine / nervous systems as afferents and efferents, the theoretical
Teratoma Formation Pluripotency Analysis Report
Teratoma Formation Pluripotency Analysis Report Project and Customer Information Service Title: Teratoma formation pluripotency analysis Customer: PepGel LLC PI/Contact: Susan, Email: sun.pepgel@gmail.com
Cluster Dendrogram. dist(cor(na.omit(tss.exprs.chip[, c(1:10, 24, 27, 30, 48:50, dist(cor(na.omit(tss.exprs.chip[, c(1:99, 103, 104, 109, 110,
A Transcriptome (RNA-seq) Transcriptome (RNA-seq) 3. 2.5 2..5..5...5..5 2. 2.5 3. 2.5 2..5..5...5..5 2. 2.5 Cluster Dendrogram RS_ES3.2 RS_ES3. RS_SHS5.2 RS_SHS5. PS_SHS5.2 PS_SHS5. RS_LJ3 PS_LJ3..4 _SHS5.2
Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
Genesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1.
Genesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1. Youngsoo Lee, Sachin Katyal, Yang Li, Sherif F. El-Khamisy, Helen R. Russell, Keith W. Caldecott and Peter J. McKinnon.
Fig. S4. Current-voltage relations of iglurs. A-C: time courses of currents evoked by 100 ms pulses
Fig. S1. Immunohistochemical detection of iglur2 protein in single islet cells. A: α cells identified using glucagon-specific antibody express the iglur2 subtype of AMPA receptor. 24 out of 26 identified
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,
Supplementary Figure 1: Validation of labeling specificity of immature OSNs and presynaptic terminals. (A) (B) (C) (D) (E)
Supplementary Figure 1: Validation of labeling specificity of immature OSNs and presynaptic terminals. (A) Confocal images of septal olfactory epithelium of an adult Gγ8-sypGFP-tdTom mouse showing colocalization
BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects.
Supplementary Figure 1 BMI risk SNPs associate with increased CADM1 and CADM2 expression in the cerebellum of human subjects. Boxplots show the 25% and 75% quantiles of normalized mrna expression levels
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 2 3 4 SUPPLEMENTARY TABLES Supplementary Table S1. Brain Tumors used in the study Code Tumor Classification Age Gender HuTuP51 Glioblastoma 57 Male HuTuP52 Glioblastoma 53 Male
Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway
Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.
Prss56, a novel marker of adult neurogenesis in the mouse brain. - Supplemental Figures 1 to 5- Brain Structure and Function
Prss56, a novel marker of adult neurogenesis in the mouse brain - Supplemental Figures 1 to 5- Brain Structure and Function Alexandre Jourdon 1,2, Aurélie Gresset 1, Nathalie Spassky 1, Patrick Charnay
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Atlas representations of the midcingulate (MCC) region targeted in this study compared against the anterior cingulate (ACC) region commonly reported. Coronal sections are shown on
Forming Embryonic-Like Nervous Tissues and Organs by Muscle-Derived Neuroepithelial Myogenic Progenitors
American Journal of Psychiatry and Neuroscience 2016; 4(5): 79-86 http://www.sciencepublishinggroup.com/j/ajpn doi: 10.11648/j.ajpn.20160405.13 ISSN: 2330-4243 (Print); ISSN: 2330-426X (Online) Forming
Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and
Supplemental methods Real-time quantitative RT-PCR and Semi-quantitative PCR Total RNA was extracted from the stomach, liver, pancreas, pituitary, and hypothalamus as previously described (). Primers and
Zhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
REPRODUCTIVE ENDOCRINOLOGY OF THE MALE
Reproductive Biotechnologies Andrology I REPRODUCTIVE ENDOCRINOLOGY OF THE MALE Prof. Alberto Contri REPRODUCTIVE ENDOCRINOLOGY OF THE MALE SPERMATOGENESIS AND REPRODUCTIVE BEHAVIOR RELATED TO THE ACTIVITY
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with
MPB333:Molecular Endocrinology of Obesity and Diabetes
MPB333:Molecular Endocrinology of Obesity and Diabetes The Use of Stem Cells as a Cure for Type 1 Diabetes January 15, 2010 Trish Labosky 9415C MRBIV trish.labosky@vanderbilt.edu In theory. 2. ~Easy and
Endocrine Glands. Endocrine glands
ENDOCRINOLOGY Endocrine Glands Endocrine glands Produce substances called hormones. Ductless glands, i.e., they release hormones directly into the bloodstream Hormones only act at their target tissue where
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
In vivo reprogramming reactive glia into ipscs to produce new neurons in the
In vivo reprogramming reactive glia into ipscs to produce new neurons in the cortex following traumatic brain injury Xiang Gao 1, Xiaoting Wang 1, Wenhui Xiong 1, Jinhui Chen 1, * 1 Spinal Cord and Brain
Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
Nature Neuroscience: doi: /nn Supplementary Figure 1. MADM labeling of thalamic clones.
Supplementary Figure 1 MADM labeling of thalamic clones. (a) Confocal images of an E12 Nestin-CreERT2;Ai9-tdTomato brain treated with TM at E10 and stained for BLBP (green), a radial glial progenitor-specific
Stage 5: Immature endocrine Stage 4 cells were cultured for seven days in DM-F12 medium supplemented with 1% B27 and 1 µm ALK5 inhibitor.
Supplemental Data Research Design and Methods Differentiation of Human ES Cells Stage 1: Mesoendoderm 60-70% confluent adherent cultures of undifferentiated H1 cells plated on 1:30 Matrigel coated surfaces
Supplementary Figure 1
Supplementary Figure 1 The average sigmoid parametric curves of capillary dilation time courses and average time to 50% peak capillary diameter dilation computed from individual capillary responses averaged
Figure S1, Beyer et al.
Figure S1, eyer et al. Pax7 Myogenin si sitrl Hoechst T = 72h 14 1.8.6.4.2 12 1 8 6 4 2 24h 48h 96h diff. sitrl siset1 212 72h diff. b1 td r t Se km MyH Vinculin Myogenin β-ctin Vinculin MW b1 ka td r
Neuroendocrinology an integrative approach
Neuroendocrinology an integrative approach JP Advis DVM, Ph.D. Bartlett Hall, Animal ciences, Cook, (848) 932-9240, advis@aesop.rutgers.edu 06 Course website: rci.rutgers.edu/~advis Material to be covered:
Interactions between bone and the central nervous system Florent Elefteriou, PhD
Interactions between bone and the central nervous system Florent Elefteriou, PhD Department of Medicine Center for Bone Biology VANDERBILT UNIVERSITY Nashville, USA BONE REMODELING Bone marrow cells Estrogen
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
Temperature, Regulation, Thirst, and Hunger
PSYB64 Lecture 6 Temperature, Regulation, Thirst, and Hunger 1. Homeostasis 2. Temperature 3. Thirst 4. Hunger 5. Obesity & Hunger Disorders HOMEOSTASIS Homeostasis: Physiological equilibrium Motivation:
Stem Cells and the Study of Neurodegeneration. Tracy Young-Pearse, PhD September 12, 2014!
Stem Cells and the Study of Neurodegeneration Tracy Young-Pearse, PhD September 12, 2014! Techniques for studying mechanisms of neurological disease Animal models Human subjects Postmortem analyses, imaging
Internal Regulation II Energy
Internal Regulation II Energy Reading: BCP Chapter 16 lookfordiagnosis.com Homeostasis Biologically, what is necessary for life is a coordinated set of chemical reactions. These reactions take place in
ProteoScan Cancer Lysate Arrays. QC and Validation Data
ProteoScan Cancer Lysate Arrays QC and Validation Data 4.5 mm Barcode Cancer Lysate Array Layout PA02 60 mm B1 C2 K3 Ly1 O2 P3 Mel1 Lv2 St3 B2 C3 L1 Ly2 O3 Pr1 Mel2 Lv3 B3 K1 L2 Ly3 P1 Pr2 Mel3 St1 C1
Cell therapeutics for the Insulin-Dependent Diabetes Mellitus
Cell therapeutics for the Insulin-Dependent Diabetes Mellitus Haekwon Kim Dept. of Biotechnology Seoul Women s University Introduction Type I diabetes is caused by the autoimmune destruction of pancreatic
Supplemental Figure 1. Isolation and characterization of CD133+ neurosphere-like
SUPPLEMENTL FIGURE LEGENDS Supplemental Figure 1. Isolation and characterization of CD133+ neurosphere-like spheroids from a human brain tumor sample or glioma xenograft. () CD133+ tumor cells isolated
DISCLOSURES FUNCTIONS OF THE HYPOTHALAMUS
NOVEL THERAPEUTIC TARGETS: THE HYPOTHALAMUS Andrew Charles, M.D. Professor Director, UCLA Goldberg Migraine Program Meyer and Renee Luskin Chair in Migraine and Headache Studies David Geffen School of
Martínez, Schwartz, Smale & Nunez
I. Artículos Martínez, Schwartz, Smale & Nunez 12 Circadian regulation of daily rhythms in orexinergic neurons Circadian regulation of daily rhythms in orexinergic neurons in diurnal and nocturnal rodents
Neocortex Zbtb20 / NFIA / Sox9
Neocortex / NFIA / Sox9 Supplementary Figure 1. Expression of, NFIA, and Sox9 in the mouse neocortex at. The lower panels are higher magnification views of the oxed area. Arrowheads indicate triple-positive
Cell Birth and Death. Chapter Three
Cell Birth and Death Chapter Three Neurogenesis All neurons and glial cells begin in the neural tube Differentiated into neurons rather than ectoderm based on factors we have already discussed If these
CNS Control of Food Intake. Adena Zadourian & Andrea Shelton
CNS Control of Food Intake Adena Zadourian & Andrea Shelton Controlling Food Intake Energy Homeostasis (Change in body adiposity + compensatory changes in food intake) Background Information/Review Insulin
ENDOCRINE SYSTEM. Endocrine
ENDOCRINE SYSTEM Endocrine Function Help regulate internal functions Use chemical messengers Recall: Endocrine vs. Exocrine glands Nervous System vs Endocrine System Target Specificity Lock n Key action
SUPPLEMENTARY INFORMATION
SUPPLMNTRY INFORMTION OI: 1.138/ncb2411 mbryoid ody Formation Pluripotent ells Multipotent Progenitor ells day ispase Formation day 7 replating s day 12 MP p1 day 17 MP p2 day 27 MP p4 mbryoid bodies d7
Brain Development III
Brain Development III Neural Development In the developing nervous system there must be: 1. The formation of different regions of the brain. 2. The ability of a neuron to differentiate. 3. The ability
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2638 Figure S1 Morphological characteristics of fetal testes and ovaries from 6.5-20 developmental weeks. Representative images of Hematoxylin and Eosin staining of testes and ovaries over
-51mV 30s 3mV. n=14 n=4 p=0.4. Depolarization (mv) 3
Supplementary Figure 1 a optoβ 2 -AR b ChR2-51mV 30s 3mV -50mV 30s 3mV c 4 n=14 n=4 p=0.4 Depolarization (mv) 3 2 1 0 Both optogenetic actuators, optoβ 2 AR and ChR2, were effective in stimulating astrocytes
SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.
Supplementary Data SUPPLEMENTARY FIG. S1. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of anpcs. A panel of lineage-specific markers were used
Boucher et al NCOMMS B
1 Supplementary Figure 1 (linked to Figure 1). mvegfr1 constitutively internalizes in endothelial cells. (a) Immunoblot of mflt1 from undifferentiated mouse embryonic stem (ES) cells with indicated genotypes;
GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!
Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain
The Obesity Susceptibility Gene Carboxypeptidase E Links FoxO1 Signaling in Hypothalamic Pro opiomelanocortin Neurons with Regulation of Food Intake
Plum et al., Supplementary online material The Oesity Suseptiility Gene Caroxypeptidase E Links FoxO1 Signaling in Hypothalami Pro opiomelanoortin Neurons with Regulation of Food Intake Leona Plum, Hua
Supplementary Fig. 1 Blocking shh function at the protein level confirms its role as a guidance cue for postcommissural axons.
Supplementary Fig. 1 Blocking shh function at the protein level confirms its role as a guidance cue for postcommissural axons. As an alternative method to demonstrate the role of shh as a guidance cue
Supplementary Figure 1. A microarray screen of organizers compared to non-organizer tissue reveals a putative organizer gene set.
Supplementary Figure 1. A microarray screen of organizers compared to non-organizer tissue reveals a putative organizer gene set. (a, b) Venn diagrams of 31 enriched (a) and 17 depleted (b) genes significantly
Research programs involving human early embryos
Research programs involving human early embryos 1. Understanding normal mammalian embryo development 2. Understanding errors in genetic and epigenetic programs 3. Providing research and therapeutic tools
NROSCI/BIOSC 1070 and MSNBIO 2070 September 11, 2017 Control Mechanisms 2: Endocrine Control
NROSCI/BIOSC 1070 and MSNBIO 2070 September 11, 2017 Control Mechanisms 2: Endocrine Control Hormones are chemical messengers that are secreted into the blood by endocrine cells or specialized neurons.
Supplemental Materials. Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in. Pancreatic Cancer.
Supplemental Materials Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in Pancreatic Cancer Jun Zhao 1, Zhilan Xiao 2, 3, Tingting Li 1, 4, Huiqin Chen 5, Ying Yuan 5, Alan
Supplementary information. Nkx2.1 regulates the generation of telencephalic astrocytes during embryonic
Supplementary information Nkx2.1 regulates the generation of telencephalic astrocytes during embryonic development Shilpi Minocha 1*, Delphine Valloton 1*, Yvan Arsenijevic 2, Jean-René Cardinaux 3, Raffaella
FLASH CARDS. Kalat s Book Chapter 10 Alphabetical
FLASH CARDS www.biologicalpsych.com Kalat s Book Chapter 10 Alphabetical AgRP AgRP Agouti-related peptide; synthesized in hypothalamus. Acts as an appetite stimulator. Also decreases metabolism. aldosterone
Supplemental Information. Cell-Autonomous Regulation of Astrocyte. Activation by the Circadian Clock Protein BMAL1
ell Reports, Volume 5 Supplemental Information ell-utonomous Regulation of strocyte ctivation by the ircadian lock Protein ML1 rian V. Lananna, ollin J. Nadarajah, Mariko Izumo, Michelle R. edeño, avid.
Ingestive Behaviors 21. Introduction. Page 1. control and story lines. (a review of general endocrinology) Integration (or the basic reflex arc model)
Ingestive Behaviors 21 (a review of general endocrinology) A neuroendocrine system: components, a reflex arc, the endocrine system, the AN, endocrine / nervous systems as afferents and efferents, the theoretical
Neuroepithelial Cells and Neural Differentiation
Neuroepithelial Cells and Neural Differentiation Neurulation The cells of the neural tube are NEUROEPITHELIAL CELLS Neural crest cells migrate out of neural tube Neuroepithelial cells are embryonic stem
Supplementary Figure S1: Pial and periventricular vascular networks and the dual GABA neuron streams of the early embryonic mouse telencephalon
Supplementary Figure S1: Pial and periventricular vascular networks and the dual GABA neuron streams of the early embryonic mouse telencephalon a) The profile of GABA neurons arriving at the pallial-subpallial
Effect of neonatal treatment with MSG (Monosodium glutamate) on thyroid of the adult male rats
Histol Histopathol (1 999) 14: 63-67 http://www.ehu.es/histol-histopathol Histology and Histopathology Effect of neonatal treatment with MSG (Monosodium glutamate) on thyroid of the adult male rats B.
SUPPLEMENTARY INFORMATION
b 350 300 250 200 150 100 50 0 E0 E10 E50 E0 E10 E50 E0 E10 E50 E0 E10 E50 Number of organoids per well 350 300 250 200 150 100 50 0 R0 R50 R100 R500 1st 2nd 3rd Noggin 100 ng/ml Noggin 10 ng/ml Noggin
Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen,
Cell Stem Cell, Volume 7 Supplemental Information Adult SVZ Lineage Cells Home to and Leave the Vascular Niche via Differential Responses to SDF1/CXCR4 Signaling Erzsebet Kokovay, Susan Goderie, Yue Wang,
Glioblastoma Multiforme
Glioblastoma Multiforme Highly malignant, invasive, difficult-to-treat primary brain tumor" " Frequency: 9,000 cases/year (peak age, 55 65 years)" " Recurrence: rapid growth; size may double every 10 days"
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
Controlled induction of human pancreatic progenitors produces functional beta-like cells in vitro
rticle ontrolled induction of human pancreatic progenitors produces functional beta-like cells in vitro Holger Russ 1, udrey V Parent 1, Jennifer J Ringler 1, Thomas G Hennings 1, Gopika G Nair 1, Mayya
The Pathology of Germ Cell Tumours of the Ovary
The Pathology of Germ Cell Tumours of the Ovary Professor Mike Wells University of Sheffield Amman, Jordan November 2013 Professor Francisco Paco Nogales I. Primitive germ cell tumors A. Dysgerminoma
Orexin and Sleep. Team: A Little Bit of Leptin
Orexin and Sleep Team: A Little Bit of Leptin Intro to Orexin 1997 -Scripps Research Institute gene expression in the hypothalamus Found gene clone 35 - expression limited to the lateral hypothalamus NTs
Columbia College of P&S Sarah Huang Hans Snoeck biorxiv ; doi: https://doi.org/ /261461
Generation of pulmonary neuroendocrine cells and tumors resembling small cell lung cancers from human embryonic stem cells Weill Cornell Medicine Joyce Chen Arun Unni Harold Varmus Asaf Poran Olivier Elemento
Unique functional properties of somatostatin-expressing GABAergic neurons in mouse barrel cortex
Supplementary Information Unique functional properties of somatostatin-expressing GABAergic neurons in mouse barrel cortex Luc Gentet, Yves Kremer, Hiroki Taniguchi, Josh Huang, Jochen Staiger and Carl
Development Team. Department of Zoology, University of Delhi. Department of Zoology, University of Delhi
Paper Module : 06 : 17 Development Team Principal Investigator : Prof. Neeta Sehgal Department of Zoology, University of Delhi Co-Principal Investigator : Prof. D.K. Singh Department of Zoology, University
A Cxcl12-Cxcr4 Chemokine Signaling Pathway Defines
Supplemental Data A Cxcl12-Cxcr4 Chemokine Signaling Pathway Defines the Initial Trajectory of Mammalian Motor Axons Ivo Lieberam, Dritan Agalliu, Takashi Nagasawa, Johan Ericson, and Thomas M. Jessell
Hypothalamus & pituitary gland
Hypothalamus & pituitary gland Huiping Wang ( 王会平 ), PhD Department of Physiology Rm C541, Block C, Research Building, School of Medicine Tel: 88208292 Outline Hypothalamus Relationship between the hypothalamus