Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute
|
|
- Amos McDowell
- 6 years ago
- Views:
Transcription
1 Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute
2 Outline Anaplastic meningioma compared to other cancers Whole genomes inform diagnosis Landscape of driver variants Identification of clinically relevant sub-types
3 Meningioma Most common primary central nervous system tumours in adults Originate from the meningeal membrane covering the brain and spinal cord Classified as: Grade 1: benign (70-80%) Grade 2: atypical (5-20%) Grade 3: malignant (1-3%)
4 Anaplastic Meningioma Presentation: progression of lower grade tumour or de novo Prognosis: poor, many cases inevitable recurrence Current insight: Grade 1 and 2: well characterised Grade 3: poorly understood, limited therapeutic options
5 Study Design Discovery cohort (whole genomes) Paired FF DNA Extension cohort (known cancer genes) Paired and unpaired, FF and FFPE
6 Discovery Cohort
7 Discovery Cohort
8 Extension Cohort Solid tumour panel (52,461 probes, 2.05 Mb) Copy number SNP introns SNP cytoscape Point mutations Coding exons from 366 genes (CGC) 333 probes targeting actionable loci (KRAS, BRAF, EGFR, ALK, KIT, TP53) TERT promoter SNP gwas gene fusions 7941 regions exons, 366 genes Fusions 2462 probes targeting 29 fusions involving 11 genes Copy number 1912 probes targeting 961 reference SNPs (1 SNP per 3Mb) 1114 probes targeting SNPs in frequently amplified genes
9 Outline Anaplastic meningioma compared to other cancers Whole genomes inform diagnosis Landscape of driver variants Identification of clinically relevant sub-types
10 Whole Genomes: point mutations subs indels subs (snp id)
11 Whole Genomes: mutation burden Sanger Analysis Pipeline Core Sequencing Facility Fastq Raw Data Mapping BWA-mem Bam Coverage stats Copy Number Point Mutations Indels Gene fusions CNVkit Caveman vcf Pindel vcf 50bp trim Annotation: Vagrent Brass Downstream Analysis Identification of Driver mutations & cancer genes, subclonal mutations etc Report
12 Whole Genomes: mutation burden
13 Universal Patterns Of Selection In Cancer And Somatic Tissues Inigo Martincorena
14 AM (n=19) NF2
15 Outline Anaplastic meningioma compared to other cancers Whole genomes inform diagnosis Landscape of driver variants Identification of clinically relevant sub-types
16 Whole Genomes: atypical cases subs indels subs (snp id)
17 NF2 mut `` `
18 MSI NF2 wt `` `
19 NAB2- STAT6 NF2 wt `` `
20 NAB2- STAT6 NF2 wt `` `
21 EML4- ALK NF2 wt `` `
22 EML4- ALK NF2 wt `` `
23 Discovery Cohort
24 Outline Anaplastic meningioma compared to other cancers Whole genomes inform diagnosis Landscape of driver variants Identification of clinically relevant sub-types
25 Rearrangements Supplementary Figure S4 a b b No recurrent novel fusions Disruptive rearrangements in PBRM1 and RB1 Supplementary Figure S4 Rearrangement burden of anaplastic meningioma. (a) Rearrangement subtypes in 18 primary anaplastic meningioma genomes classified into four broad categories of structural variant. The horizontal axis indicates sample number and the vertical axis shows the total number of rearrangements. (b) Comparison of overall rearrangement burden in anaplastic meningioma with 11 other tumor types colour coded according to source of data and analysis. Horizontal axis indicates cancer type and number of samples per cohort. Vertical axis shows rearrangent number per sample. Box plot hinges demarcate the 25th to 75th centile with median indicated by the middle horizonal line and whiskers extending to 1.5 times the interquartile range. Underlying violin plots show the full range and distribution of rearrangement burden across each tumor cohort. WTSI, Wellcome Trust Sanger Institute.
26 Copy Number Aggregate CN profiles from 18 genomes Multiple recurrent CN changes deletions: 1p, 6q, 14 and 22 Homozygous deletion: NF2 and CDKN2A
27 Drivers
28 Outline Anaplastic meningioma compared to other cancers Whole genomes inform diagnosis Landscape of driver variants Identification of clinically relevant sub-types
29 31 tumours, 28 patients
30 31 tumours, 28 patients 25 patients
31 31 tumours, 28 patients 25 patients 100% NF2 ARID1A, PBRM1 62% 50% 0% C1 C2 C1 C2
32 Acknowledgements
NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation
NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department
More informationCharacterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
More information5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff
5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff National molecular screening of patients with lung cancer for a national trial of multiple novel agents. 2000 NSCLC patients/year (late
More informationACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics
ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole
More informationNGS in tissue and liquid biopsy
NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationTransform genomic data into real-life results
CLINICAL SUMMARY Transform genomic data into real-life results Biomarker testing and targeted therapies can drive improved outcomes in clinical practice New FDA-Approved Broad Companion Diagnostic for
More informationIllumina Trusight Myeloid Panel validation A R FHAN R A FIQ
Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ G E NETIC T E CHNOLOGIST MEDICAL G E NETICS, CARDIFF To Cover Background to the project Choice of panel Validation process Genes on panel, Protocol
More informationBreast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and
More informationAccel-Amplicon Panels
Accel-Amplicon Panels Amplicon sequencing has emerged as a reliable, cost-effective method for ultra-deep targeted sequencing. This highly adaptable approach is especially applicable for in-depth interrogation
More informationSupplementary Figure 1. Estimation of tumour content
Supplementary Figure 1. Estimation of tumour content a, Approach used to estimate the tumour content in S13T1/T2, S6T1/T2, S3T1/T2 and S12T1/T2. Tissue and tumour areas were evaluated by two independent
More informationGenomic analysis of childhood High grade glial (HGG) brain tumors
Genomic analysis of childhood High grade glial (HGG) brain tumors Linda D Cooley Children s Mercy, Kansas City The Children s Mercy Hospital, 2017 Genomic analysis of childhood High grade glial (HGG) brain
More informationInsights from Sequencing the Melanoma Exome
Insights from Sequencing the Melanoma Exome Michael Krauthammer, MD PhD, December 2 2015 Yale University School Yof Medicine 1 2012 Exome Screens and Results Exome Sequencing of 108 sun-exposed melanomas
More informationCancer Gene Panels. Dr. Andreas Scherer. Dr. Andreas Scherer President and CEO Golden Helix, Inc. Twitter: andreasscherer
Cancer Gene Panels Dr. Andreas Scherer Dr. Andreas Scherer President and CEO Golden Helix, Inc. scherer@goldenhelix.com Twitter: andreasscherer About Golden Helix - Founded in 1998 - Main outside investor:
More informationNGS ONCOPANELS: FDA S PERSPECTIVE
NGS ONCOPANELS: FDA S PERSPECTIVE CBA Workshop: Biomarker and Application in Drug Development August 11, 2018 Rockville, MD You Li, Ph.D. Division of Molecular Genetics and Pathology Food and Drug Administration
More informationNext Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making
Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making November 20, 2014 Capturing Value in Next Generation Sequencing Symposium Douglas Johnson MD, MSCI Vanderbilt-Ingram
More informationAnalysis with SureCall 2.1
Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis
More informationMEDICAL GENOMICS LABORATORY. Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG)
Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG) Ordering Information Acceptable specimen types: Blood (3-6ml EDTA; no time limitations associated with receipt) Saliva (OGR-575 DNA Genotek;
More informationFrequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R
Frequency(%) 1 a b ALK FS-indel ALK R1Q HRAS Q61R HRAS G13R IDH R17K IDH R14Q MET exon14 SS-indel KIT D8Y KIT L76P KIT exon11 NFS-indel SMAD4 R361 IDH1 R13 CTNNB1 S37 CTNNB1 S4 AKT1 E17K ERBB D769H ERBB
More informationDr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory
Dr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory Personalised Therapy/Precision Medicine Selection of a therapeutic drug based on the presence or absence of a specific
More informationAVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
More informationNext generation diagnostics Bringing high-throughput sequencing into clinical application
Next generation diagnostics Bringing high-throughput sequencing into clinical application Leonardo A. Meza-Zepeda, PhD Translational Genomics Group Institute for Cancer Research Leonardo.Meza-Zepeda@rr-research.no
More informationACE ImmunoID. ACE ImmunoID. Precision immunogenomics. Precision Genomics for Immuno-Oncology
ACE ImmunoID ACE ImmunoID Precision immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. A universal biomarker platform for immuno-oncology Patient response to cancer immunotherapies
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationSureSelect Cancer All-In-One Custom and Catalog NGS Assays
SureSelect Cancer All-In-One Custom and Catalog NGS Assays Detect all cancer-relevant variants in a single SureSelect assay SNV Indel TL SNV Indel TL Single DNA input Single AIO assay Single data analysis
More informationComprehensive genomic profiling for various solid tumors
Content Highlight Test Specification Test Content Performance Validation Test Report I II III IV V The NovoPM TM comprehensive cancer genomic profiling test Comprehensive genomic profiling for various
More informationSupplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the
Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the deep dermis. (b) The melanocytes demonstrate abundant
More informationCell-free tumor DNA for cancer monitoring
Learning objectives Cell-free tumor DNA for cancer monitoring Christina Lockwood, PhD, DABCC, DABMGG Department of Laboratory Medicine 1. Define circulating, cell-free tumor DNA (ctdna) 2. Understand the
More informationSupplementary Figure 1. Cytoscape bioinformatics toolset was used to create the network of protein-protein interactions between the product of each
Supplementary Figure 1. Cytoscape bioinformatics toolset was used to create the network of protein-protein interactions between the product of each mutated gene and the panel of 125 cancer-driving genes
More informationPlasma-Seq conducted with blood from male individuals without cancer.
Supplementary Figures Supplementary Figure 1 Plasma-Seq conducted with blood from male individuals without cancer. Copy number patterns established from plasma samples of male individuals without cancer
More informationSupplementary Tables. Supplementary Figures
Supplementary Files for Zehir, Benayed et al. Mutational Landscape of Metastatic Cancer Revealed from Prospective Clinical Sequencing of 10,000 Patients Supplementary Tables Supplementary Table 1: Sample
More informationIntegration of Cancer Genome into GECCO- Genetics and Epidemiology of Colorectal Cancer Consortium
Integration of Cancer Genome into GECCO- Genetics and Epidemiology of Colorectal Cancer Consortium Ulrike Peters Fred Hutchinson Cancer Research Center University of Washington U01-CA137088-05, PI: Peters
More informationNext generation histopathological diagnosis for precision medicine in solid cancers
Next generation histopathological diagnosis for precision medicine in solid cancers from genomics to clinical application Aldo Scarpa ARC-NET Applied Research on Cancer Department of Pathology and Diagnostics
More informationNew Drug development and Personalized Therapy in The Era of Molecular Medicine
New Drug development and Personalized Therapy in The Era of Molecular Medicine Ramesh K. Ramanathan MD Virginia G. Piper Cancer Center Translational Genomics Research Institute Scottsdale, AZ Clinical
More informationAn integrated map of genetic variation from 1092 human genomes
SUPPLEMENTAL METHODS AND MATERIALS Whole genome sequencing Alignment: Short insert paired-end reads were aligned to the GRCh37 reference human genome with 1000 genomes decoy contigs using BWA-mem(1). Somatic
More informationSection 2 Original Policy Date 2013 Last Review Status/Date September 1, 2014
Policy Number 2.04.82 Molecular Markers in Fine Needle Aspirates of the Thyroid Medical Policy Section 2 Original Policy Date 2013 Last Review Status/Date September 1, 2014 Disclaimer Our medical policies
More informationRelationship between genomic features and distributions of RS1 and RS3 rearrangements in breast cancer genomes.
Supplementary Figure 1 Relationship between genomic features and distributions of RS1 and RS3 rearrangements in breast cancer genomes. (a,b) Values of coefficients associated with genomic features, separately
More informationNGS IN ONCOLOGY: FDA S PERSPECTIVE
NGS IN ONCOLOGY: FDA S PERSPECTIVE ASQ Biomed/Biotech SIG Event April 26, 2018 Gaithersburg, MD You Li, Ph.D. Division of Molecular Genetics and Pathology Food and Drug Administration (FDA) Center for
More informationFluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS
APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor
More informationEXAMPLE. - Potentially responsive to PI3K/mTOR and MEK combination therapy or mtor/mek and PKC combination therapy. ratio (%)
Dr Kate Goodhealth Goodhealth Medical Clinic 123 Address Road SUBURBTOWN NSW 2000 Melanie Citizen Referring Doctor Your ref Address Dr John Medico 123 Main Street, SUBURBTOWN NSW 2000 Phone 02 9999 9999
More informationGenomic Medicine: What every pathologist needs to know
Genomic Medicine: What every pathologist needs to know Stephen P. Ethier, Ph.D. Professor, Department of Pathology and Laboratory Medicine, MUSC Director, MUSC Center for Genomic Medicine Genomics and
More informationp.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11
ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N
More informationUNIVERSITY OF TORINO DEPARTMENT OF ONCOLOGY. Giorgio V. Scagliotti University of Torino Dipartment of Oncology
Giorgio V. Scagliotti University of Torino Dipartment of Oncology giorgio.scagliotti@unito.it Molecular landscape of MM not fully characterized to allow personalized treatment Recurrent genetic alterations
More informationIntroduction of an NGS gene panel into the Haemato-Oncology MPN service
Introduction of an NGS gene panel into the Haemato-Oncology MPN service Dr. Anna Skowronska, Dr Jane Bryon, Dr Samuel Clokie, Dr Yvonne Wallis and Professor Mike Griffiths West Midlands Regional Genetics
More informationCopy number and somatic mutations drive tumors
Detection of copy number alterations, ploidy and loss of heterozygosity across the genome in FFPE specimens Utility for diagnosis and treatment with comparison to FISH-based and as a complement to sequencing
More informationGenome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl.
GenomeVIP: the Genome Institute at Washington University A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud R. Jay Mashl October 20, 2014 Turnkey Variant
More informationBWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space
Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate
More informationPersonalized Medicine: Lung Biopsy and Tumor
Personalized Medicine: Lung Biopsy and Tumor Mutation Testing Elizabeth H. Moore, MD Personalized Medicine: Lung Biopsy and Tumor Mutation Testing Genomic testing has resulted in a paradigm shift in the
More informationMolecular Testing in Lung Cancer
Molecular Testing in Lung Cancer Pimpin Incharoen, M.D. Assistant Professor, Thoracic Pathology Department of Pathology, Ramathibodi Hospital Genetic alterations in lung cancer Source: Khono et al, Trans
More informationNature Medicine: doi: /nm.4439
Figure S1. Overview of the variant calling and verification process. This figure expands on Fig. 1c with details of verified variants identification in 547 additional validation samples. Somatic variants
More informationNature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases.
Supplementary Figure 1 Somatic coding mutations identified by WES/WGS for 83 ATL cases. (a) The percentage of targeted bases covered by at least 2, 10, 20 and 30 sequencing reads (top) and average read
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationMolecular Genetics of Paediatric Tumours. Gino Somers MBBS, BMedSci, PhD, FRCPA Pathologist-in-Chief Hospital for Sick Children, Toronto, ON, CANADA
Molecular Genetics of Paediatric Tumours Gino Somers MBBS, BMedSci, PhD, FRCPA Pathologist-in-Chief Hospital for Sick Children, Toronto, ON, CANADA Financial Disclosure NanoString - conference costs for
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationCirculating Tumor DNA in GIST and its Implications on Treatment
Circulating Tumor DNA in GIST and its Implications on Treatment October 2 nd 2017 Dr. Ciara Kelly Assistant Attending Physician Sarcoma Medical Oncology Service Objectives Background Liquid biopsy & ctdna
More informationNature Biotechnology: doi: /nbt.1904
Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is
More informationDisclosures Genomic testing in lung cancer
Disclosures Genomic testing in lung cancer No disclosures Objectives Understand how FISH and NGS provide complementary data for the evaluation of lung cancer Recognize the challenges of performing testing
More informationGolden Helix s End-to-End Solution for Clinical Labs
Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics
More informationGenomic landsccape of poorly differentiated and anaplastic thyroid carcinomas: Clues for better classification, risk stratification and therapy
ACCME/Disclosures The USCAP requires that anyone in a position to influence or control the content of CME disclose any relevant financial relationship WITH COMMERCIAL INTERESTS which they or their spouse/partner
More informationNature Genetics: doi: /ng Supplementary Figure 1. Details of sequencing analysis.
Supplementary Figure 1 Details of sequencing analysis. (a) Flow chart showing which patients fall into each category and were used for analysis. (b) Graph showing the average and median coverage for all
More informationNature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data.
Supplementary Figure 1 PCA for ancestry in SNV data. (a) EIGENSTRAT principal-component analysis (PCA) of SNV genotype data on all samples. (b) PCA of only proband SNV genotype data. (c) PCA of SNV genotype
More informationNGS Gateway Lab Services
TM NGS Gateway Lab Services Accelerating Precision Medicine Design a Complete Genomic Testing Portfolio with Turnkey Assays About NGS Gateway Lab Services TM Designed to provide a gateway to your own in-house
More informationEnterprise Interest Thermo Fisher Scientific / Employee
Enterprise Interest Thermo Fisher Scientific / Employee A next-generation sequencing assay to estimate tumor mutation load from FFPE research samples Fiona Hyland. Director of R&D, Bioinformatics Clinical
More informationMutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
More informationCancer Genomics. Nic Waddell. Winter School in Mathematical and Computational Biology. July th
Cancer Genomics Nic Waddell Winter School in Mathematical and Computational Biology 6th July 2015 Time Line of Key Events in Cancer Genomics Michael R. Stratton Science 2011;331:1553-1558 The Cancer Genome
More informationGenomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
More informationIlluminating the genetics of complex human diseases
Illuminating the genetics of complex human diseases Michael Schatz Sept 27, 2012 Beyond the Genome @mike_schatz / #BTG2012 Outline 1. De novo mutations in human diseases 1. Autism Spectrum Disorder 2.
More informationNCCN Non-Small Cell Lung Cancer V Meeting June 15, 2018
Guideline Page and Request Illumina Inc. requesting to replace Testing should be conducted as part of broad molecular profiling with Consider NGS-based assays that include EGFR, ALK, ROS1, and BRAF as
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/7/283/283ra54/dc1 Supplementary Materials for Clonal status of actionable driver events and the timing of mutational processes in cancer evolution
More informationMEDICAL POLICY. SUBJECT: MOLECULAR PANEL TESTING OF CANCERS TO IDENTIFY TARGETED THERAPIES (Excluding NSCLC and CRC) EFFECTIVE DATE: 12/21/17
MEDICAL POLICY SUBJECT: MOLECULAR PANEL TESTING OF PAGE: 1 OF: 5 If a product excludes coverage for a service, it is not covered, and medical policy criteria do not apply. If a commercial product, including
More informationDisclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath
Circulating DNA and NGS technology JS Reis-Filho, MD, PhD, FRCPath Director of Experimental Pathology, Department of Pathology Affiliate Member, Human Oncology and Pathogenesis Program Disclosure of Relevant
More informationMEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)
Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)
More informationOncoPPi Portal A Cancer Protein Interaction Network to Inform Therapeutic Strategies
OncoPPi Portal A Cancer Protein Interaction Network to Inform Therapeutic Strategies 2017 Contents Datasets... 2 Protein-protein interaction dataset... 2 Set of known PPIs... 3 Domain-domain interactions...
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature8645 Physical coverage (x haploid genomes) 11 6.4 4.9 6.9 6.7 4.4 5.9 9.1 7.6 125 Neither end mapped One end mapped Chimaeras Correct Reads (million ns) 1 75 5 25 HCC1187 HCC1395 HCC1599
More informationComprehensive Genomic Profiling, in record time. Accurate. Clinically Proven. Fast.
Comprehensive Genomic Profiling, in record time Accurate. ly Proven. Fast. PCDx advantages Comprehensive genomic profiling, in record time PCDx Comprehensive Genomic Profiling (CGP) provides precise information
More informationIntroduction to Cancer Bioinformatics and cancer biology. Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015
Introduction to Cancer Bioinformatics and cancer biology Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015 Why cancer bioinformatics? Devastating disease, no cure on the horizon Major
More informationLiquid biopsy: the experience of real life case studies
Liquid biopsy: the experience of real life case studies 10 th September 2018 Beatriz Bellosillo Servicio de Anatomía Patológica Hospital del Mar, Barcelona Agenda Introduction Experience in colorectal
More informationNeoTYPE Cancer Profiles
NeoTYPE Cancer Profiles 30+ Multimethod Assays for Hematologic Diseases and Solid Tumors Molecular FISH Anatomic Pathology The next generation of diagnostic, prognostic, and therapeutic assessment What
More informationComprehensive Analyses of Circulating Cell- Free Tumor DNA
Comprehensive Analyses of Circulating Cell- Free Tumor DNA Boston, MA June 28th, 2016 Derek Murphy, Ph.D. Scientist, Research and Development Personal Genome Diagnostics Acquisition of Somatic Alterations
More informationCancer Validation in the 100,000 genomes project. Dr Shirley Henderson ACGS spring meeting 06/07/16
Cancer Validation in the 100,000 genomes project Dr Shirley Henderson ACGS spring meeting 06/07/16 Cancer is a lesion of the Genome Diagnosis Cancer Molecular Lesions Prognosis Disease Monitoring Why is
More informationInvestigating rare diseases with Agilent NGS solutions
Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe
More informationSupplementary Figure 1. Copy Number Alterations TP53 Mutation Type. C-class TP53 WT. TP53 mut. Nature Genetics: doi: /ng.
Supplementary Figure a Copy Number Alterations in M-class b TP53 Mutation Type Recurrent Copy Number Alterations 8 6 4 2 TP53 WT TP53 mut TP53-mutated samples (%) 7 6 5 4 3 2 Missense Truncating M-class
More informationThe feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients
The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients ASSC Scientific Meeting 13 th October 2016 Prof Andrew Barbour UQ SOM
More informationPersonalised cancer care Information for Medical Specialists. A new way to unlock treatment options for your patients
Personalised cancer care Information for Medical Specialists A new way to unlock treatment options for your patients Contents Optimised for clinical benefit 4 Development history 4 Full FIND IT panel vs
More informationNature Genetics: doi: /ng Supplementary Figure 1. SEER data for male and female cancer incidence from
Supplementary Figure 1 SEER data for male and female cancer incidence from 1975 2013. (a,b) Incidence rates of oral cavity and pharynx cancer (a) and leukemia (b) are plotted, grouped by males (blue),
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Systematic investigation of cancer-associated somatic point mutations in SNP databases HyunChul Jung 1,2, Thomas Bleazard 3, Jongkeun Lee 1 and Dongwan Hong 1 1. Cancer Genomics
More informationIdentifying Mutations Responsible for Rare Disorders Using New Technologies
Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance
More informationNeoTYPE Cancer Profiles
NeoTYPE Cancer Profiles Multimethod Analysis of 25+ Hematologic Diseases and Solid Tumors Anatomic Pathology FISH Molecular The next generation of diagnostic, prognostic, and therapeutic assessment NeoTYPE
More informationNature Genetics: doi: /ng.2995
Supplementary Figure 1 Kaplan-Meier survival curves of patients with brainstem tumors. (a) Comparison of patients with PPM1D mutation versus wild-type PPM1D. (b) Comparison of patients with PPM1D mutation
More informationFigure S4. 15 Mets Whole Exome. 5 Primary Tumors Cancer Panel and WES. Next Generation Sequencing
Figure S4 Next Generation Sequencing 15 Mets Whole Exome 5 Primary Tumors Cancer Panel and WES Get coverage of all variant loci for all three Mets Variant Filtering Sequence Alignments Index and align
More informationCancer Informatics Lecture
Cancer Informatics Lecture Mayo-UIUC Computational Genomics Course June 22, 2018 Krishna Rani Kalari Ph.D. Associate Professor 2017 MFMER 3702274-1 Outline The Cancer Genome Atlas (TCGA) Genomic Data Commons
More informationMultiplex target enrichment using DNA indexing for ultra-high throughput variant detection
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin
More informationStrandAdvantage Tissue-Specific Cancer Genomic Tests. Empowering Crucial First-Line Therapy Decisions for Your Patient
StrandAdvantage Tissue-Specific Cancer Genomic Tests Empowering Crucial First-Line Therapy Decisions for Your Patient Harness the power of precision medicine with StrandAdvantage Precision medicine in
More informationARTICLE RESEARCH. Macmillan Publishers Limited. All rights reserved
Extended Data Figure 6 Annotation of drivers based on clinical characteristics and co-occurrence patterns. a, Putative drivers affecting greater than 10 patients were assessed for enrichment in IGHV mutated
More informationSupplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.
Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized
More informationIdentification and clinical detection of genetic alterations of pre-neoplastic lesions Time for the PML ome? David Sidransky MD Johns Hopkins
Identification and clinical detection of genetic alterations of pre-neoplastic lesions Time for the PML ome? David Sidransky MD Johns Hopkins February 3-5, 2016 Lansdowne Resort, Leesburg, VA Molecular
More informationOut-Patient Billing CPT Codes
Out-Patient Billing CPT Codes Updated Date: August 3, 08 Client Billed Molecular Tests HPV DNA Tissue Testing 8764 No Medicare Billed - Molecular Tests NeoARRAY NeoARRAY SNP/Cytogenetic No 89 NeoLAB NeoLAB
More informationThe 100,000 Genomes Project Harnessing the power of genomics for NHS rare disease and cancer patients
The 100,000 Genomes Project Harnessing the power of genomics for NHS rare disease and cancer patients Dr Richard Scott, Clinical Lead for Rare Disease Dr Nirupa Murugaesu, Clinical Lead for Cancer Four
More informationAn ultrasensitive method for quantitating circulating tumor DNA with broad patient coverage
An ultrasensitive method for quantitating circulating tumor DNA with broad patient coverage Aaron M Newman1,2,7, Scott V Bratman1,3,7, Jacqueline To3, Jacob F Wynne3, Neville C W Eclov3, Leslie A Modlin3,
More information