Nature Genetics: doi: /ng Supplementary Figure 1. Phenotypic characterization of MES- and ADRN-type cells.

Size: px
Start display at page:

Download "Nature Genetics: doi: /ng Supplementary Figure 1. Phenotypic characterization of MES- and ADRN-type cells."

Transcription

1 Supplementary Figure 1 Phenotypic characterization of MES- and ADRN-type cells. (a) Bright-field images showing cellular morphology of MES-type (691-MES, 700-MES, 717-MES) and ADRN-type (691-ADRN, 700- ADRN, 717-ADRN) cell lines. Note attached growth of MES-type lines, while ADRN-type cell lines grow as semiattached spheres. Scale bar, 100 m. (b) PROM1 (encoding the CD133 antigen) mrna expression in the three MES and ADRN cell line pairs shown in a. (c) FACS analysis of CD133 expression on the isogenic cell lines 691-MES and 691-ADRN. (d) Box plots showing frequency of CD133 + cells in three MES and ADRN cell line pairs as measured by FACS. Each circle represents an individual FACS analysis. (e) Box plots showing motility of MES or ADRN cells as measured in Transwell migration assays. Each circle represents the average number of migrated cells from quadruplicate experiments. (f) Unsupervised cluster analysis (Spearman rank correlation) of the 1,000 genes with the highest standard deviation in the four isogenic pairs of MES and ADRN cell lines. Four MES cell lines cluster on the left, and four ADRN cell lines cluster on the right. The same results were obtained for the 500 or 1,500 genes with the highest standard deviation. (g) k-means clustering for the 1,000 genes with the highest standard deviation in the series of 33 neuroblastoma cell lines mapped in Figure 1c. The 500 or 1,500 genes with the highest standard deviation gave similar results.

2 Supplementary Figure 2 Spontaneous in vitro interconversion and in vivo tumorigenicity of MES and ADRN cells. (a) Frequency of CD133 + cells in clones grown from FACS-sorted CD133 AMC700B cells. (b) Survival of mice xenografted with FACSsorted CD133 + or CD133 cells of cell line AMC700B. Mice were sacrificed when tumors were up to 1 cm in diameter. (c) IHC analysis of the tumors grown from xenografted CD133 + or CD B cells. Tumors were stained for dopamine -hydroxylase (DBH) and vimentin (VIM). HE, hematoxylin and eosin staining.

3 Supplementary Figure 3 Examples of H3K27ac profiles of MES- and ADRN-specific super-enhancer-associated genes. (a) Five MES-specific genes with associated super-enhancers (SEs). (b) Box plots showing expression of the genes shown in a in the MES and ADRN counterparts of the four isogenic cell line pairs. (c) Five ADRN-specific genes associated with super-enhancers. (d) Box plots showing expression of the genes shown in c in the MES and ADRN counterparts of the four isogenic cell line pairs. Whiskers in b and d denote the interval within 1.5 times the interquartile range (IQR) of the median.

4 Supplementary Figure 4 mrna expression levels and super-enhancer status of all TFs in pairs of MES and ADRN cell lines of isogenic origin. (a d) XY plots showing the expression of all TFs. TFs with MES-specific expression identified in the MES-specific signature are indicated in orange. TFs with ADRN-specific expression identified in the ADRN-specific signature are indicated in blue. TFs of the signature associated with super-enhancers are indicated by a bold colored dot. (a) 691-MES and 691-ADRN cells. (b) 717-MES and 717-ADRN cells. (c) 700-MES and 700-ADRN cells. (d) SH-EP2 and SH-SY5Y cells.

5 Supplementary Figure 5 GATA3 binds to the epicenters of super-enhancers of ADRN-specific TFs. (a) The most prominent GATA3 binding peak 19 within super-enhancers of ADRN super-enhancer-associated TFs was used to center a ±1-Mb region. Data are from cell line SH-SY5Y. Gene bodies within the region are indicated in thin stripes, and signature TFs are indicated with thick stripes. The blue dot indicates GATA3, zoomed in c. (b) The same regions are shown, now showing the H3K27ac signal 19. (c) Example of the GATA3 and H3K27ac profiles in the region of the GATA3 gene and its associated super-enhancers. The zoomed region shows that GATA3 peaks binds to the epicenter of the H3K27ac domains.

6 Supplementary Figure 6 H3K27ac profiles of nine cell lines for PHOX2A and PHOX2B. (a) PHOX2A. (b) PHOX2B. Horizontal blue bars indicate super-enhancer (SE) regions.

7 Supplementary Figure 7 PRRX1 induces adrenergic-to-mesenchymal reprogramming. (a) Protein blot analysis of neuroblastoma cell lines 691-ADRN, SH-SY5Y and SK-N-BE(2C) with doxycycline-inducible expression of PRRX1 (t = 96 h). Immunoblots were analyzed for PRRX1 induction, mesenchymal marker SNAI2 and adrenergic markers PHOX2B and DBH. -actin is used as a loading control. Dox, doxycycline. (b) PRRX1 induces the migratory potential of 691-ADRN, SH-SY5Y and SK-N-BE(2C) cells. Each circle represents the number of migrated cells per high-power field. Four high-power fields per Transwell were analyzed. (c) Time-course mrna analysis of SK-N-BE(2C) cells with inducible PRRX1 expression. Downregulation kinetics between 8 and 196 h after PRRX1 induction were clustered by k-means analysis in four groups (clusters 1 4). Below each cluster are representative examples of four genes. mrna levels as measured by Affymetrix array of PRRX1-expressing cells are indicated in red, and control cells (without Dox) are shown in blue. The x axis depicts time in hours; the y axis depicts expression values for indicated genes. (d) Western blot analysis of cell line SK-N-AS treated by CRISPR Cas9 with control grna (84, 86) or PRRX1-gRNA (clones 1, 2a). Lane 2 is underloaded. (e) Western blot analysis of cell line GI-MEN treated by CRISPR Cas9 with control grna (84, 86) or PRRX1-gRNA (clones 1, 2a, 2b). (f) Western blot analysis of PRRX1 in 691-MES cells expressing IPTG-inducible control shrna or PRRX1 shrna (646, 647, 648). -actin is shown as a loading control. (g) Analysis of the ADRN and MES scores of the cell lines with silencing of PRRX1 shown in d f. Inactivation of PRRX1 does not result in significant shifts. See Supplementary Data for uncropped images of western blots used in a and d f.

8 Supplementary Figure 8 Relationship between the MES and ADRN signature scores and molecular and clinical variables and the prognostic value of PRRX1 in a series of 122 primary neuroblastoma tumors. (a) HE staining of tumor N712T, which is a highly mesenchymal neuroblastoma as indicated in b, shows ~90% tumor cell content. (b h) Mesenchymal and adrenergic signature scores in primary neuroblastoma tumors in relation to percentage tumor cells in sections used for mrna profiling (b), amplification of MYCN (c), LOH1p (d), loss of chromosome 11 (e), INSS stage (f), survival (g) and age (h). Box plots show the median signature score for each group. Whiskers denote the interval within 1.5 times the interquartile range (IQR) of the median. Tumors for which parameters were not determined are not shown in b h. Cell line pairs are numbered 1 4 with MES and ADRN counterparts shown in orange and blue, respectively. (i l) Kaplan Meier analysis of the relationship between PRRX1 expression and overall survival in a series of 122 neuroblastoma tumors 12 (i,j) and a neuroblastoma series analyzed by RNA seq 22 (k,l). Patients were classified in two groups with PRRX1 expression above or below the median value. The analysis was performed for all patients in the series (i,k) or for stage 3 and 4 patients only (j,l).

9 Supplementary Figure 9 PRRX1 is expressed in neuroblastoma cells. (a) Representative false-color image of double-ihc for MYCN (blue) and PRRX1 (red). MYCN + PRRX1 + cells are shown in yellow. Scale bar, 100 m. (b) Percentage of MYCN PRRX1 double-positive cells relative to all PRRX1 + cells in six stage 4 neuroblastoma tumors. (c) Dot plot visualization of MAML3 mrna expression levels (Affymetrix probeset _at) in three independent neuroblastoma series (red) as compared to eight other tumor types (blue) and nine normal tissues (green). (d) Hematoxylin and eosin staining (HE; left) and double-ihc for MAML3 (blue, nuclear) and the ADRN markers DBH (middle; red, cytoplasmic) and TH (right; red, cytoplasmic) on serial neuroblastoma sections from a representative stage 4 neuroblastoma. Str, Schwannian stroma; Nbl, neuroblasts with small round blue morphology. Scale bar, 100 m.

10 Supplementary Figure 10 Mesenchymal neuroblastoma cells are chemo-resistant in vitro and are enriched in post-therapy tumors in vivo. (a) Box plots showing sensitivity to cisplatin, doxorubicin or etoposide of pairs of MES- and ADRN-type cells of isogenic origin. MTT assays were used to determine viability after cisplatin, doxorubicin or etoposide treatment. MES- and ADRN-type cells in orange and blue, respectively. Whiskers denote the interval within 1.5 times the interquartile range (IQR) of the median. (b) IHC analysis of the mesenchymal marker PRRX1 in tumor biopsies taken before and after chemotherapy treatment (patients 1 and 2) or after treatment (patients 3 and 4). Scale bar, 50 m.

Nature Genetics: doi: /ng Supplementary Figure 1. SEER data for male and female cancer incidence from

Nature Genetics: doi: /ng Supplementary Figure 1. SEER data for male and female cancer incidence from Supplementary Figure 1 SEER data for male and female cancer incidence from 1975 2013. (a,b) Incidence rates of oral cavity and pharynx cancer (a) and leukemia (b) are plotted, grouped by males (blue),

More information

R2 Training Courses. Release The R2 support team

R2 Training Courses. Release The R2 support team R2 Training Courses Release 2.0.2 The R2 support team Nov 08, 2018 Students Course 1 Student Course: Investigating Intra-tumor Heterogeneity 3 1.1 Introduction.............................................

More information

SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer.

SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Supplementary Figure 1 SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Scatter plots comparing expression profiles of matched pretreatment

More information

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian

More information

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni. Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

SUPPLEMENTARY FIGURES AND TABLES

SUPPLEMENTARY FIGURES AND TABLES SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non

More information

TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge

TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the

More information

Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.

Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. Supplementary Figure 1 Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. (a) Breeding scheme. R26-LSL-SB11 homozygous mice were bred to Trp53 LSL-R270H/+

More information

Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.

Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by

More information

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.

More information

Supplementary Figure 1: Comparison of acgh-based and expression-based CNA analysis of tumors from breast cancer GEMMs.

Supplementary Figure 1: Comparison of acgh-based and expression-based CNA analysis of tumors from breast cancer GEMMs. Supplementary Figure 1: Comparison of acgh-based and expression-based CNA analysis of tumors from breast cancer GEMMs. (a) CNA analysis of expression microarray data obtained from 15 tumors in the SV40Tag

More information

Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well

Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well plate at cell densities ranging from 25-225 cells in

More information

gliomas. Fetal brain expected who each low-

gliomas. Fetal brain expected who each low- Supplementary Figure S1. Grade-specificity aberrant expression of HOXA genes in gliomas. (A) Representative RT-PCR analyses of HOXA gene expression in human astrocytomas. Exemplified glioma samples include

More information

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2

More information

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description: File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'

More information

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted

More information

Supplemental Table S1

Supplemental Table S1 Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected

More information

Supplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-

Supplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn- Supplementary Table S1. Tumor samples used for analysis Sample# Age Tumor size (cm) pn- Stage Stage BNG (grade) ERα PR HER2 (FISH) Triple negative T1 46 3 N1a III 2 Pos Neg N T2 58 1 N(i-) I 3 Pos Neg

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature15260 Supplementary Data 1: Gene expression in individual basal/stem, luminal, and luminal progenitor cells. Box plots show expression levels for each gene from the 49-gene differentiation

More information

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette

More information

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

More information

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung

Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing

More information

Supplemental Table 1 Molecular Profile of the SCLC Cell Line Panel

Supplemental Table 1 Molecular Profile of the SCLC Cell Line Panel Supplemental Table 1 Molecular Profile of the SCLC Cell Line Panel p53 RB Myc Cell Line Mutation A Mutation A Amplification B COR-L103 C p.y234c p.d584e L-Myc NCI-H526 p.s33_splice None N-Myc NCI-H1048

More information

Supplementary Figure 1. Mother centrioles can reduplicate while in the close association

Supplementary Figure 1. Mother centrioles can reduplicate while in the close association C1-GFP distance (nm) C1-GFP distance (nm) a arrested HeLa cell expressing C1-GFP and Plk1TD-RFP -3 s 1 2 3 4 5 6 7 8 9 11 12 13 14 16 17 18 19 2 21 22 23 24 26 27 28 29 3 b 9 8 7 6 5 4 3 2 arrested HeLa

More information

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b) KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.

Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets. Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated

More information

Nature Genetics: doi: /ng.3731

Nature Genetics: doi: /ng.3731 Supplementary Figure 1 Circadian profiles of Adarb1 transcript and ADARB1 protein in mouse tissues. (a) Overlap of rhythmic transcripts identified in the previous transcriptome analyses. The mouse liver

More information

Supplementary Table S1. List of PTPRK-RSPO3 gene fusions in TCGA's colon cancer cohort. Chr. # of Gene 2. Chr. # of Gene 1

Supplementary Table S1. List of PTPRK-RSPO3 gene fusions in TCGA's colon cancer cohort. Chr. # of Gene 2. Chr. # of Gene 1 Supplementary Tale S1. List of PTPRK-RSPO3 gene fusions in TCGA's colon cancer cohort TCGA Case ID Gene-1 Gene-2 Chr. # of Gene 1 Chr. # of Gene 2 Genomic coordiante of Gene 1 at fusion junction Genomic

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR

More information

Nature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity.

Nature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity. Supplementary Figure 1 HOX fusions enhance self-renewal capacity. Mouse bone marrow was transduced with a retrovirus carrying one of three HOX fusion genes or the empty mcherry reporter construct as described

More information

Supplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded

Supplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded Supplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded from TCGA and differentially expressed metabolic genes

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Bredel M, Scholtens DM, Yadav AK, et al. NFKBIA deletion in

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases.

Nature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases. Supplementary Figure 1 Somatic coding mutations identified by WES/WGS for 83 ATL cases. (a) The percentage of targeted bases covered by at least 2, 10, 20 and 30 sequencing reads (top) and average read

More information

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.

7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the

More information

Supplementary Materials and Methods

Supplementary Materials and Methods DD2 suppresses tumorigenicity of ovarian cancer cells by limiting cancer stem cell population Chunhua Han et al. Supplementary Materials and Methods Analysis of publicly available datasets: To analyze

More information

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences

More information

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10866 a b 1 2 3 4 5 6 7 Match No Match 1 2 3 4 5 6 7 Turcan et al. Supplementary Fig.1 Concepts mapping H3K27 targets in EF CBX8 targets in EF H3K27 targets in ES SUZ12 targets in ES

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice. Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.

More information

supplementary information

supplementary information DOI: 10.1038/ncb2133 Figure S1 Actomyosin organisation in human squamous cell carcinoma. (a) Three examples of actomyosin organisation around the edges of squamous cell carcinoma biopsies are shown. Myosin

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Supplementary Figure 1. The expression of ephrin-b2 H2BGFP persists in the post-hearingonset organ of Corti and is specifically restricted to supporting cells. Sox2 immunolabeling

More information

TMA-VARESE COHORT-1 TMA-BERN COHORT-2

TMA-VARESE COHORT-1 TMA-BERN COHORT-2 Supplementary Figure 1 TMA-VARESE COHORT-1 TOTAL SAMPLES #5 GLEASON SCORE Number Percentage 6 16 32% = 7 17 34% >7 17 34% TUMOR STAGE T2C 28 56% T3A- 21 42% T3C-T4 1 2% NODE STATUS N 42 84% N1 8 16% PSA

More information

Supplementary Table 2: ALK mutations in neuroblastoma cell lines and comparison

Supplementary Table 2: ALK mutations in neuroblastoma cell lines and comparison Supplementary data Supplementary Table 2: ALK mutations in neuroblastoma cell lines and comparison with published studies. (MNA = MYCN amplification, A = MYCN amplified, NA = not MYCN amplified, wt = wild-type).

More information

Material and Methods. Flow Cytometry Analyses:

Material and Methods. Flow Cytometry Analyses: Material and Methods Flow Cytometry Analyses: Immunostaining of breast cancer cells for HER2 was performed by incubating cells with anti- HER2/neu APC (Biosciences, Cat# 340554), anti-her2/neu PE (Biosciences,

More information

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. Lick response during the delayed Go versus No-Go task.

Nature Neuroscience: doi: /nn Supplementary Figure 1. Lick response during the delayed Go versus No-Go task. Supplementary Figure 1 Lick response during the delayed Go versus No-Go task. Trial-averaged lick rate was averaged across all mice used for pyramidal cell imaging (n = 9). Different colors denote different

More information

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.

More information

Lung Met 1 Lung Met 2 Lung Met Lung Met H3K4me1. Lung Met H3K27ac Primary H3K4me1

Lung Met 1 Lung Met 2 Lung Met Lung Met H3K4me1. Lung Met H3K27ac Primary H3K4me1 a Gained Met-VELs 1.5 1.5 -.5 Lung Met 1 Lung Met Lung Met 3 1. Lung Met H3K4me1 Lung Met H3K4me1 1 Lung Met H3K4me1 Lung Met H3K7ac 1.5 Lung Met H3K7ac Lung Met H3K7ac.8 Primary H3K4me1 Primary H3K7ac

More information

Nature Genetics: doi: /ng Supplementary Figure 1

Nature Genetics: doi: /ng Supplementary Figure 1 Supplementary Figure 1 MSI2 interactors are associated with the riboproteome and are functionally relevant. (a) Coomassie blue staining of FLAG-MSI2 immunoprecipitated complexes. (b) GO analysis of MSI2-interacting

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence. Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin

More information

Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs

Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs Supplementary Table Clinicopathological characteristics of 35 patients with CRCs Characteristics Type-A CRC Type-B CRC P value Sex Male / Female 9 / / 8.5 Age (years) Median (range) 6. (9 86) 6.5 (9 76).95

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2

More information

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)

More information

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

Nature Immunology: doi: /ni.3412

Nature Immunology: doi: /ni.3412 Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell

More information

Supplementary. properties of. network types. randomly sampled. subsets (75%

Supplementary. properties of. network types. randomly sampled. subsets (75% Supplementary Information Gene co-expression network analysis reveals common system-level prognostic genes across cancer types properties of Supplementary Figure 1 The robustness and overlap of prognostic

More information

Relationship between genomic features and distributions of RS1 and RS3 rearrangements in breast cancer genomes.

Relationship between genomic features and distributions of RS1 and RS3 rearrangements in breast cancer genomes. Supplementary Figure 1 Relationship between genomic features and distributions of RS1 and RS3 rearrangements in breast cancer genomes. (a,b) Values of coefficients associated with genomic features, separately

More information

Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547

Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547 Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living

More information

Figure S2. Distribution of acgh probes on all ten chromosomes of the RIL M0022

Figure S2. Distribution of acgh probes on all ten chromosomes of the RIL M0022 96 APPENDIX B. Supporting Information for chapter 4 "changes in genome content generated via segregation of non-allelic homologs" Figure S1. Potential de novo CNV probes and sizes of apparently de novo

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.

Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells. Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

More information

activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows

activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl

More information

Nature Structural & Molecular Biology: doi: /nsmb.2419

Nature Structural & Molecular Biology: doi: /nsmb.2419 Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb

More information

Pathologic Stage. Lymph node Stage

Pathologic Stage. Lymph node Stage ASC ASC a c Patient ID BMI Age Gleason score Non-obese PBMC 1 22.1 81 6 (3+3) PBMC 2 21.9 6 6 (3+3) PBMC 3 22 84 8 (4+4) PBMC 4 24.6 68 7 (3+4) PBMC 24. 6 (3+3) PBMC 6 24.7 73 7 (3+4) PBMC 7 23. 67 7 (3+4)

More information

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent

More information

Chapter 4 Cellular Oncogenes ~ 4.6 -

Chapter 4 Cellular Oncogenes ~ 4.6 - Chapter 4 Cellular Oncogenes - 4.2 ~ 4.6 - Many retroviruses carrying oncogenes have been found in chickens and mice However, attempts undertaken during the 1970s to isolate viruses from most types of

More information

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the

More information

Supplemental Information. Genomic Characterization of Murine. Monocytes Reveals C/EBPb Transcription. Factor Dependence of Ly6C Cells

Supplemental Information. Genomic Characterization of Murine. Monocytes Reveals C/EBPb Transcription. Factor Dependence of Ly6C Cells Immunity, Volume 46 Supplemental Information Genomic Characterization of Murine Monocytes Reveals C/EBPb Transcription Factor Dependence of Ly6C Cells Alexander Mildner, Jörg Schönheit, Amir Giladi, Eyal

More information

Supplementary Figure 1. Recording sites.

Supplementary Figure 1. Recording sites. Supplementary Figure 1 Recording sites. (a, b) Schematic of recording locations for mice used in the variable-reward task (a, n = 5) and the variable-expectation task (b, n = 5). RN, red nucleus. SNc,

More information

Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood

Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood tree illustrating CRF01_AE gp120 protein sequence relationships between 107 Envs sampled in the RV144 trial

More information

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in

hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Fumagalli D, Venet D, Ignatiadis M, et al. RNA Sequencing to predict response to neoadjuvant anti-her2 therapy: a secondary analysis of the NeoALTTO randomized clinical trial.

More information

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC

More information

Expanded View Figures

Expanded View Figures Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and

More information

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor

More information

Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors

Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

Layered-IHC (L-IHC): A novel and robust approach to multiplexed immunohistochemistry So many markers and so little tissue

Layered-IHC (L-IHC): A novel and robust approach to multiplexed immunohistochemistry So many markers and so little tissue Page 1 The need for multiplex detection of tissue biomarkers. There is a constant and growing demand for increased biomarker analysis in human tissue specimens. Analysis of tissue biomarkers is key to

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan

More information

Supplementary Figure 1 The ability to regenerate an ear hole is discontinuous with wound healing. Ear-hole closure at D85 for each sex within each

Supplementary Figure 1 The ability to regenerate an ear hole is discontinuous with wound healing. Ear-hole closure at D85 for each sex within each Supplementary Figure 1 The ability to regenerate an ear hole is discontinuous with wound healing. Ear-hole closure at D85 for each sex within each species observed. Data show a binary response to a 4 mm

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table

Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates

More information

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation

More information