Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

Size: px
Start display at page:

Download "Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute"

Transcription

1 Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

2 Outline Anaplastic meningioma compared to other cancers Whole genomes inform diagnosis Landscape of driver variants Identification of clinically relevant sub-types

3 Meningioma Most common primary central nervous system tumours in adults Originate from the meningeal membrane covering the brain and spinal cord Classified as: Grade 1: benign (70-80%) Grade 2: atypical (5-20%) Grade 3: malignant (1-3%)

4 Anaplastic Meningioma Presentation: progression of lower grade tumour or de novo Prognosis: poor, many cases inevitable recurrence Current insight: Grade 1 and 2: well characterised Grade 3: poorly understood, limited therapeutic options

5 Study Design Discovery cohort (whole genomes) Paired FF DNA Extension cohort (known cancer genes) Paired and unpaired, FF and FFPE

6 Discovery Cohort

7 Discovery Cohort

8 Extension Cohort Solid tumour panel (52,461 probes, 2.05 Mb) Copy number SNP introns SNP cytoscape Point mutations Coding exons from 366 genes (CGC) 333 probes targeting actionable loci (KRAS, BRAF, EGFR, ALK, KIT, TP53) TERT promoter SNP gwas gene fusions 7941 regions exons, 366 genes Fusions 2462 probes targeting 29 fusions involving 11 genes Copy number 1912 probes targeting 961 reference SNPs (1 SNP per 3Mb) 1114 probes targeting SNPs in frequently amplified genes

9 Outline Anaplastic meningioma compared to other cancers Whole genomes inform diagnosis Landscape of driver variants Identification of clinically relevant sub-types

10 Whole Genomes: point mutations subs indels subs (snp id)

11 Whole Genomes: mutation burden Sanger Analysis Pipeline Core Sequencing Facility Fastq Raw Data Mapping BWA-mem Bam Coverage stats Copy Number Point Mutations Indels Gene fusions CNVkit Caveman vcf Pindel vcf 50bp trim Annotation: Vagrent Brass Downstream Analysis Identification of Driver mutations & cancer genes, subclonal mutations etc Report

12 Whole Genomes: mutation burden

13 Universal Patterns Of Selection In Cancer And Somatic Tissues Inigo Martincorena

14 AM (n=19) NF2

15 Outline Anaplastic meningioma compared to other cancers Whole genomes inform diagnosis Landscape of driver variants Identification of clinically relevant sub-types

16 Whole Genomes: atypical cases subs indels subs (snp id)

17 NF2 mut `` `

18 MSI NF2 wt `` `

19 NAB2- STAT6 NF2 wt `` `

20 NAB2- STAT6 NF2 wt `` `

21 EML4- ALK NF2 wt `` `

22 EML4- ALK NF2 wt `` `

23 Discovery Cohort

24 Outline Anaplastic meningioma compared to other cancers Whole genomes inform diagnosis Landscape of driver variants Identification of clinically relevant sub-types

25 Rearrangements Supplementary Figure S4 a b b No recurrent novel fusions Disruptive rearrangements in PBRM1 and RB1 Supplementary Figure S4 Rearrangement burden of anaplastic meningioma. (a) Rearrangement subtypes in 18 primary anaplastic meningioma genomes classified into four broad categories of structural variant. The horizontal axis indicates sample number and the vertical axis shows the total number of rearrangements. (b) Comparison of overall rearrangement burden in anaplastic meningioma with 11 other tumor types colour coded according to source of data and analysis. Horizontal axis indicates cancer type and number of samples per cohort. Vertical axis shows rearrangent number per sample. Box plot hinges demarcate the 25th to 75th centile with median indicated by the middle horizonal line and whiskers extending to 1.5 times the interquartile range. Underlying violin plots show the full range and distribution of rearrangement burden across each tumor cohort. WTSI, Wellcome Trust Sanger Institute.

26 Copy Number Aggregate CN profiles from 18 genomes Multiple recurrent CN changes deletions: 1p, 6q, 14 and 22 Homozygous deletion: NF2 and CDKN2A

27 Drivers

28 Outline Anaplastic meningioma compared to other cancers Whole genomes inform diagnosis Landscape of driver variants Identification of clinically relevant sub-types

29 31 tumours, 28 patients

30 31 tumours, 28 patients 25 patients

31 31 tumours, 28 patients 25 patients 100% NF2 ARID1A, PBRM1 62% 50% 0% C1 C2 C1 C2

32 Acknowledgements

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department

More information

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why

More information

5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff

5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff 5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff National molecular screening of patients with lung cancer for a national trial of multiple novel agents. 2000 NSCLC patients/year (late

More information

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole

More information

NGS in tissue and liquid biopsy

NGS in tissue and liquid biopsy NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences

More information

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

Transform genomic data into real-life results

Transform genomic data into real-life results CLINICAL SUMMARY Transform genomic data into real-life results Biomarker testing and targeted therapies can drive improved outcomes in clinical practice New FDA-Approved Broad Companion Diagnostic for

More information

Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ

Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ G E NETIC T E CHNOLOGIST MEDICAL G E NETICS, CARDIFF To Cover Background to the project Choice of panel Validation process Genes on panel, Protocol

More information

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and

More information

Accel-Amplicon Panels

Accel-Amplicon Panels Accel-Amplicon Panels Amplicon sequencing has emerged as a reliable, cost-effective method for ultra-deep targeted sequencing. This highly adaptable approach is especially applicable for in-depth interrogation

More information

Supplementary Figure 1. Estimation of tumour content

Supplementary Figure 1. Estimation of tumour content Supplementary Figure 1. Estimation of tumour content a, Approach used to estimate the tumour content in S13T1/T2, S6T1/T2, S3T1/T2 and S12T1/T2. Tissue and tumour areas were evaluated by two independent

More information

Genomic analysis of childhood High grade glial (HGG) brain tumors

Genomic analysis of childhood High grade glial (HGG) brain tumors Genomic analysis of childhood High grade glial (HGG) brain tumors Linda D Cooley Children s Mercy, Kansas City The Children s Mercy Hospital, 2017 Genomic analysis of childhood High grade glial (HGG) brain

More information

Insights from Sequencing the Melanoma Exome

Insights from Sequencing the Melanoma Exome Insights from Sequencing the Melanoma Exome Michael Krauthammer, MD PhD, December 2 2015 Yale University School Yof Medicine 1 2012 Exome Screens and Results Exome Sequencing of 108 sun-exposed melanomas

More information

Cancer Gene Panels. Dr. Andreas Scherer. Dr. Andreas Scherer President and CEO Golden Helix, Inc. Twitter: andreasscherer

Cancer Gene Panels. Dr. Andreas Scherer. Dr. Andreas Scherer President and CEO Golden Helix, Inc. Twitter: andreasscherer Cancer Gene Panels Dr. Andreas Scherer Dr. Andreas Scherer President and CEO Golden Helix, Inc. scherer@goldenhelix.com Twitter: andreasscherer About Golden Helix - Founded in 1998 - Main outside investor:

More information

NGS ONCOPANELS: FDA S PERSPECTIVE

NGS ONCOPANELS: FDA S PERSPECTIVE NGS ONCOPANELS: FDA S PERSPECTIVE CBA Workshop: Biomarker and Application in Drug Development August 11, 2018 Rockville, MD You Li, Ph.D. Division of Molecular Genetics and Pathology Food and Drug Administration

More information

Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making

Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making November 20, 2014 Capturing Value in Next Generation Sequencing Symposium Douglas Johnson MD, MSCI Vanderbilt-Ingram

More information

Analysis with SureCall 2.1

Analysis with SureCall 2.1 Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis

More information

MEDICAL GENOMICS LABORATORY. Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG)

MEDICAL GENOMICS LABORATORY. Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG) Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG) Ordering Information Acceptable specimen types: Blood (3-6ml EDTA; no time limitations associated with receipt) Saliva (OGR-575 DNA Genotek;

More information

Frequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R

Frequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R Frequency(%) 1 a b ALK FS-indel ALK R1Q HRAS Q61R HRAS G13R IDH R17K IDH R14Q MET exon14 SS-indel KIT D8Y KIT L76P KIT exon11 NFS-indel SMAD4 R361 IDH1 R13 CTNNB1 S37 CTNNB1 S4 AKT1 E17K ERBB D769H ERBB

More information

Dr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory

Dr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory Dr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory Personalised Therapy/Precision Medicine Selection of a therapeutic drug based on the presence or absence of a specific

More information

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation

More information

Next generation diagnostics Bringing high-throughput sequencing into clinical application

Next generation diagnostics Bringing high-throughput sequencing into clinical application Next generation diagnostics Bringing high-throughput sequencing into clinical application Leonardo A. Meza-Zepeda, PhD Translational Genomics Group Institute for Cancer Research Leonardo.Meza-Zepeda@rr-research.no

More information

ACE ImmunoID. ACE ImmunoID. Precision immunogenomics. Precision Genomics for Immuno-Oncology

ACE ImmunoID. ACE ImmunoID. Precision immunogenomics. Precision Genomics for Immuno-Oncology ACE ImmunoID ACE ImmunoID Precision immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. A universal biomarker platform for immuno-oncology Patient response to cancer immunotherapies

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

SureSelect Cancer All-In-One Custom and Catalog NGS Assays

SureSelect Cancer All-In-One Custom and Catalog NGS Assays SureSelect Cancer All-In-One Custom and Catalog NGS Assays Detect all cancer-relevant variants in a single SureSelect assay SNV Indel TL SNV Indel TL Single DNA input Single AIO assay Single data analysis

More information

Comprehensive genomic profiling for various solid tumors

Comprehensive genomic profiling for various solid tumors Content Highlight Test Specification Test Content Performance Validation Test Report I II III IV V The NovoPM TM comprehensive cancer genomic profiling test Comprehensive genomic profiling for various

More information

Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the

Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the deep dermis. (b) The melanocytes demonstrate abundant

More information

Cell-free tumor DNA for cancer monitoring

Cell-free tumor DNA for cancer monitoring Learning objectives Cell-free tumor DNA for cancer monitoring Christina Lockwood, PhD, DABCC, DABMGG Department of Laboratory Medicine 1. Define circulating, cell-free tumor DNA (ctdna) 2. Understand the

More information

Supplementary Figure 1. Cytoscape bioinformatics toolset was used to create the network of protein-protein interactions between the product of each

Supplementary Figure 1. Cytoscape bioinformatics toolset was used to create the network of protein-protein interactions between the product of each Supplementary Figure 1. Cytoscape bioinformatics toolset was used to create the network of protein-protein interactions between the product of each mutated gene and the panel of 125 cancer-driving genes

More information

Plasma-Seq conducted with blood from male individuals without cancer.

Plasma-Seq conducted with blood from male individuals without cancer. Supplementary Figures Supplementary Figure 1 Plasma-Seq conducted with blood from male individuals without cancer. Copy number patterns established from plasma samples of male individuals without cancer

More information

Supplementary Tables. Supplementary Figures

Supplementary Tables. Supplementary Figures Supplementary Files for Zehir, Benayed et al. Mutational Landscape of Metastatic Cancer Revealed from Prospective Clinical Sequencing of 10,000 Patients Supplementary Tables Supplementary Table 1: Sample

More information

Integration of Cancer Genome into GECCO- Genetics and Epidemiology of Colorectal Cancer Consortium

Integration of Cancer Genome into GECCO- Genetics and Epidemiology of Colorectal Cancer Consortium Integration of Cancer Genome into GECCO- Genetics and Epidemiology of Colorectal Cancer Consortium Ulrike Peters Fred Hutchinson Cancer Research Center University of Washington U01-CA137088-05, PI: Peters

More information

Next generation histopathological diagnosis for precision medicine in solid cancers

Next generation histopathological diagnosis for precision medicine in solid cancers Next generation histopathological diagnosis for precision medicine in solid cancers from genomics to clinical application Aldo Scarpa ARC-NET Applied Research on Cancer Department of Pathology and Diagnostics

More information

New Drug development and Personalized Therapy in The Era of Molecular Medicine

New Drug development and Personalized Therapy in The Era of Molecular Medicine New Drug development and Personalized Therapy in The Era of Molecular Medicine Ramesh K. Ramanathan MD Virginia G. Piper Cancer Center Translational Genomics Research Institute Scottsdale, AZ Clinical

More information

An integrated map of genetic variation from 1092 human genomes

An integrated map of genetic variation from 1092 human genomes SUPPLEMENTAL METHODS AND MATERIALS Whole genome sequencing Alignment: Short insert paired-end reads were aligned to the GRCh37 reference human genome with 1000 genomes decoy contigs using BWA-mem(1). Somatic

More information

Section 2 Original Policy Date 2013 Last Review Status/Date September 1, 2014

Section 2 Original Policy Date 2013 Last Review Status/Date September 1, 2014 Policy Number 2.04.82 Molecular Markers in Fine Needle Aspirates of the Thyroid Medical Policy Section 2 Original Policy Date 2013 Last Review Status/Date September 1, 2014 Disclaimer Our medical policies

More information

Relationship between genomic features and distributions of RS1 and RS3 rearrangements in breast cancer genomes.

Relationship between genomic features and distributions of RS1 and RS3 rearrangements in breast cancer genomes. Supplementary Figure 1 Relationship between genomic features and distributions of RS1 and RS3 rearrangements in breast cancer genomes. (a,b) Values of coefficients associated with genomic features, separately

More information

NGS IN ONCOLOGY: FDA S PERSPECTIVE

NGS IN ONCOLOGY: FDA S PERSPECTIVE NGS IN ONCOLOGY: FDA S PERSPECTIVE ASQ Biomed/Biotech SIG Event April 26, 2018 Gaithersburg, MD You Li, Ph.D. Division of Molecular Genetics and Pathology Food and Drug Administration (FDA) Center for

More information

Fluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS

Fluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor

More information

EXAMPLE. - Potentially responsive to PI3K/mTOR and MEK combination therapy or mtor/mek and PKC combination therapy. ratio (%)

EXAMPLE. - Potentially responsive to PI3K/mTOR and MEK combination therapy or mtor/mek and PKC combination therapy. ratio (%) Dr Kate Goodhealth Goodhealth Medical Clinic 123 Address Road SUBURBTOWN NSW 2000 Melanie Citizen Referring Doctor Your ref Address Dr John Medico 123 Main Street, SUBURBTOWN NSW 2000 Phone 02 9999 9999

More information

Genomic Medicine: What every pathologist needs to know

Genomic Medicine: What every pathologist needs to know Genomic Medicine: What every pathologist needs to know Stephen P. Ethier, Ph.D. Professor, Department of Pathology and Laboratory Medicine, MUSC Director, MUSC Center for Genomic Medicine Genomics and

More information

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11 ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N

More information

UNIVERSITY OF TORINO DEPARTMENT OF ONCOLOGY. Giorgio V. Scagliotti University of Torino Dipartment of Oncology

UNIVERSITY OF TORINO DEPARTMENT OF ONCOLOGY. Giorgio V. Scagliotti University of Torino Dipartment of Oncology Giorgio V. Scagliotti University of Torino Dipartment of Oncology giorgio.scagliotti@unito.it Molecular landscape of MM not fully characterized to allow personalized treatment Recurrent genetic alterations

More information

Introduction of an NGS gene panel into the Haemato-Oncology MPN service

Introduction of an NGS gene panel into the Haemato-Oncology MPN service Introduction of an NGS gene panel into the Haemato-Oncology MPN service Dr. Anna Skowronska, Dr Jane Bryon, Dr Samuel Clokie, Dr Yvonne Wallis and Professor Mike Griffiths West Midlands Regional Genetics

More information

Copy number and somatic mutations drive tumors

Copy number and somatic mutations drive tumors Detection of copy number alterations, ploidy and loss of heterozygosity across the genome in FFPE specimens Utility for diagnosis and treatment with comparison to FISH-based and as a complement to sequencing

More information

Genome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl.

Genome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl. GenomeVIP: the Genome Institute at Washington University A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud R. Jay Mashl October 20, 2014 Turnkey Variant

More information

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate

More information

Personalized Medicine: Lung Biopsy and Tumor

Personalized Medicine: Lung Biopsy and Tumor Personalized Medicine: Lung Biopsy and Tumor Mutation Testing Elizabeth H. Moore, MD Personalized Medicine: Lung Biopsy and Tumor Mutation Testing Genomic testing has resulted in a paradigm shift in the

More information

Molecular Testing in Lung Cancer

Molecular Testing in Lung Cancer Molecular Testing in Lung Cancer Pimpin Incharoen, M.D. Assistant Professor, Thoracic Pathology Department of Pathology, Ramathibodi Hospital Genetic alterations in lung cancer Source: Khono et al, Trans

More information

Nature Medicine: doi: /nm.4439

Nature Medicine: doi: /nm.4439 Figure S1. Overview of the variant calling and verification process. This figure expands on Fig. 1c with details of verified variants identification in 547 additional validation samples. Somatic variants

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases.

Nature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases. Supplementary Figure 1 Somatic coding mutations identified by WES/WGS for 83 ATL cases. (a) The percentage of targeted bases covered by at least 2, 10, 20 and 30 sequencing reads (top) and average read

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Molecular Genetics of Paediatric Tumours. Gino Somers MBBS, BMedSci, PhD, FRCPA Pathologist-in-Chief Hospital for Sick Children, Toronto, ON, CANADA

Molecular Genetics of Paediatric Tumours. Gino Somers MBBS, BMedSci, PhD, FRCPA Pathologist-in-Chief Hospital for Sick Children, Toronto, ON, CANADA Molecular Genetics of Paediatric Tumours Gino Somers MBBS, BMedSci, PhD, FRCPA Pathologist-in-Chief Hospital for Sick Children, Toronto, ON, CANADA Financial Disclosure NanoString - conference costs for

More information

DNA-seq Bioinformatics Analysis: Copy Number Variation

DNA-seq Bioinformatics Analysis: Copy Number Variation DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq

More information

Circulating Tumor DNA in GIST and its Implications on Treatment

Circulating Tumor DNA in GIST and its Implications on Treatment Circulating Tumor DNA in GIST and its Implications on Treatment October 2 nd 2017 Dr. Ciara Kelly Assistant Attending Physician Sarcoma Medical Oncology Service Objectives Background Liquid biopsy & ctdna

More information

Nature Biotechnology: doi: /nbt.1904

Nature Biotechnology: doi: /nbt.1904 Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is

More information

Disclosures Genomic testing in lung cancer

Disclosures Genomic testing in lung cancer Disclosures Genomic testing in lung cancer No disclosures Objectives Understand how FISH and NGS provide complementary data for the evaluation of lung cancer Recognize the challenges of performing testing

More information

Golden Helix s End-to-End Solution for Clinical Labs

Golden Helix s End-to-End Solution for Clinical Labs Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics

More information

Genomic landsccape of poorly differentiated and anaplastic thyroid carcinomas: Clues for better classification, risk stratification and therapy

Genomic landsccape of poorly differentiated and anaplastic thyroid carcinomas: Clues for better classification, risk stratification and therapy ACCME/Disclosures The USCAP requires that anyone in a position to influence or control the content of CME disclose any relevant financial relationship WITH COMMERCIAL INTERESTS which they or their spouse/partner

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Details of sequencing analysis.

Nature Genetics: doi: /ng Supplementary Figure 1. Details of sequencing analysis. Supplementary Figure 1 Details of sequencing analysis. (a) Flow chart showing which patients fall into each category and were used for analysis. (b) Graph showing the average and median coverage for all

More information

Nature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data.

Nature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data. Supplementary Figure 1 PCA for ancestry in SNV data. (a) EIGENSTRAT principal-component analysis (PCA) of SNV genotype data on all samples. (b) PCA of only proband SNV genotype data. (c) PCA of SNV genotype

More information

NGS Gateway Lab Services

NGS Gateway Lab Services TM NGS Gateway Lab Services Accelerating Precision Medicine Design a Complete Genomic Testing Portfolio with Turnkey Assays About NGS Gateway Lab Services TM Designed to provide a gateway to your own in-house

More information

Enterprise Interest Thermo Fisher Scientific / Employee

Enterprise Interest Thermo Fisher Scientific / Employee Enterprise Interest Thermo Fisher Scientific / Employee A next-generation sequencing assay to estimate tumor mutation load from FFPE research samples Fiona Hyland. Director of R&D, Bioinformatics Clinical

More information

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,

More information

Cancer Genomics. Nic Waddell. Winter School in Mathematical and Computational Biology. July th

Cancer Genomics. Nic Waddell. Winter School in Mathematical and Computational Biology. July th Cancer Genomics Nic Waddell Winter School in Mathematical and Computational Biology 6th July 2015 Time Line of Key Events in Cancer Genomics Michael R. Stratton Science 2011;331:1553-1558 The Cancer Genome

More information

Genomic structural variation

Genomic structural variation Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural

More information

Illuminating the genetics of complex human diseases

Illuminating the genetics of complex human diseases Illuminating the genetics of complex human diseases Michael Schatz Sept 27, 2012 Beyond the Genome @mike_schatz / #BTG2012 Outline 1. De novo mutations in human diseases 1. Autism Spectrum Disorder 2.

More information

NCCN Non-Small Cell Lung Cancer V Meeting June 15, 2018

NCCN Non-Small Cell Lung Cancer V Meeting June 15, 2018 Guideline Page and Request Illumina Inc. requesting to replace Testing should be conducted as part of broad molecular profiling with Consider NGS-based assays that include EGFR, ALK, ROS1, and BRAF as

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/7/283/283ra54/dc1 Supplementary Materials for Clonal status of actionable driver events and the timing of mutational processes in cancer evolution

More information

MEDICAL POLICY. SUBJECT: MOLECULAR PANEL TESTING OF CANCERS TO IDENTIFY TARGETED THERAPIES (Excluding NSCLC and CRC) EFFECTIVE DATE: 12/21/17

MEDICAL POLICY. SUBJECT: MOLECULAR PANEL TESTING OF CANCERS TO IDENTIFY TARGETED THERAPIES (Excluding NSCLC and CRC) EFFECTIVE DATE: 12/21/17 MEDICAL POLICY SUBJECT: MOLECULAR PANEL TESTING OF PAGE: 1 OF: 5 If a product excludes coverage for a service, it is not covered, and medical policy criteria do not apply. If a commercial product, including

More information

Disclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath

Disclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath Circulating DNA and NGS technology JS Reis-Filho, MD, PhD, FRCPath Director of Experimental Pathology, Department of Pathology Affiliate Member, Human Oncology and Pathogenesis Program Disclosure of Relevant

More information

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)

More information

OncoPPi Portal A Cancer Protein Interaction Network to Inform Therapeutic Strategies

OncoPPi Portal A Cancer Protein Interaction Network to Inform Therapeutic Strategies OncoPPi Portal A Cancer Protein Interaction Network to Inform Therapeutic Strategies 2017 Contents Datasets... 2 Protein-protein interaction dataset... 2 Set of known PPIs... 3 Domain-domain interactions...

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature8645 Physical coverage (x haploid genomes) 11 6.4 4.9 6.9 6.7 4.4 5.9 9.1 7.6 125 Neither end mapped One end mapped Chimaeras Correct Reads (million ns) 1 75 5 25 HCC1187 HCC1395 HCC1599

More information

Comprehensive Genomic Profiling, in record time. Accurate. Clinically Proven. Fast.

Comprehensive Genomic Profiling, in record time. Accurate. Clinically Proven. Fast. Comprehensive Genomic Profiling, in record time Accurate. ly Proven. Fast. PCDx advantages Comprehensive genomic profiling, in record time PCDx Comprehensive Genomic Profiling (CGP) provides precise information

More information

Introduction to Cancer Bioinformatics and cancer biology. Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015

Introduction to Cancer Bioinformatics and cancer biology. Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015 Introduction to Cancer Bioinformatics and cancer biology Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015 Why cancer bioinformatics? Devastating disease, no cure on the horizon Major

More information

Liquid biopsy: the experience of real life case studies

Liquid biopsy: the experience of real life case studies Liquid biopsy: the experience of real life case studies 10 th September 2018 Beatriz Bellosillo Servicio de Anatomía Patológica Hospital del Mar, Barcelona Agenda Introduction Experience in colorectal

More information

NeoTYPE Cancer Profiles

NeoTYPE Cancer Profiles NeoTYPE Cancer Profiles 30+ Multimethod Assays for Hematologic Diseases and Solid Tumors Molecular FISH Anatomic Pathology The next generation of diagnostic, prognostic, and therapeutic assessment What

More information

Comprehensive Analyses of Circulating Cell- Free Tumor DNA

Comprehensive Analyses of Circulating Cell- Free Tumor DNA Comprehensive Analyses of Circulating Cell- Free Tumor DNA Boston, MA June 28th, 2016 Derek Murphy, Ph.D. Scientist, Research and Development Personal Genome Diagnostics Acquisition of Somatic Alterations

More information

Cancer Validation in the 100,000 genomes project. Dr Shirley Henderson ACGS spring meeting 06/07/16

Cancer Validation in the 100,000 genomes project. Dr Shirley Henderson ACGS spring meeting 06/07/16 Cancer Validation in the 100,000 genomes project Dr Shirley Henderson ACGS spring meeting 06/07/16 Cancer is a lesion of the Genome Diagnosis Cancer Molecular Lesions Prognosis Disease Monitoring Why is

More information

Investigating rare diseases with Agilent NGS solutions

Investigating rare diseases with Agilent NGS solutions Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe

More information

Supplementary Figure 1. Copy Number Alterations TP53 Mutation Type. C-class TP53 WT. TP53 mut. Nature Genetics: doi: /ng.

Supplementary Figure 1. Copy Number Alterations TP53 Mutation Type. C-class TP53 WT. TP53 mut. Nature Genetics: doi: /ng. Supplementary Figure a Copy Number Alterations in M-class b TP53 Mutation Type Recurrent Copy Number Alterations 8 6 4 2 TP53 WT TP53 mut TP53-mutated samples (%) 7 6 5 4 3 2 Missense Truncating M-class

More information

The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients

The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients ASSC Scientific Meeting 13 th October 2016 Prof Andrew Barbour UQ SOM

More information

Personalised cancer care Information for Medical Specialists. A new way to unlock treatment options for your patients

Personalised cancer care Information for Medical Specialists. A new way to unlock treatment options for your patients Personalised cancer care Information for Medical Specialists A new way to unlock treatment options for your patients Contents Optimised for clinical benefit 4 Development history 4 Full FIND IT panel vs

More information

Nature Genetics: doi: /ng Supplementary Figure 1. SEER data for male and female cancer incidence from

Nature Genetics: doi: /ng Supplementary Figure 1. SEER data for male and female cancer incidence from Supplementary Figure 1 SEER data for male and female cancer incidence from 1975 2013. (a,b) Incidence rates of oral cavity and pharynx cancer (a) and leukemia (b) are plotted, grouped by males (blue),

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Systematic investigation of cancer-associated somatic point mutations in SNP databases HyunChul Jung 1,2, Thomas Bleazard 3, Jongkeun Lee 1 and Dongwan Hong 1 1. Cancer Genomics

More information

Identifying Mutations Responsible for Rare Disorders Using New Technologies

Identifying Mutations Responsible for Rare Disorders Using New Technologies Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance

More information

NeoTYPE Cancer Profiles

NeoTYPE Cancer Profiles NeoTYPE Cancer Profiles Multimethod Analysis of 25+ Hematologic Diseases and Solid Tumors Anatomic Pathology FISH Molecular The next generation of diagnostic, prognostic, and therapeutic assessment NeoTYPE

More information

Nature Genetics: doi: /ng.2995

Nature Genetics: doi: /ng.2995 Supplementary Figure 1 Kaplan-Meier survival curves of patients with brainstem tumors. (a) Comparison of patients with PPM1D mutation versus wild-type PPM1D. (b) Comparison of patients with PPM1D mutation

More information

Figure S4. 15 Mets Whole Exome. 5 Primary Tumors Cancer Panel and WES. Next Generation Sequencing

Figure S4. 15 Mets Whole Exome. 5 Primary Tumors Cancer Panel and WES. Next Generation Sequencing Figure S4 Next Generation Sequencing 15 Mets Whole Exome 5 Primary Tumors Cancer Panel and WES Get coverage of all variant loci for all three Mets Variant Filtering Sequence Alignments Index and align

More information

Cancer Informatics Lecture

Cancer Informatics Lecture Cancer Informatics Lecture Mayo-UIUC Computational Genomics Course June 22, 2018 Krishna Rani Kalari Ph.D. Associate Professor 2017 MFMER 3702274-1 Outline The Cancer Genome Atlas (TCGA) Genomic Data Commons

More information

Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection

Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin

More information

StrandAdvantage Tissue-Specific Cancer Genomic Tests. Empowering Crucial First-Line Therapy Decisions for Your Patient

StrandAdvantage Tissue-Specific Cancer Genomic Tests. Empowering Crucial First-Line Therapy Decisions for Your Patient StrandAdvantage Tissue-Specific Cancer Genomic Tests Empowering Crucial First-Line Therapy Decisions for Your Patient Harness the power of precision medicine with StrandAdvantage Precision medicine in

More information

ARTICLE RESEARCH. Macmillan Publishers Limited. All rights reserved

ARTICLE RESEARCH. Macmillan Publishers Limited. All rights reserved Extended Data Figure 6 Annotation of drivers based on clinical characteristics and co-occurrence patterns. a, Putative drivers affecting greater than 10 patients were assessed for enrichment in IGHV mutated

More information

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized

More information

Identification and clinical detection of genetic alterations of pre-neoplastic lesions Time for the PML ome? David Sidransky MD Johns Hopkins

Identification and clinical detection of genetic alterations of pre-neoplastic lesions Time for the PML ome? David Sidransky MD Johns Hopkins Identification and clinical detection of genetic alterations of pre-neoplastic lesions Time for the PML ome? David Sidransky MD Johns Hopkins February 3-5, 2016 Lansdowne Resort, Leesburg, VA Molecular

More information

Out-Patient Billing CPT Codes

Out-Patient Billing CPT Codes Out-Patient Billing CPT Codes Updated Date: August 3, 08 Client Billed Molecular Tests HPV DNA Tissue Testing 8764 No Medicare Billed - Molecular Tests NeoARRAY NeoARRAY SNP/Cytogenetic No 89 NeoLAB NeoLAB

More information

The 100,000 Genomes Project Harnessing the power of genomics for NHS rare disease and cancer patients

The 100,000 Genomes Project Harnessing the power of genomics for NHS rare disease and cancer patients The 100,000 Genomes Project Harnessing the power of genomics for NHS rare disease and cancer patients Dr Richard Scott, Clinical Lead for Rare Disease Dr Nirupa Murugaesu, Clinical Lead for Cancer Four

More information

An ultrasensitive method for quantitating circulating tumor DNA with broad patient coverage

An ultrasensitive method for quantitating circulating tumor DNA with broad patient coverage An ultrasensitive method for quantitating circulating tumor DNA with broad patient coverage Aaron M Newman1,2,7, Scott V Bratman1,3,7, Jacqueline To3, Jacob F Wynne3, Neville C W Eclov3, Leslie A Modlin3,

More information