SALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407
|
|
- Marilynn Byrd
- 6 years ago
- Views:
Transcription
1 SALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407 The Mismatch Repair (MMR) system is critical for the maintenance of genomic stability. MMR increases the fidelity of DNA replication by identifying and excising single-base mismatches and insertion-deletion loops that may arise during DNA replication. Cells with MMR deficiency may lead to the accumulation of mutations resulting in the initiation of cancer. The MMR genes are involved in one of the most prevalent cancer syndromes in humans known as hereditary nonpolyposis colon cancer (HNPCC). There are several proteins required for the complete MMR system. Mutations in the MLH1 and MSH2 have been found in about 90% of HNPCC cases. Mutations in other MMR genes have been less frequent in HNPCC patients. In many sporadic colon cancers, hypermethylation of the MLH1 gene promoter resulting in its transcriptional silencing has been observed more than mutations. This ME011-A1 MMR mix has been developed to detect aberrant CpG islands methylation of six MMR genes and includes 5 s for MLH1, 3 s MSH2, 3 s for MHSH6, 3 s for MSH3, 1 for MLH3, 3 s for PMS2 and 3 s specific for the MGMT promoter region. MGMT plays a role in removing O(6)-alkylguanine which is the major mutagenic and carcinogenic lesion induced by alkylating mutagens. The MLH1 gene is located at chromosome 3p22.1, MLH3 at chromosome 14q24.3, MSH2 at 2p21, MSH3 at 05q14.1, MSH6 gene at 2p16, PMS2 at 7p22 and the MGMT gene is located at chromosome 10q26. This kit includes 21 s containing a recognition, which yields information about the methylation status of a target sequences. In addition, 11 reference s are present which are not influenced by the digestion. Besides the detection of aberrant methylation, all s present will give information on copy number changes in the analysed sample. More information about MS-MLPA can be found on page 6. This SALSA MS-MLPA kit can be used to detect aberrant methylation of one or more sequences of the MMR genes. Methylation levels can be different for different tissues. Please use DNA derived from the same type of tissue and purified by the same method as reference sample. This SALSA MS-MLPA kit can be used to detect deletions and duplications of one or more sequences of the MMR genes. Heterozygous deletions of recognition sequences should give a 35-50% reduced relative peak area of the amplification product of that. However, mutations and/or polymorphisms very close to the ligation may also result in a reduced relative peak area. Therefore, apparent deletions detected by a single always require confirmation by other methods. We have no information on what percentage of defects in these genes is caused by deletions/duplications of complete exons. Please note that most defects in these genes are expected to be small (point) mutations, most of which will not be detected by this MLPA test. SALSA MS- kits are sold by for research purposes and to demonstrate the possibilities of the MLPA technique. This kit is not CE/FDA certified for use in diagnostic procedures. kits are supplied with all necessary buffers and enzymes. Purchase of the test kits includes a limited license to use these products for research purposes. The use of this SALSA kit requires a thermocycler with heated lid and sequence type electrophoresis equipment. Different fluorescent PCR primers are available. The MLPA technique has been first described in Nucleic Acid Research 30, e57 (2002). The MS-MLPA method for the detection of both copy numbers and methylation changes was described in Nucleic Acid Research 33, e128 by Nygren et al Related kits P003 MLH1/MSH2: Hereditary nonpolyposis colon cancer (HNPCC) genes included: MSH2, MLH1 P248 MLH1/MSH2: HNPCC confirmation genes included: MSH2, MLH1 P008 MSH6/PMS2: HNPCC genes included: MSH6, PMS2, MUTYH More information Web : info@mlpa.com; Fax : Mail : bv; Willem Schoutenstraat 6, 1057 DN Amsterdam, the Netherlands SALSA MS- kit ME011 MMR Page 1 of 8
2 References of kit ME011 Jeuken JW et al. (2007). MS-MLPA: an attractive alternative laboratory assay for robust, reliable, and semiquantitative detection of MGMT promoter hypermethylation in gliomas. Lab Invest Aug 13. Please note During testing on various tumour samples, we have observed that many s undergo significant methylation changes. However, as we have little access to patient samples, it is unfortunately not possible for to validate each on samples with known decreased mrna levels and of which the methylation status of the sequences has been confirmed by independent methods. The MS-MLPA s are in promoter regions which are unmethylated in normal blood-derived control samples, and they do not generate a signal after digestion in normal controls. We have tested each by in vitro methylation of sample DNAs with Hha1 methylase, and found each signal indeed remains intact after Hha1 digestion. Methylation-specific MLPA Please note that each MS-MLPA reaction generates two samples that need analysis by capillary electrophoresis: one undigested sample for copy number detection and one digested sample for methylation detection. A modification of the MLPA technique, MS-MLPA allows the detection of both copy number changes and unusual methylation levels of different sequences in one simple reaction. MLPA s for methylation quantification are similar to normal MLPA s, except that the sequence detected by the MS-MLPA contains the sequence recognized by the methylation-sensitive restriction enzyme. Similar to ordinary MLPA reactions, the MS-MLPA protocol starts with sample DNA denaturation and overnight hybridization. The reaction then is split into two tubes. One tube is processed as a standard MLPA reaction. This reaction provides information on copy number changes. The other tube of the MLPA hybridization reaction is incubated with the methylation-sensitive endonuclease while simultaneously, the hybridized s are ligated. Hybrids of (unmethylated) oligonucleotides and unmethylated sample DNA are digested by the enzyme. Digested s will not be exponentially amplified by PCR and hence will not generate a signal when analyzed by capillary electrophoresis. In contrast, if the sample DNA is methylated, the hemimethylated -sample DNA hybrids are prevented from being digested by and the ligated s will generate a signal. More information about MS-MLPA can be found in the MS-MLPA protocol. Please note that this product can not be used with an alternative protocol in which the genomic DNA is first digested with Hha1, followed by MLPA reactions on both digested and undigested genomic DNA. Data analysis The ME011-A1 MMR mix contains 32 different s with amplification products between 136 and 400 nt. In addition, it contains 7 control fragments generating an amplification product smaller than 120 nt: four DNA Quantity fragments (Q-fragments) at nt and three DNA denaturation control fragments (Dfragments) at nt. More information on how to interpret observations on these control fragments can be found in the MLPA protocol. Intra-sample data normalisation (all samples) For analysis of MLPA results, not the absolute fluorescence values but intra-normalized data are used (relative peak areas). The data generated in the digested and undigested sample should first be normalized intra-sample by comparing the signal of each target-specific against every single reference separately, thereby creating as many ratios per as there are reference s. The median of all produced ratios per gives an estimate of the final ratio of the sample s targetspecific sequences. This median can then be used for sample to reference comparison, both in the copy number determination and in the digestion determination. Copy numbers determination (comparison between undigested samples) The final ratio, or ploidy status, of each is calculated by comparing a) the intra-normalized ratio of each obtained on the undigested patient sample with b) the average intra-normalized ratio of each obtained on the undigested reference samples. When copy number changes have a low coincidence in SALSA MS- kit ME011 MMR Page 2 of 8
3 your samples (20% or lower) you may also use the median of all intra-normalized signals of all undigested samples per. Methylation analysis (comparing digested and undigested samples) Methylation status of MS-MLPA s* is calculated by dividing a) the intra-normalized ratio of each MS- MLPA obtained on the digested sample with b) the intra-normalized ratio of each MS-MLPA obtained on the undigested sample. Multiplying this value with 100 gives an estimation of the percentage methylation. Aberrant methylation can than be identified by a changed methylation status of one or more MS-MLPA s in a patient sample when compared to results obtained on DNA reference samples. *Note: An MS-MLPA targets a single specific in a CpG island; if methylation is absent for a particular CpG-, this does not necessarily mean that the whole CpG island is unmethylated! For samples containing both tumour and normal cells, MLPA experiments will indicate the average copy number of genes. When only small numbers of samples are tested, visual comparison of peak profiles should be sufficient to easily identify exon deletions and methylation status. Comparison of results should preferably be performed within one experiment. Only samples from the same tissue and purified by the same method should be compared. Note that Coffalyser, the MLPA analysis tool developed at, can be downloaded free of charge from our web This mix was developed by A. Errami & J.P. Schouten at. In case the results obtained with this mix lead to a scientific publication, it would be very much appreciated if the first mix designer could be made a coauthor. Info/remarks/suggestions for improvement: info@mlpa.com. SALSA MS- kit ME011 MMR Page 3 of 8
4 SALSA MS-MLPA ME011-A1 MMR mix Hha1 Chromosomal position reference MMR Q-fragments: DNA quantity; only visible with less than 100 ng sample DNA D-fragments: Low signal of 88 or 96 nt fragment indicates incomplete denaturation 136 Reference (CREM) 0981-L p PMS L p MLH L1265-3p PMS L p MSH L p MLH L p Reference (TNFRSF1A) 0554-L p MSH L p MGMT 5670-L q MLH L p MLH L q MSH L p MSH L q Reference (PAH) 2334-L q MLH L p MSH L0499-2p Reference (BCL2) 0587-L q * MLH L p MSH L p MSH L q MLH L p MSH L p Reference (CDK6) 3184-L2523-7q * MGMT 7188-L q PMS L p Reference (CDH1) 2416-L q * MSH L q MLH L q Reference (AI651963) 1234-L p MGMT 2239-L q Reference (TSPAN15) 0973-L q MSH L p21 * More variable and might be replaced in future lots. This contains a but is not completely digested when normal blood-derived DNA is used! Note: Please notify us of any mistakes. The identity of the genes detected by the reference s is available on request: info@mlpa.com. SALSA MS- kit ME011 MMR Page 4 of 8
5 MMR s arranged according to chromosomal location The Hha1 s are marked with grey. s are marked with - MLH1 s L7710 MLH L1265 MLH1-265* 6221-L1747 MLH L7712 MLH L1266 MLH L1745 MLH1 + * More variable. (distance to ATG start) (Deng, A-region) (Deng, B-region) Reverse (Deng, B-region) (Deng, C-region) - 13 (Deng, D-region) (intron 1, 93 nt after exon 1) TCCGCCACATACCGCTCGTAGTAT- TCGTGCTCAGCCTCGTAGTGGCGCCTGAC GGGTCCACTCGGGCCGGAAAACT- AGAGCCTCGTCGACTTCCATCTTGCTTCTTT CTGCTGAGGTGATCTGGCGCAGA- GCGGAGGAGGTGCTTGGCGCTTCTCAGGC AGAGCGGACAGCGATCTCTAACGCGCAA- GCGCATATCCTTCTAGGTAGCGGGCAGTA CGTTGAGCATCTAGACGTTTCCTTGGCTCT- TCTGGCGCCAAAATGTCGTTCGTGGCAGG CGGACACGCCTCTTTGCCCGGGCAGA- GGCATGTACAGCGCATGCCCACAACGGCG Distance to next 0.2 kb 0.2 kb The most important methylation region for MLH1 expression, the Deng C-region, is from -248 to -178 nt before the transcription. The transcription that Deng uses for reference lies 21 nt before the startcodon. The second most important region, the Deng D-region, is from -9 to +15 nt (Deng G. et al (1999) Cancer Research 59, and Capel, E. et al (2007) Oncogene advance online publ.). For this reason, methylation of the 198 and 166 nt s will be most important for mrna expression. It is not possible for us to design extra MLPA s in these regions as there are no other s. MSH2 s L7711 MSH2 + AY reverse L2162 MSH L0599 MSH * 0911-L0499 * More variable MSH2 exon CGAAACCCGCAGACGCGCATCCT- TAGTAGAGCTCCTTTCTGTGTTTACTCAGCT AGTAGCTAAAGTCACCAGCGTGCGCGGGA- AGCTGGGCCGCGTCTGCTTATGATTGGTTG CCTTTTCGACCGGGGCGACTTCT- ATACGGCGCACGGCGAGGACGCGCTGCTG CGTCGATTCCCAGATCTTAACCGACT- TGCCAAGAAGTTTCAAAGACAAGCAGCAAA Distance to next 0.3 kb 26.5 kb The MSH2 ATG startcodon is at in this AY sequence. MSH6 s U L5732 MSH CCAGCCCCGCGGCGTGAGGGA - AGGGGAGCTCAGCAGTTCCCCGCGCGGGG L5733 MSH CGAGGCGCCTGTTGATTGGCCACT-GGGG CCCGGGTTCCTCCGGCGGAGCGCGCCT L5731 MSH CGTTCTGTCGGACGGAGCTCCTAAAAreverse GCACCGCATCTACCGCGCGGCTCCTGCTG Distance to next 0.2 kb The MSH6 ATG startcodon is at in this U sequence. One more methylation for MSH6 is available in kit ME002 Tumor suppressor-2. SALSA MS- kit ME011 MMR Page 5 of 8
6 MLH3 s NM_ L7722 MLH L0793 MLH3, exon CGTGGGCACGCACGAGCCTCA- AGATCCAAGGTGCGCGCGTCGGCGTCCGAG GCGACCTTGTTCTTCCTTTCCTTCCGA- GAGCTCGAGCAGAGAGGACTGTGATGAGAC Distance to next 9.0 kb The MLH3 ATG startcodon is at in this NM_ sequence (startcodon in exon 2). PMS2 s Genbank AC L7715 PMS L7716 PMS L4043 PMS GCAAAAGGGGGTAGCGCGTGCCAAAG- GCCAACGCTCAGAAACCGTCAGAGGTCACG CCAATGGGAGTTCAGGAGGCGGA- GCGCCTGTGGGAGCCCTGGAGGGAACTTT GGAGGTGAGCGGGGCTCGCAGTCT- TCCGGTGTCCCCTCTCGCGCGCCCTCTTTG Distance to next 0.2 kb The PMS2 ATG startcodon is at in this AC sequence. MSH3 s L7721 MSH3 + Genbank AY reverse 346* 7939-L7720 MSH ** 7938-L7719 MSH GGGCTGCTGCGCGGGAGGCCCAGT-TGCTG ATTTCTGCCCGGATTCTGCTGCCCGGTGAG GTGGGCAGCCTGCGCCCGTTT- GGGTCCCATCGCCCCGGCCCGGCAGATACC GACAGCAGCGGGAGGACCTCCGA-GCCCG CTCGTTACAGCAGAACGCGCGGTCAAGTTT Distance to next * More variable The MSH3 ATG startcodon is at in this AY sequence. ** This contains a but is not digested completely when normal blood-derived DNA is used!!! MGMT s Genbank X L1261 MGMT L5146 MGMT * 7188-L5144 MGMT * More variable Transcript NM_ starts at CCAGCGTAGCCGCCCCGAGCA-GGACCGGG ATTCTCACTAAGCGGGCGCCGTC GGCAAACTAAGGCACAGAGCCTCA-GGCGG AAGCTGGGAAGGCGCCGCCCGGCTTGTAC GTCCTCGCGGTGCGCACCGTT-TGCGA CTTGGTGAGTGTCTGGGTCGCCTCGCTCC Distance to next 0.4 kb Complete sequences are available on request: info@mlpa.com. SALSA MS- kit ME011 MMR Page 6 of 8
7 Reference s Partial sequence L0781 AI CAATTGCCATTTTTTCCTGACATTCACTGT- GGAAATTTGGTGCACGACACTGTTAGGGGA L0382 BCL2 - CTTCTCCTGGCTGTCTCTGAAGACTC- TGCTCAGTTTGGCCCTGGTGGGAGCTTGCA L1862 CDH1 - CTATGAAGGAAGCGGTTCCGAAGCTGCTA- GTCTGAGCTCCCTGAACTCCTCAGAGTCAG L2523 CDK6 - CGTGATTGGACTCCCAGGAGAAGAAGACT- GGCCTAGAGATGTTGCCCTTCCCAGGCAGG L0566 CREM - GGAGCTCCTCCACCAGGTGCTACAAT-TGTA CAGTACGCAGCACAATCAGCTGATGGCACA L0560 TSPAN15 - GGGGTGGAGGACATCATCATGGA-GCACT CTGTCACTGATGGGCTCCTGGGGCCCGGTG L1820 PAH - CAGTGCCCTGGTTCCCAAGAA-CCATTCAAG AGCTGGACAGATTTGCCAATCAGATTCTCA L0123 TNFRSF1A - GCCACACTGCCCTGAGCCCAA-ATGGG GGAGTGAGAGGCCATAGCTGTCTGGC The Hha1 s are marked with grey. s are marked with - Chromosomal location 10p14 18q q22.1 7q p q22 12q23 12p13.31 Complete sequences are available on request: info@mlpa.com. SALSA MS- kit ME011 MMR Page 7 of 8
8 kit ME011 MMR sample picture ,63 158,16 238, ,39 166,35 133,77 153,11 246,50 263,58 318,83 96,10 208, ,61 91,16 195,37 183,12 228, ,81 190,12 201,08 219,36 256,30 281,69 291,57 353,21 396,21 272,35 308,78 326,88 336,91 381,74 364, ,53 344,39 300, Dye Signal Size Figure 1. Capillary electrophoresis pattern from a sample of approximately 50 ng human male control DNA analyzed with kit ME011 MMR (lot 0609) undigested control DNA Dye Signal Size Figure 2. Capillary electrophoresis pattern from a sample of approximately 50 ng human male control DNA analyzed with kit ME011 MMR (lot 0407) digested with Hha1. The MSH3 at length 282 nt contains a but is not completely digested when blood-derived DNA is used! Please note an aspecific product may be present at 350 nt. SALSA MS- kit ME011 MMR Page 8 of
MRC-Holland MLPA. Description version 29;
SALSA MLPA KIT P003-B1 MLH1/MSH2 Lot 1209, 0109. As compared to the previous lots 0307 and 1006, one MLH1 probe (exon 19) and four MSH2 probes have been replaced. In addition, one extra MSH2 exon 1 probe,
More informationMRC-Holland MLPA. Description version 08; 30 March 2015
SALSA MLPA probemix P351-C1 / P352-D1 PKD1-PKD2 P351-C1 lot C1-0914: as compared to the previous version B2 lot B2-0511 one target probe has been removed and three reference probes have been replaced.
More informationMRC-Holland MLPA. Description version 28; 4 January 2018
SALSA MLPA probemix ME011-B3 Mismatch Repair genes Lot B3-1017 and B3-0715. As compared to the previous version B2 (lot B2-0614), one probe has a small change in length but no change in the sequence detected.
More informationSALSA MLPA probemix P315-B1 EGFR
SALSA MLPA probemix P315-B1 EGFR Lot B1-0215 and B1-0112. As compared to the previous A1 version (lot 0208), two mutation-specific probes for the EGFR mutations L858R and T709M as well as one additional
More informationMRC-Holland MLPA. Description version 14; 28 September 2016
SALSA MLPA probemix P279-B3 CACNA1A Lot B3-0816. As compared to version B2 (lot B2-1012), one reference probe has been replaced and the length of several probes has been adjusted. Voltage-dependent calcium
More informationSALSA MLPA KIT P050-B2 CAH
SALSA MLPA KIT P050-B2 CAH Lot 0510, 0909, 0408: Compared to lot 0107, extra control fragments have been added at 88, 96, 100 and 105 nt. The 274 nt probe gives a higher signal in lot 0510 compared to
More informationSALSA MLPA probemix P169-C2 HIRSCHSPRUNG-1 Lot C As compared to version C1 (lot C1-0612), the length of one probe has been adjusted.
mix P169-C2 HIRSCHSPRUNG-1 Lot C2-0915. As compared to version C1 (lot C1-0612), the length of one has been adjusted. Hirschsprung disease (HSCR), or aganglionic megacolon, is a congenital disorder characterised
More informationMRC-Holland MLPA. Description version 06; 07 August 2015
SALSA MLPA probemix P323-B1 CDK4-HMGA2-MDM2 Lot B1-0711. As compared to version A1 (test version sent to test labs), this product has been completely redesigned. Probes for HMGA2 and several other genes
More informationPRADER WILLI/ANGELMAN
SALSA MS-MLPA probemix ME028-B2 PRADER WILLI/ANGELMAN Lot B2-0811: As compared to version B1 (lot B1-0609, B1-1108), the 88 and 96 nt control fragments have been replaced (QDX2). PRADER-WILLI SYNDROME
More informationP323-B1 CDK4-HMGA2-MDM2
SALSA MLPA probemix P323-B1 CDK4-HMGA2-MDM2 Lot B1-0714, B1-0711. As compared to previous test version (lot A1-0508), this probemix has been completely redesigned. Probes for HMGA2 and several other genes
More informationMRC-Holland MLPA. Description version 12; 13 January 2017
SALSA MLPA probemix P219-B3 PAX6 Lot B3-0915: Compared to version B2 (lot B2-1111) two reference probes have been replaced and one additional reference probe has been added. In addition, one flanking probe
More informationSALSA MLPA probemix P241-D2 MODY mix 1 Lot D As compared to version D1 (lot D1-0911), one reference probe has been replaced.
mix P241-D2 MODY mix 1 Lot D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent diabetes
More informationNew: P077 BRCA2. This new probemix can be used to confirm results obtained with P045 BRCA2 probemix.
SALSA MLPA KIT P045-B2 BRCA2/CHEK2 Lot 0410, 0609. As compared to version B1, four reference probes have been replaced and extra control fragments at 100 and 105 nt (X/Y specific) have been included. New:
More informationMRC-Holland MLPA. Description version 07; 26 November 2015
SALSA MLPA probemix P266-B1 CLCNKB Lot B1-0415, B1-0911. As compared to version A1 (lot A1-0908), one target probe for CLCNKB (exon 11) has been replaced. In addition, one reference probe has been replaced
More informationMRC-Holland MLPA. Description version 29; 31 July 2015
SALSA MLPA probemix P081-C1/P082-C1 NF1 P081 Lot C1-0114. As compared to the previous B2 version (lot 0813 and 0912), 11 target probes are replaced or added, and 10 new reference probes are included. P082
More informationMRC-Holland MLPA. Description version 06; 23 December 2016
SALSA MLPA probemix P417-B2 BAP1 Lot B2-1216. As compared to version B1 (lot B1-0215), two reference probes have been added and two target probes have a minor change in length. The BAP1 (BRCA1 associated
More informationMRC-Holland MLPA. Description version 30; 06 June 2017
SALSA MLPA probemix P081-C1/P082-C1 NF1 P081 Lot C1-0517, C1-0114. As compared to the previous B2 version (lot B2-0813, B2-0912), 11 target probes are replaced or added, and 10 new reference probes are
More informationSALSA MLPA KIT P060-B2 SMA
SALSA MLPA KIT P6-B2 SMA Lot 111, 511: As compared to the previous version B1 (lot 11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). Please note that, in contrast to the
More informationMRC-Holland MLPA. Description version 13;
SALSA MLPA probemix P027-C1 Uveal Melanoma Lot C1-0211: A large number of probes have been replaced by other probes in the same chromosomal regions as compared to previous lots, and several reference probes
More informationMRC-Holland MLPA. Description version 08; 18 November 2016
SALSA MLPA probemix P122-D1 NF1 AREA Lot D1-1016. As compared to lot C2-0312, four probes in the NF1 area and one reference probe have been removed, four reference probes have been replaced and several
More informationSALSA MLPA probemix P241-D2 MODY mix 1 Lot D2-0716, D As compared to version D1 (lot D1-0911), one reference probe has been replaced.
mix P241-D2 MODY mix 1 Lot D2-0716, D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent
More informationMRC-Holland MLPA. Description version 18; 09 September 2015
SALSA MLPA probemix P090-A4 BRCA2 Lot A4-0715, A4-0714, A4-0314, A4-0813, A4-0712: Compared to lot A3-0710, the 88 and 96 nt control fragments have been replaced (QDX2). This product is identical to the
More informationMRC-Holland MLPA. Description version 08; 07 May 2015
mix P185-C1 Intersex Lot C1-0611: As compared to the previous version B2 (lot B2-0311), s for CYP21A2 have been removed and s for the CXorf21 gene as well as additional s for NR0B1, NR5A1 and the Y chromosome
More informationMRC-Holland MLPA. Description version 19;
SALSA MLPA probemix P6-B2 SMA Lot B2-712, B2-312, B2-111, B2-511: As compared to the previous version B1 (lot B1-11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). SPINAL
More informationMRC-Holland MLPA. Description version 52; 22 July 2015
SALSA MS-MLPA probemix ME028-B2 Prader-Willi/Angelman Lot B2-0413, lot B2-0811. As compared to version B1 (lot B1-0609), the control fragments have been replaced (QDX2). PRADER-WILLI SYNDROME (PWS) and
More informationSALSA MLPA probemix P371-A1 Microdeletion Syndromes 5 Lot A1-0509
mix P371-A1 Microdeletion Syndromes 5 Lot A1-0509 The purpose of the P371 mix is to further investigate results found with the P245 Microdeletion mix. The P245 mix provides a possibility to screen samples
More informationSALSA MLPA probemix P185-C2 Intersex Lot C2-1015: As compared to the previous version C1 (lot C1-0611), the lengths of four probes have been adjusted.
mix P185-C2 Intersex Lot C2-1015: As compared to the previous version C1 (lot C1-0611), the lengths of four s have been adjusted. The sex-determining region on chromosome Y (SRY) is the most important
More informationSALSA MLPA probemix P372-B1 Microdeletion Syndromes 6 Lot B1-1016, B
SALSA MLPA probemix P372-B1 Microdeletion Syndromes 6 Lot B1-1016, B1-0613. The purpose of the P372 probemix is to further investigate results found with the P245 Microdeletion Syndromes-1A probemix. The
More informationMost severely affected will be the probe for exon 15. Please keep an eye on the D-fragments (especially the 96 nt fragment).
SALSA MLPA probemix P343-C3 Autism-1 Lot C3-1016. As compared to version C2 (lot C2-0312) five reference probes have been replaced, one reference probe added and several lengths have been adjusted. Warning:
More informationMRC-Holland MLPA. Description version 05; 03 April 2019
SALSA MLPA probemix ME012-A1 MGMT-IDH1-IDH2 Lot A1-1215. Glioblastoma, the most common malignant primary brain tumour, is characterised by aggressive behaviour and a poor survival. Hypermethylation in
More informationMRC-Holland MLPA. Description version 23; 15 February 2018
SALSA MLPA probemix P225-D2 PTEN Lot D2-0315. As compared to the previous version (lot D1-0613), one probe has a small change in length but no change in the sequence detected. PTEN is a tumour suppressor
More informationSALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A
SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A1-1011. This SALSA MLPA probemix is for basic research and intended for experienced MLPA users only! This probemix enables you to quantify genes
More informationMRC-Holland MLPA. Related SALSA MLPA probemixes P190 CHEK2: Breast cancer susceptibility, genes included: CHEK2, ATM, PTEN, TP53.
SALSA MLPA probemix P056-C1 TP53 Lot C1-0215 & lot C1-0214. As compared to version B1 (lot B1-1011) most of the reference and flanking probes have been replaced and several have been added. Furthermore,
More informationSALSA MLPA KIT P078-B1 Breast Tumour Lot 0210, 0109
SALSA MLPA KIT P078-B1 Breast Tumour Lot 0210, 0109 This P078-B1 Breast Tumour probemix contains probes for several genes (including ERBB2, BIRC5, MYC, TOP2A, ESR1, MTDH, CCND1, CCNE1, EGFR and C11orf30)
More informationMRC-Holland MLPA. Description version 23; 26 January 2017
SALSA MLPA probemix ME024-B2 9p21 CDKN2A/2B region Lot B2-0615. As compared to the previous version B1 (lot B1-0411), one flanking probe is redesigned, two reference probes are replaced, and several probes
More informationSALSA MLPA probemix P383-A1 T-ALL Lot A
SALSA MLPA probemix P383-A1 T-ALL Lot A1-0213. T-lineage acute lymphoblastic leukaemia (T-ALL) is a clonal malignant disorder of immature T-cells, which accounts for about 15% of paediatric and 25% of
More informationProduct Description SALSA MS-MLPA Probemix ME011-C1 Mismatch Repair Genes To be used with the MS-MLPA General Protocol.
Product Description SALSA MS- Probemix ME011-C1 Mismatch Repair Genes To be used with the MS-MLPA General Protocol. Version C1. As compared to the previous version (lot B3-1017), this probemix has been
More informationSALSA MLPA Probemix P014-B1 Chromosome 8 Lot B and B
SALSA MLPA Probemix P014-B1 Chromosome 8 Lot B1-0916 and B1-0713. Copy number changes of the human chromosome 8 are common in many types of tumours. In most cases, losses of 8p sequences and gains of 8q
More informationSALSA MLPA probemix P175-A3 Tumour Gain Lot A3-0714: As compared to the previous version A2 (lot A2-0411), nine probes have a small change in length.
SALSA MLPA probemix P175-A3 Tumour Gain Lot A3-0714: As compared to the previous version A2 (lot A2-0411), nine probes have a small change in length. This SALSA probemix is for basic research only! This
More informationProduct Description SALSA MLPA probemix P045-C1 BRCA2/CHEK2 To be used with the MLPA General Protocol.
Product Description SALSA probemix P045-C1 BRCA2/CHEK2 To be used with the MLPA General Protocol. Version C1. As compared to version B3, the probes for the BRCA2 upstream region and exons 8, 11, 12, 19
More informationProduct Description SALSA MS-MLPA Probemix ME028-C1 Prader-Willi/Angelman To be used with the MS-MLPA General Protocol.
Product Description SALSA MS- Probemix ME028-C1 Prader-Willi/Angelman To be used with the MS-MLPA General Protocol. Version C1. For complete product history see page 9. Catalogue numbers: ME028-025R: SALSA
More informationProduct Description SALSA MLPA Probemix P027-C2 Uveal melanoma To be used with the MLPA General Protocol.
Product Description SALSA Probemix P027-C2 Uveal melanoma To be used with the MLPA General Protocol. Version C2. As compared to version C1, three reference probes have been replaced and the lengths of
More informationProduct Description SALSA MLPA Probemix P055-D1 PAH To be used with the MLPA General Protocol.
Product Description SALSA Probemix P055-D1 PAH To be used with the MLPA General Protocol. Version D1. For complete product history see page 7. Catalogue numbers: P055-025R: SALSA MLPA probemix P055 PAH,
More informationProduct Description SALSA MLPA Probemix P138-C1 SLC2A1-STXBP1 To be used with the MLPA General Protocol.
Product Description SALSA Probemix P138-C1 SLC2A1-STXBP1 To be used with the MLPA General Protocol. Version C1. For complete product history see page 7. Catalogue numbers: P138-025R: SALSA MLPA probemix
More informationMRC-Holland MLPA. Description version 10; 06 April 2018
Description version ; 6 April 8 mix P36-B Y-Chromosome Microdeletions Lot B-5. As compared to version A (Lot A-), all probes f DPY9L, one probe f RBMYCP and one probe f KDM5D have been removed, and one
More informationMRC-Holland MLPA. Description version 15;
probemix P036-E1 HUMAN TELOMERE-3 Lot E1-0910, E1-1208, E1-0808. As compared to version D2 (lot D2-0408), the probes for 1p and 4q have been replaced. Approximately 3-8% of all cases of mental retardation
More informationSALSA MLPA KIT P036-E1 HUMAN TELOMERE-3 Lot 0808: As compared to the previous version (P036-D2), the probes for 1p and 4q have been replaced.
SALSA MLPA KIT P036-E1 HUMAN TELOMERE-3 Lot 0808: As compared to the previous version (P036-D2), the probes for 1p and 4q have been replaced. MENTAL RETARDATION is caused by aberrant copy numbers of subtelomeric
More informationAnatomic Molecular Pathology: An Emerging Field
Anatomic Molecular Pathology: An Emerging Field Antonia R. Sepulveda M.D., Ph.D. University of Pennsylvania asepu@mail.med.upenn.edu 2008 ASIP Annual Meeting Anatomic pathology (U.S.) is a medical specialty
More informationThe Next Generation of Hereditary Cancer Testing
The Next Generation of Hereditary Cancer Testing Why Genetic Testing? Cancers can appear to run in families. Often this is due to shared environmental or lifestyle patterns, such as tobacco use. However,
More informationLynch Syndrome Screening for Endometrial Cancer: Basic Concepts 1/16/2017
1 Hi, my name is Sarah Kerr. I m a pathologist at Mayo Clinic, where I participate in our high volume Lynch syndrome tumor testing practice. Today I hope to cover some of the basics needed to understand
More informationSupplemental Data: Detailed Characteristics of Patients with MKRN3. Patient 1 was born after an uneventful pregnancy. She presented in our
1 2 Supplemental Data: Detailed Characteristics of Patients with MKRN3 Mutations 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Patient 1 was born after an uneventful pregnancy. She presented
More informationProduct Description SALSA MLPA Probemix P045-C1 BRCA2/CHEK2 To be used with the MLPA General Protocol.
Product Description SALSA Probemix P045-C1 BRCA2/CHEK2 To be used with the MLPA General Protocol. Version C1. As compared to version B3, the probes for the BRCA2 upstream region and exons 8, 11, 12, 19
More informationAbstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
More informationSerrated Polyps and a Classification of Colorectal Cancer
Serrated Polyps and a Classification of Colorectal Cancer Ian Chandler June 2011 Structure Serrated polyps and cancer Molecular biology The Jass classification The familiar but oversimplified Vogelsteingram
More informationDevelopment of Carcinoma Pathways
The Construction of Genetic Pathway to Colorectal Cancer Moriah Wright, MD Clinical Fellow in Colorectal Surgery Creighton University School of Medicine Management of Colon and Diseases February 23, 2019
More informationStudying The Role Of DNA Mismatch Repair In Brain Cancer Malignancy
Kavya Puchhalapalli CALS Honors Project Report Spring 2017 Studying The Role Of DNA Mismatch Repair In Brain Cancer Malignancy Abstract Malignant brain tumors including medulloblastomas and primitive neuroectodermal
More informationTumorNext-Lynch. genetic testing for hereditary colorectal or uterine cancer
TumorNet-Lynch genetic testing for hereditary colorectal or uterine cancer What Are the Causes of Hereditary Colorectal Cancer? sporadic 70% familial 20% hereditary 10% Lynch syndrome, up to 4% Familial
More informationThe Human Major Histocompatibility Complex
The Human Major Histocompatibility Complex 1 Location and Organization of the HLA Complex on Chromosome 6 NEJM 343(10):702-9 2 Inheritance of the HLA Complex Haplotype Inheritance (Family Study) 3 Structure
More informationTable S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3.
Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3. MN1 (Accession No. NM_002430) MN1-1514F 5 -GGCTGTCATGCCCTATTGAT Exon 1 MN1-1882R 5 -CTGGTGGGGATGATGACTTC Exon
More informationB Base excision repair, in MUTYH-associated polyposis and colorectal cancer, BRAF testing, for hereditary colorectal cancer, 696
Index Note: Page numbers of article titles are in boldface type. A Adenomatous polyposis, familial. See Familial adenomatous polyposis. Anal anastomosis, ileal-pouch, proctocolectomy with, in FAP, 591
More informationLYNCH SYNDROME: IN YOUR FACE BUT LOST IN SPACE (MOUNTAIN)!
LYNCH SYNDROME: IN YOUR FACE BUT LOST IN SPACE (MOUNTAIN)! Kathryn Singh, MPH, MS, LCGC Associate Clinical Professor Assistant Director, Graduate Program in Genetic Counseling Division of Genetic and Genomic
More informationProduct Description SALSA MLPA probemix P002-D1 BRCA1 To be used with the MLPA General Protocol.
Product Description SALSA probemix P002-D1 BRCA1 To be used with the MLPA General Protocol. Version D1. As compared to version C2, 12 extra BRCA1 probes and 3 probes for exon 24 have been included, and
More informationCase Study. Overview. Deleterious MLH1 mutation detected on sequencing 10/16/2014
The Role of Next Generation Sequencing for Hereditary Cancer Syndromes: A Focus on Endometrial Cancer Laura J. Tafe, MD Assistant Professor of Pathology Assistant Director, Molecular Pathology Dartmouth-Hitchcock
More informationProduct Description SALSA MLPA Probemix P015-F2 MECP2 To be used with the MLPA General Protocol.
Product Description SALSA Probemix P015-F2 MECP2 To be used with the MLPA General Protocol. Version F2. Compared to version F1, two reference probes have been replaced and the 118 nt Y fragment has been
More informationIntroduction to Cancer Biology
Introduction to Cancer Biology Robin Hesketh Multiple choice questions (choose the one correct answer from the five choices) Which ONE of the following is a tumour suppressor? a. AKT b. APC c. BCL2 d.
More informationIntroduction to Genetics
Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationCANCER. Inherited Cancer Syndromes. Affects 25% of US population. Kills 19% of US population (2nd largest killer after heart disease)
CANCER Affects 25% of US population Kills 19% of US population (2nd largest killer after heart disease) NOT one disease but 200-300 different defects Etiologic Factors In Cancer: Relative contributions
More informationProduct Description SALSA MLPA Probemix P002-D1 BRCA1 To be used with the MLPA General Protocol.
Product Description SALSA Probemix P002-D1 BRCA1 To be used with the MLPA General Protocol. Version D1. For a complete product history see page 11. Catalogue numbers: P002-025R: SALSA MLPA probemix P002
More informationMSI positive MSI negative
Pritchard et al. 2014 Supplementary Figure 1 MSI positive MSI negative Hypermutated Median: 673 Average: 659.2 Non-Hypermutated Median: 37.5 Average: 43.6 Supplementary Figure 1: Somatic Mutation Burden
More informationColon Cancer and Hereditary Cancer Syndromes
Colon Cancer and Hereditary Cancer Syndromes Gisela Keller Institute of Pathology Technische Universität München gisela.keller@lrz.tum.de Colon Cancer and Hereditary Cancer Syndromes epidemiology models
More informationChapter 5. Gazzoli I, Loda M, Garber J, Syngal S and Kolodner RD. Cancer Research 2002 Jul 15; 62(14):
Chapter 5 A hereditary nonpolyposis colorectal carcinoma case associated with hypermethylation of the MLH1 gene in normal tissue and loss of heterozygosity of the unmethylated allele in the resulting microsatellite
More informationPolicy Specific Section: Medical Necessity and Investigational / Experimental. October 14, 1998 March 28, 2014
Medical Policy Genetic Testing for Colorectal Cancer Type: Medical Necessity and Investigational / Experimental Policy Specific Section: Laboratory/Pathology Original Policy Date: Effective Date: October
More informationOriginal Policy Date
MP 2.04.76 Genetic Counseling Medical Policy Section Medicine Issue 12:2013 Original Policy Date 12:2013 Last Review Status/Date Created Local Policy/ 12:2013 Return to Medical Policy Index Disclaimer
More informationKaryotype analysis reveals transloction of chromosome 22 to 9 in CML chronic myelogenous leukemia has fusion protein Bcr-Abl
Chapt. 18 Cancer Molecular Biology of Cancer Student Learning Outcomes: Describe cancer diseases in which cells no longer respond Describe how cancers come from genomic mutations (inherited or somatic)
More informationProfiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola
Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the
More informationImmunotherapy in Colorectal cancer
Immunotherapy in Colorectal cancer Ahmed Zakari, MD Associate Professor University of Central Florida, College of Medicine Medical Director, Gastro Intestinal Cancer Program Florida Hospital Cancer Institute
More informationCOLON CANCER & GENETICS VERMONT COLORECTAL CANCER SUMMIT NOVEMBER 15, 2014
COLON CANCER & GENETICS VERMONT COLORECTAL CANCER SUMMIT NOVEMBER 15, 2014 WENDY MCKINNON, MS, CGC CERTIFIED GENETIC COUNSELOR FAMILIAL CANCER PROGRAM UNIVERSIT Y OF VERMONT MEDICAL CENTER 1 CHARACTERISTICS
More informationMEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)
Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)
More informationLESSON 3.2 WORKBOOK. How do normal cells become cancer cells? Workbook Lesson 3.2
For a complete list of defined terms, see the Glossary. Transformation the process by which a cell acquires characteristics of a tumor cell. LESSON 3.2 WORKBOOK How do normal cells become cancer cells?
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK NW Thames Regional Genetics Laboratory Northwick Park Hospital Watford Road Harrow HA1 3UJ United Kingdom Contact: Caroline Sullivan Tel:
More informationLynch Syndrome. Angie Strang, PGY2
Lynch Syndrome Angie Strang, PGY2 Background Previously hereditary nonpolyposis colorectal cancer Autosomal dominant inherited cancer susceptibility syndrome Caused by defects in the mismatch repair system
More informationASSESSMENT OF MLH1 PROMOTER METHYLATION IN ENDOMETRIAL CANCER USING PYROSEQUENCING TECHNOLOGY OBJECTIVES
ASSESSMENT OF MLH1 PROMOTER METHYLATION IN ENDOMETRIAL CANCER USING PYROSEQUENCING TECHNOLOGY Authors: Duilio Della Libera, Alessandra D Urso, Federica Modesti, Georgeta Florea, Marta Gobbato Hospital:
More informationSection Chapter 14. Go to Section:
Section 12-3 Chapter 14 Go to Section: Content Objectives Write these Down! I will be able to identify: The origin of genetic differences among organisms. The possible kinds of different mutations. The
More informationCourse Title Form Hours subject
Course Title Form Hours subject Types, and structure of chromosomes L 1 Histology Karyotyping and staining of human chromosomes L 2 Histology Chromosomal anomalies L 2 Histology Sex chromosomes L 1 Histology
More informationCitation for published version (APA): Bleeker, W. A. (2001). Therapeutic considerations in Dukes C colon cancer s.n.
University of Groningen Therapeutic considerations in Dukes C colon cancer Bleeker, Willem Aldert IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite
More informationBiochemistry 201: DNA repair January 24, 26, 2000 Gilbert Chu
1) Why study DNA repair? Biochemistry 201: DNA repair January 24, 26, 2000 Gilbert Chu The genome is assaulted by a myriad of different agents that cause DNA damage. Sources of damage can be both exogenous
More informationThe Whys OAP Annual Meeting CCO Symposium September 20. Immunohistochemical Assessment Dr. Terence Colgan Mount Sinai Hospital, Toronto
Immunohistochemical Assessment of Mismatch Repair Proteins in Endometrial Cancer: The Whys and How Terence J. Colgan, MD Head of Gynaecological Pathology, Mount Sinai Hospital, University of Toronto, Toronto.
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationUniversal Screening for Lynch Syndrome
Universal Screening for Lynch Syndrome St. Vincent/Ameripath protocol proposal Lynch syndrome (HNPCC) 1/35 individuals with colorectal cancer has Lynch syndrome Over half individuals are >50 at time of
More informationA Review from the Genetic Counselor s Perspective
: A Review from the Genetic Counselor s Perspective Erin Sutcliffe, MS, CGC Certified Genetic Counselor Cancer Risk Evaluation Program INTRODUCTION Errors in base pair matching that occur during DNA replication,
More informationCancer genetics
Cancer genetics General information about tumorogenesis. Cancer induced by viruses. The role of somatic mutations in cancer production. Oncogenes and Tumor Suppressor Genes (TSG). Hereditary cancer. 1
More informationMolecular aspects of HNPCC and identification of mutation carriers Niessen, Renee
University of Groningen Molecular aspects of HNPCC and identification of mutation carriers Niessen, Renee IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish
More informationmirna Dr. S Hosseini-Asl
mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region
More informationMRC-Holland MLPA. Description version 24;
SALSA MLPA KIT P245-A2 Microdeletion Syndromes-1 Lot 0909, 0209, 1008. As compared to lot 1207, two extra control fragments at 100 and 105 nt have been added (X and Y-specific). The 108 nt Y probe has
More informationThis is DUE: Come prepared to share your findings with your group.
Biology 160 Reading Guide 10: Population Dynamics, HIV NAME: This is DUE: Come prepared to share your findings with your group. *As before, please turn in only the Critical Thinking questions on a separate
More informationMolecular Characterization of the NF2 Gene in Korean Patients with Neurofibromatosis Type 2: A Report of Four Novel Mutations
Korean J Lab Med 2010;30:190-4 DOI 10.3343/kjlm.2010.30.2.190 Original Article Diagnostic Genetics Molecular Characterization of the NF2 Gene in Korean Patients with Neurofibromatosis Type 2: A Report
More informationManagement of higher risk of colorectal cancer. Huw Thomas
Management of higher risk of colorectal cancer Huw Thomas Colorectal Cancer 41,000 new cases pa in UK 16,000 deaths pa 60% 5 year survival Adenoma-carcinoma sequence (Morson) Survival vs stage (Dukes)
More informationUsing the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep
Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold
More informationJayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3
Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3 1 Department of Biotechnology, JMIT, Radaur, Haryana, India 2 KITM, Kurukshetra, Haryana, India 3 NIDDK, National Institute of Health,
More information