gliomas. Fetal brain expected who each low-

Size: px
Start display at page:

Download "gliomas. Fetal brain expected who each low-"

Transcription

1 Supplementary Figure S1. Grade-specificity aberrant expression of HOXA genes in gliomas. (A) Representative RT-PCR analyses of HOXA gene expression in human astrocytomas. Exemplified glioma samples include four WHO grade 4 glioblastomas (GBM 4, GBM 5, GBM 3, GBM 6), three WHO grade 2 astrocytomas (A-1, A-2, A3), and one WHO grade 3 anaplastic astrocytoma (AA-1). Fetal brain white (FBW) matter was used as a non-tumoral control; HEK 293T cells (293T) were used as positive control. The criterion for assessment of positive versus negative gene expression was based on the presence or absence of specific PCR bands at the expected molecular weights, respectively. In some instances, non-specific PCR bands weree also detected at incorrect molecular weights on repeated experiments (e.g. HOXA5 and HOXA11 in FBW); such bands were thus not consideredd to correspond to positive expression. HOXA1 and HOXA9 genes present two specific PCR bands, representing two alternative splicing variants. GBM samples show strikingly higher activation of HOXA genes as compared to lower grade gliomas or normal brain tissue. (B) HOXA9 expression analysis by RT-PCRR in primary-recurrent astrocytoma (WHO grade 2). The time interval reflects the time from initial surgery for a low-grade astrocytoma to the time of surgery for tumor recurrence, each diagnosed histologically as glioblastoma (WHO grade 4). Note that the tumor pairs from three patients who each initially presented with low-grade low-

2 grade primary tumors demonstrate absence or negligible expression of HOXA9, while all the three high-grade recurrences show significant expression of HOXA9. (C) HOXA9 expression analysis by RT-PCR in seven recurrent low-grade infiltrative gliomas (lanes 1-7), a positive control (lane 8) and a negative control (Water). Each tumor was initially diagnosed as a WHO grade 2 astrocytoma and remained a WHO grade 2 at recurrence. Prior to resection of the recurrent tumor, five of the patients were treated with external beam radiation therapy and three were treated with chemotherapy. Expression of HOXA9 was not detected in any of the WHO grade 2 astrocytoma recurrences, suggesting that HOXA9 activation is not therapy-related.

3 Supplementary Figure S2. HOXB, HOXC, and HOXD gene clusters demonstrate chromosomal domains of transcriptional activation in the UCSF tumor set. (A to C) Gene expression heat maps centered on HOXB, HOXC, and HOXD clusters and extending 1 Mb in each direction for the UCSF tumor set (37 GBMs) demonstrates HOX gene domains of activation resembling those detected for the HOXA cluster. Genes contained in boundaries flanking the activation domains are relatively silent. For each heat map, the gray side

4 bar indicates the estimated boundaries of the activation domain. The colored horizontal bar across the top of the heat map indicates which tumors express HOXA9 (blue, high expression; yellow, low or no expression). Red and green colors reflect high and low/no expression of each gene, respectively.

5 Supplementary Figure S3. HOXB, HOXC, and HOXD gene clusters demonstrate chromosomal domains of transcriptional activation in the MDA tumor set. (A to C) Gene expression heat maps centered on HOXB, HOXC, and HOXD clusters for the MDA tumor set (63 GBMs), analyzed and represented as in Figure S2. White color corresponds to samples for which the expression status could not be assigned with high (>95%) confidence.

6 Supplementary Figure S4. Aberrant transcriptional activation across HOX clusters in glioblastoma does not recapitulate the co-linear expression pattern of HOX genes during embryonic development. (A and B) Gene expression heat maps were generated for the two sets of glioblastomas, 37 from UCSF (A) and 63 from MDA (B). Clustering tumors using Euclidian distance suggests two primary tumor groups displaying HOX-activated or HOX inactive expression patterns. The colored horizontal bar across the top of the heat map indicates which tumors express HOXA9 (blue, high expression; yellow, low or no expression). Red and green colors reflect high and low/no expression of each gene, respectively. White color corresponds to samples for which the expression status could not be assigned with high (>95%) confidence. Note that the highly ordered HOX gene expression patterns observed during development are not recapitulated by the tumors with aberrant HOX gene expression.

7 Supplementary Figure S5. The PI3K pathway regulates HOXA9 expression in glioblastoma cells. (A) Quantitative real-time PCR (qpcr) assessment of HOXA9 mrna expression levels in A172 cells following treatment with the PI3K inhibitor, LY294002, for time points ranging from 1 to 24 hours. Also included are measurements of HOXA9 levels after treatment of A172 cells with LY for 24 hours and followed by incubation with media lacking LY for 8, 24 and 32 hours. Expression levels were normalized to hgus, a housekeeping gene with relatively constant levels of expression. A significant decrease in HOXA9 mrna levels occurs as early as

8 4 hours following treatment with LY HOXA9 levels return to pre-treatment levels 32 hours after LY removal. The results are representative of 3 independent experiments. * P<0.05, 2-sided Student s t-test (P<0.001 at 4h; P<0.001 at 8h; P=0.002 at 24h; P=0.008 at 24+8h; P<0.001 at 24+24h). (B) A172 cells were treated with LY for 24 hours and HOXA9 protein levels assessed by immunoblot analysis. PI3K inhibition resulted in a marked decrease of HOXA9 protein levels in A172 cells, which is consistent with our findings of PI3K-mediated regulation of HOXA9 transcription. α-tubulin was used as an internal loading control. The results are representative of 3 independent experiments for each blot. (C) Treatment of A172 cells with rapamycin for 24 hours resulted in successful inhibition of mtor activity as assessed by decreased levels of phosphorylated p70/p85 S6Kinase, a downstream target of mtor-mediated phosphorylation. The 2 bands indicate both p70 and p85 isoforms of the same kinase. HOXA9 protein levels were not affected by mtor inhibition, supporting our hypothesis that mtor is not a major mediator of PI3K-regulation of HOXA gene expression. Total levels of p70/p85 S6Kinase and α-tubulin were used as internal loading controls. The results are representative of 3 independent experiments for each blot. (D and E) Quantitative real-time PCR (qpcr) assessment of HOXA9 expression levels in A172 cells and two sublines of a primary GBM grown in neurosphere conditions (NSP_7030/SF and NSP_7081/GS2-3), deleted at the PTEN locus (data not shown), following treatment with the PI3K inhibitor, LY (D), or the mtor inhibitor, rapamycin (E), for 24 hours. Expression levels of HOXA9 were normalized to human GUS (hgus), a housekeeping gene with relatively constant levels of expression. The relative gene expression levels of control-treated cells were normalized to 100% to facilitate the comparisons. A significant decrease in HOXA9 mrna levels occurred following treatment with LY in both A172 cells (*P<0.001) and GBM-derived neurosphere cell lines (NSP_7030, *P=0.021; NSP_7081, *P=0.049). In contrast, rapamycin treatment did not show a consistent effect on HOXA9 transcriptional levels across the tested cell lines (NSP_7030, *P=0.011). The results are representative of 3 independent experiments.

9 Supplementary Figure S6. HOXA9 expression status improves MGMT-based prediction of progression-free survival of glioblastoma patients from the UCSF tumor set. (A) Kaplan-Meier progression-free survival curve for 43 GBM patients from UCSF (including cases used for expression array analysis and those used for initial assessment of HOXA expression) whose tumors demonstrated (green line) or lacked (red line) MGMT promoter methylation. Patients whose tumors had methylation of the MGMT promoter had a trend toward longer progression-free survival (P=0.060). (B) Kaplan-Meier progression-free survival curve for the same set as in (A), based on HOXA9 expression and MGMT promoter methylation status. Patients whose tumors expressed HOXA9 and/or lacked methylation of the MGMT promoter (red line) had a significantly shorter progression-free survival (P=0.001) than patients whose tumors did not express HOXA9 and had a methylated MGMT promoter (green line). (C) Kaplan-Meier progression-free survival curve for the 24 patients whose tumors demonstrated MGMT promoter methylation, stratified based on whether or not the tumors expressed HOXA9.

10 Expression of HOXA9 was associated with significantly shorter progression-free survival (P<0.001), even considering only the patients with a methylated MGMT promoter.

11 Supplementary Figure S7. Examples of methylation-specific PCR (MSP) analysis of the MGMT promoter for glioblastoma tumor tissue from three patients (lanes 1 to 3) and a fetal brain specimen with DNA either untreated (F. Brain) or in vitro methylated with SssI (SssI F. Brain). Note the presence of bands in both the unmethylated (U) and methylated (M) lanes for glioblastoma samples #1 and #3, reflecting MGMT promoter methylation. The lack of a band in the lane corresponding to methylation-specific primers for glioblastoma sample #2 reflects a lack of MGMT promoter methylation. PCR reactions in the absencee of DNA ( H 2 O) were performed as negative controls for both the unmethylation and methylation reactions.

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured

More information

Cancer Treatment by Alternating Electric Fields (TTFields); Physical Basis & Clinical Trial Results. Madrid, March 2015

Cancer Treatment by Alternating Electric Fields (TTFields); Physical Basis & Clinical Trial Results. Madrid, March 2015 1 Cancer Treatment by Alternating Electric Fields (TTFields); Physical Basis & Clinical Trial Results Madrid, March 2015 2 Cancer Treatments Surgical - whenever possible, Effective mostly in Early stages,

More information

Supplementary Information

Supplementary Information Supplementary Information Temozolomide suppresses MYC via activation of TAp63 to inhibit progression of human glioblastoma Tomohiro Yamaki, Yusuke Suenaga, Toshihiko Iuchi, Jennifer Alagu, Atsushi Takatori,

More information

Corporate Medical Policy

Corporate Medical Policy Corporate Medical Policy Analysis of MGMT Promoter Methylation in Malignant Gliomas File Name: Origination: Last CAP Review: Next CAP Review: Last Review: analysis_of_mgmt_promoter_methylation_in_malignant_gliomas

More information

Supplementary Information

Supplementary Information Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10866 a b 1 2 3 4 5 6 7 Match No Match 1 2 3 4 5 6 7 Turcan et al. Supplementary Fig.1 Concepts mapping H3K27 targets in EF CBX8 targets in EF H3K27 targets in ES SUZ12 targets in ES

More information

PI3-Kinase Signaling. Rational Incorporation of Novel Agents into Multimodality Therapy. PI3-kinase. PI3-kinase 5/2/2010

PI3-Kinase Signaling. Rational Incorporation of Novel Agents into Multimodality Therapy. PI3-kinase. PI3-kinase 5/2/2010 Rational Incorporation of Novel Agents into Multimodality Therapy I3-Kinase Signaling EGF IRS1 I3K EGFR I2 I3 TEN Rictor GßL AKT RAS40 Survival Raptor GßL Daphne Haas-Kogan UCSF Annual Course April 30-May

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Bredel M, Scholtens DM, Yadav AK, et al. NFKBIA deletion in

More information

Nature Genetics: doi: /ng.2995

Nature Genetics: doi: /ng.2995 Supplementary Figure 1 Kaplan-Meier survival curves of patients with brainstem tumors. (a) Comparison of patients with PPM1D mutation versus wild-type PPM1D. (b) Comparison of patients with PPM1D mutation

More information

SUPPLEMENTARY FIGURES: Supplementary Figure 1

SUPPLEMENTARY FIGURES: Supplementary Figure 1 SUPPLEMENTARY FIGURES: Supplementary Figure 1 Supplementary Figure 1. Glioblastoma 5hmC quantified by paired BS and oxbs treated DNA hybridized to Infinium DNA methylation arrays. Workflow depicts analytic

More information

High expression of cellular retinol binding protein-1 in lung adenocarcinoma is associated with poor prognosis

High expression of cellular retinol binding protein-1 in lung adenocarcinoma is associated with poor prognosis High expression of cellular retinol binding protein-1 in lung adenocarcinoma is associated with poor prognosis Supplementary Material Supplementary Figure S1. Representative CRBP-1 immunostaining of non-neoplastic

More information

Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the

Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the deep dermis. (b) The melanocytes demonstrate abundant

More information

Nature Genetics: doi: /ng Supplementary Figure 1. SEER data for male and female cancer incidence from

Nature Genetics: doi: /ng Supplementary Figure 1. SEER data for male and female cancer incidence from Supplementary Figure 1 SEER data for male and female cancer incidence from 1975 2013. (a,b) Incidence rates of oral cavity and pharynx cancer (a) and leukemia (b) are plotted, grouped by males (blue),

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Phenotypic characterization of MES- and ADRN-type cells.

Nature Genetics: doi: /ng Supplementary Figure 1. Phenotypic characterization of MES- and ADRN-type cells. Supplementary Figure 1 Phenotypic characterization of MES- and ADRN-type cells. (a) Bright-field images showing cellular morphology of MES-type (691-MES, 700-MES, 717-MES) and ADRN-type (691-ADRN, 700-

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study. mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes

More information

S1 Appendix: Figs A G and Table A. b Normal Generalized Fraction 0.075

S1 Appendix: Figs A G and Table A. b Normal Generalized Fraction 0.075 Aiello & Alter (216) PLoS One vol. 11 no. 1 e164546 S1 Appendix A-1 S1 Appendix: Figs A G and Table A a Tumor Generalized Fraction b Normal Generalized Fraction.25.5.75.25.5.75 1 53 4 59 2 58 8 57 3 48

More information

Supplementary Information

Supplementary Information Supplementary Information - chimeric fusion transcript in human gastric cancer promotes tumorigenesis through activation of PI3K/AKT signaling Sun Mi Yun, Kwiyeom Yoon, Sunghoon Lee, Eunjeong Kim, Seong-Ho

More information

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description: File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'

More information

Nature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity.

Nature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity. Supplementary Figure 1 HOX fusions enhance self-renewal capacity. Mouse bone marrow was transduced with a retrovirus carrying one of three HOX fusion genes or the empty mcherry reporter construct as described

More information

supplementary information

supplementary information DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served

More information

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze

More information

Examining large groups of cancer patients to identify ways of predicting which therapies cancers might respond to.

Examining large groups of cancer patients to identify ways of predicting which therapies cancers might respond to. Stratified Medicine Examining large groups of cancer patients to identify ways of predicting which therapies cancers might respond to. Looking in detail at cancer cells and their genetic make up. Permit

More information

SALSA MLPA probemix P315-B1 EGFR

SALSA MLPA probemix P315-B1 EGFR SALSA MLPA probemix P315-B1 EGFR Lot B1-0215 and B1-0112. As compared to the previous A1 version (lot 0208), two mutation-specific probes for the EGFR mutations L858R and T709M as well as one additional

More information

Biomarker development in the era of precision medicine. Bei Li, Interdisciplinary Technical Journal Club

Biomarker development in the era of precision medicine. Bei Li, Interdisciplinary Technical Journal Club Biomarker development in the era of precision medicine Bei Li, 23.08.2016 Interdisciplinary Technical Journal Club The top ten highest-grossing drugs in the United States help between 1 in 25 and 1 in

More information

Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.

Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. Supplementary Figure 1 Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. (a) Breeding scheme. R26-LSL-SB11 homozygous mice were bred to Trp53 LSL-R270H/+

More information

SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.

SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al. s1 A Pten flox/flox () SOPten flox/flox () flox allele 6. kb B Pten flox/flox () SOPten flox/flox () Pten Actin! allele 2.3 kb Supplementary Figure S1. Yanagi, et al. A B BrdU BrdU positive cells ( ) 3

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers).

iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). Supplementary Materials Supplementary Methods iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). IDH1 R132H and R132L Forward:

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

More information

PRINCESS MARGARET CANCER CENTRE CLINICAL PRACTICE GUIDELINES

PRINCESS MARGARET CANCER CENTRE CLINICAL PRACTICE GUIDELINES PRINCESS MARGARET CANCER CENTRE CLINICAL PRACTICE GUIDELINES CENTRAL NERVOUS SYSTEM ANAPLASTIC GLIOMAS CNS Site Group Anaplastic Gliomas Author: Dr. Norm Laperriere Date: February 20, 2018 1. INTRODUCTION

More information

Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with

Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with Coomassie brilliant blue. One µg/ml recombinant human (rh) apo-e

More information

SUPPLEMENTARY FIGURES AND TABLES

SUPPLEMENTARY FIGURES AND TABLES SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non

More information

Supplemental Information. Molecular, Pathological, Radiological, and Immune. Profiling of Non-brainstem Pediatric High-Grade

Supplemental Information. Molecular, Pathological, Radiological, and Immune. Profiling of Non-brainstem Pediatric High-Grade Cancer Cell, Volume 33 Supplemental Information Molecular, Pathological, Radiological, and Immune Profiling of Non-brainstem Pediatric High-Grade Glioma from the HERBY Phase II Randomized Trial Alan Mackay,

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

Supporting Information

Supporting Information Supporting Information Vaira et al. 10.1073/pnas.0907676107 0h 24h 48h PTEN pathway Expression 0h 24h 48h Time MAP Kinase Signaling Pathway Expression 0h 24h 48h Time Collagen Expression Fig. S1. Differential

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Supplementary Material

Supplementary Material Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental

More information

Plasma exposure levels from individual mice 4 hours post IP administration at the

Plasma exposure levels from individual mice 4 hours post IP administration at the Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent

More information

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.

More information

Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors

Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA

More information

Phospho-AKT Sampler Kit

Phospho-AKT Sampler Kit Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody

More information

Radioterapia no Tratamento dos Gliomas de Baixo Grau

Radioterapia no Tratamento dos Gliomas de Baixo Grau Radioterapia no Tratamento dos Gliomas de Baixo Grau Dr. Luis Souhami University Montreal - Canada Low Grade Gliomas Relatively rare Heterogeneous, slow growing tumors WHO Classification Grade I Pilocytic

More information

Clustered mutations of oncogenes and tumor suppressors.

Clustered mutations of oncogenes and tumor suppressors. Supplementary Figure 1 Clustered mutations of oncogenes and tumor suppressors. For each oncogene (red dots) and tumor suppressor (blue dots), the number of mutations found in an intramolecular cluster

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/1/8/e1500296/dc1 Supplementary Materials for Transcriptional regulation of APOBEC3 antiviral immunity through the CBF- /RUNX axis This PDF file includes: Brett

More information

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice. Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.

More information

SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer.

SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Supplementary Figure 1 SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Scatter plots comparing expression profiles of matched pretreatment

More information

Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well

Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well plate at cell densities ranging from 25-225 cells in

More information

mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions

mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions Supplementary Information mtor plays critical roles in pancreatic cancer stem cells through specific and stemness-related functions Shyuichiro Matsubara 1, Qiang Ding 1, Yumi Miyazaki 1, Taisaku Kuwahata

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of

More information

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h) Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d

More information

Supplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was

Supplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was Supplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was performed on a total of 85 SS patients. Data filtration

More information

Pediatric Brain Tumors: Updates in Treatment and Care

Pediatric Brain Tumors: Updates in Treatment and Care Pediatric Brain Tumors: Updates in Treatment and Care Writer Classroom Rishi R. Lulla, MD MS Objectives Introduce the common pediatric brain tumors Discuss current treatment strategies for pediatric brain

More information

Off-Label Treatments. Clinical Trials for Recurrent GBM UCSF Radiation Oncology Course: Management of Recurrent Disease. Outline

Off-Label Treatments. Clinical Trials for Recurrent GBM UCSF Radiation Oncology Course: Management of Recurrent Disease. Outline Off-Label Treatments Clinical Trials for Recurrent GBM UCSF Radiation Oncology Course: Management of Recurrent Disease Jennifer Clarke, MD, MPH Assistant Professor Division of Neuro-Oncology Depts of Neurological

More information

Figure S1: Effects on haptotaxis are independent of effects on cell velocity A)

Figure S1: Effects on haptotaxis are independent of effects on cell velocity A) Supplemental Figures Figure S1: Effects on haptotaxis are independent of effects on cell velocity A) Velocity of MV D7 fibroblasts expressing different GFP-tagged Ena/VASP family proteins in the haptotaxis

More information

Identification and characterization of multiple splice variants of Cdc2-like kinase 4 (Clk4)

Identification and characterization of multiple splice variants of Cdc2-like kinase 4 (Clk4) Identification and characterization of multiple splice variants of Cdc2-like kinase 4 (Clk4) Vahagn Stepanyan Department of Biological Sciences, Fordham University Abstract: Alternative splicing is an

More information

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:

More information

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor

More information

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB SUPPLEMENTARY FIGURES: PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB Jingying Xu, Xiuhai Ren, Anup Singh Pathania, G. Esteban Fernandez,

More information

Nature Genetics: doi: /ng.3731

Nature Genetics: doi: /ng.3731 Supplementary Figure 1 Circadian profiles of Adarb1 transcript and ADARB1 protein in mouse tissues. (a) Overlap of rhythmic transcripts identified in the previous transcriptome analyses. The mouse liver

More information

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2

More information

Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.

Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22. Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.32 PCOS locus after conditioning for the lead SNP rs10993397;

More information

U118MG. Supplementary Figure 1 U373MG U118MG 3.5 A CCF-SSTG

U118MG. Supplementary Figure 1 U373MG U118MG 3.5 A CCF-SSTG A172 CCF-SSTG1 15 - - - 1 1 1 2 2 3 4 6 7 8 10101112131617192022-1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22 T98G U373MG - - - 1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22-1 1 1 2 2 3 4 6 7

More information

Supplementary Figures

Supplementary Figures Supplementary Figures a miel1-2 (SALK_41369).1kb miel1-1 (SALK_978) b TUB MIEL1 Supplementary Figure 1. MIEL1 expression in miel1 mutant and S:MIEL1-MYC transgenic plants. (a) Mapping of the T-DNA insertion

More information

Antibody-Drug Conjugates in Glioblastoma Multiforme: Finding Ways Forward

Antibody-Drug Conjugates in Glioblastoma Multiforme: Finding Ways Forward Transcript Details This is a transcript of a continuing medical education (CME) activity accessible on the ReachMD network. Additional media formats for the activity and full activity details (including

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY FIGURES AND TABLE SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).

More information

The mir-199a/brm/egr1 axis is a determinant of anchorage-independent growth in epithelial tumor cell lines

The mir-199a/brm/egr1 axis is a determinant of anchorage-independent growth in epithelial tumor cell lines Supplementary information Supplementary Figure -9 Supplementary Table -4 The mir-99a/brm/egr axis is a determinant of anchorage-independent growth in epithelial tumor cell lines Kazuyoshi Kobayashi, Kouhei

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Information included with Nature MS 2008-02-01484B by Colantonio et al., entitled The dynein regulatory complex is required for ciliary motility and otolith biogenesis in the inner ear. This

More information

Supplemental Information For: The genetics of splicing in neuroblastoma

Supplemental Information For: The genetics of splicing in neuroblastoma Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,

More information

BIO360 Fall 2013 Quiz 1

BIO360 Fall 2013 Quiz 1 BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.

More information

Supplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression

Supplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression Molecular Cell, Volume 68 Supplemental Information NRF2 Is a Major Target of ARF in p53-independent Tumor Suppression Delin Chen, Omid Tavana, Bo Chu, Luke Erber, Yue Chen, Richard Baer, and Wei Gu Figure

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed.

of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed. Supplementary Note The potential association and implications of HBV integration at known and putative cancer genes of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed. Human telomerase

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases.

Nature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases. Supplementary Figure 1 Somatic coding mutations identified by WES/WGS for 83 ATL cases. (a) The percentage of targeted bases covered by at least 2, 10, 20 and 30 sequencing reads (top) and average read

More information

Senior Thesis. Presented to. The Faculty of the School of Arts and Sciences Brandeis University

Senior Thesis. Presented to. The Faculty of the School of Arts and Sciences Brandeis University Greenwald 1 Mouse intercellular adhesion molecule 1 (ICAM-1) isoforms demonstrate different binding affinities to mouse macrophage-1 antigen (Mac-1) and preliminary evidence for alternatively-spliced variants

More information

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

Nature Structural & Molecular Biology: doi: /nsmb.2419

Nature Structural & Molecular Biology: doi: /nsmb.2419 Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb

More information

Supplementary Data Cyclophilin B Supports Myc and Mutant p53 Dependent Survival of Glioblastoma Multiforme Cells

Supplementary Data Cyclophilin B Supports Myc and Mutant p53 Dependent Survival of Glioblastoma Multiforme Cells Supplementary Data Cyclophilin B Supports Myc and Mutant p53 Dependent Survival of Glioblastoma Multiforme Cells Jae Won Choi, Mark A. Schroeder, Jann N. Sarkaria, and Richard J. Bram 1 Figure S1. Pharmacological

More information

Prognostic value of ADC in glioblastoma multiforme and its correlation with survival and MGMT promoter methylation status.

Prognostic value of ADC in glioblastoma multiforme and its correlation with survival and MGMT promoter methylation status. Prognostic value of ADC in glioblastoma multiforme and its correlation with survival and MGMT promoter methylation status. R. Zalazar, M.D. Hernández, M. Páramo, P. Slon, M. Millor Muruzabal, J. Solorzano

More information

Differentiation-induced Changes of Mediterranean Fever Gene (MEFV) Expression in HL-60 Cell

Differentiation-induced Changes of Mediterranean Fever Gene (MEFV) Expression in HL-60 Cell Differentiation-induced Changes of Mediterranean Fever Gene (MEFV) Expression in HL-60 Cell Wenxin Li Department of Biological Sciences Fordham University Abstract MEFV is a human gene that codes for an

More information

Precision medicine: How to exploit the growing knowledge on the evolving genomes of cells to improve cancer prevention and therapy.

Precision medicine: How to exploit the growing knowledge on the evolving genomes of cells to improve cancer prevention and therapy. Precision medicine: How to exploit the growing knowledge on the evolving genomes of cells to improve cancer prevention and therapy Joe Costello, PhD Department of Neurological Surgery A more accurate and

More information

Supporting Information

Supporting Information Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Discussion The cell cycle machinery and the DNA damage response network are highly interconnected and co-regulated in assuring faithful duplication and partition of genetic materials into

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer

More information

Cilengitide (Impetreve) for glioblastoma multiforme. February 2012

Cilengitide (Impetreve) for glioblastoma multiforme. February 2012 Cilengitide (Impetreve) for glioblastoma multiforme February 2012 This technology summary is based on information available at the time of research and a limited literature search. It is not intended to

More information

Nature Biotechnology: doi: /nbt.1904

Nature Biotechnology: doi: /nbt.1904 Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is

More information

Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.

Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data

More information

Glioblastoma: Adjuvant Treatment Abdulrazag Ajlan, MD, MSc, FRCSC, UCNS(D)

Glioblastoma: Adjuvant Treatment Abdulrazag Ajlan, MD, MSc, FRCSC, UCNS(D) Glioblastoma: Adjuvant Treatment Abdulrazag Ajlan, MD, MSc, FRCSC, UCNS(D) *Neurosurgery Consultant, King Saud University, Riyadh, KSA *Adjunct Teaching Faculty, Neurosurgery, Stanford School Of Medicine,

More information

Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or

Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent

More information

Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015

Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015 Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a

More information

Supplementary Figure 1

Supplementary Figure 1 Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor

More information

Supplementary material. Supplementary Figure legends

Supplementary material. Supplementary Figure legends Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)

More information

Molecular prognostic factors in glioblastoma: state of the art and future challenges. Author Proof

Molecular prognostic factors in glioblastoma: state of the art and future challenges. Author Proof Review Molecular prognostic factors in glioblastoma: state of the art and future challenges Ana Xavier-Magalhães 1,2, Meera Nandhabalan 3,4, Chris Jones 3,4 & Bruno M Costa* 1,2 Practice Points Glioblastoma

More information

Figure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h

Figure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h Figure S1 Time-dependent down-modulation of HER3 by EZN-392 HE ER3 mrna A, %Contr rol 12 No Treatment EZN-392, 2 μm 1 8 6 4 2 2 8 24 Time, h Figure S2. Specific target down-modulation by HER3 (EZN-392)

More information