SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

Transcription

1 SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang 1,2, Ting Shi 3, Changhong Zhu 1,2, Cheng Chen 1,2, Xin Liu 1,2, Jinke Cheng 1, Tomas Mustelin 4, Gen-Sheng Feng 5, Guoqiang Chen 3, Jianxiu Yu 1,2,3 * Supplementary Figures S1-S9 Supplementary Methods 1

2 Supplementary Figures S1-S9 Supplementary Figure S1. SUMOplot prediction of human PTEN protein. SUMO consensus sequence ΨKXE/D (where Ψ is a large hydrophobic amino acid, K is the target lysine, X is any amino acid, D or E is an acidic residue). SUMOylation sites of human PTEN protein were predicted by the program of Abgent SUMOplot ( K 254 and K 266 are the highest score (>0.9) in all possible PTEN SUMOylation sites. We demonstrated both are true SUMO acceptor sites. 2

3 a b Supplementary Figure S2. PTEN is covalently conjugated with one molecule of SUMO1 with a size of 75 kda. 293T cells (a) and PC3 (b) transfected Flag-PTEN with or without Flag-Ubc9/His-SUMO1 were lysed and treated with Ni2+-NTA resin for in vivo SUMOylation assays 11. 3

4 a b Supplementary Figure S3. (a) SUMO-site mutations do not alter PTEN ubiquitination. 293T cells transfected Flag-PTEN or mutants with HA-Ubiquitin were lysed for immunoprecipitation with anti-flag antibody (5µl for 1µg of lysates), and followed by immunoblotting with anti-ha and Flag antibodies (dilution 1:1000). Lysates as input were blotted with anti-flag and β-actin antibodies. The result showed that these two point mutations of K 266 R and K 254 R appear not to affect PTEN ubiquitination. (b) SUMO-site mutations do not affect PTEN acetylation. 293T cells were transfected with Flag-PTEN or mutants, and 48 hrs later treated with Trichostatin A (TSA, 2 µm) for 6 hrs. Lysates were used for immunoprecipitation with anti-flag antibody, and followed by immunoblotting with anti-acetyllysine (dilution 1:1000). The result showed that both K 266 R and K 254 R mutations do not affect PTEN ubiquitination. 4

5 a b 5

6 Supplementary Figure S4. (a) SUMO-site mutations do not affect the protein level of PTEN in stable PC3 luc cell lines. PC3 luc cells were infected with the prepared pseudovirus containing the empty lentivirus expression vector (Lenti-Vector), Lenti-PTEN-WT, Lenti-PTEN- K 254 R or Lenti-PTEN-K 266 R. Stably transduced cells selected by puromycin were lysed and immunoblotted with anti-pten and anti-gapdh antibodies. The result showed that the expression of PTEN is comparable in all clones. (b) All PTEN proteins including mutants K 254 R and K 266 R still localize predominantly to the cytoplasm of stable PC3 luc cell lines. Subcellular localization of PTEN and its mutants in stable PC3 cells was immunostained with PTEN antibody and DAPI, and monitored by confocal microscopy. All images were identically processed and the same scale bar (20 µm) was used in all images. 6

7 a 600 Number of colonies per cells *** ** *** b Number of colonies per 5000 cells *** * *** 0 Supplementary Figure S5. (a) PTEN SUMOylation is essential for its suppression of anchorage-independent growth of PC3 cells. The effect of PTEN and its mutants on anchorage-independent growth was assessed using a soft agar colony assay. PC3 cells stably expressing the Lenti-Vector, PTEN-WT, PTEN-K 254 R and PTEN-K 266 R were seeded into six- 7

8 well plates in triple at a concentration of cells/well in the presence of 1% serum. The photographs of the cells growing in plate and of the colonies developed in soft agar were taken 2 weeks after seeding. All images were identically processed and the same scale bar (500 µm) was used in all images. The number of colonies was scored under a microscope after 2 weeks in the presence of 1% serum. Each value represents the mean±sem of three independent experiments with triplicates each. An unpaired (equalvariance) t test was performed on PTEN-WT and PTEN mutant clones compared to the vector control (***, P <0.001), and on PTEN-WT compared to PTEN-K 254 R (**, P<0.01). (b) PTEN SUMOylation is essential for its suppression of anchorage-independent growth of 293T cells. The effect of PTEN and its mutants on anchorage-independent growth was assessed using a soft agar colony-forming assay. 293T cells stably expressing the Lenti-Vector, PTEN-WT, PTEN-K 254 R and PTEN-K 266 R were seeded into six-well plates in triple at a concentration of cells/well in the presence of 1% serum. The photographs of the cells growing in plate and of the colonies developed in soft agar were taken 2 weeks after seeding. All images were identically processed and used the same scale bar (100 µm) in all images. The number of colonies was scored under a microscope after 2 weeks in the presence of 1% serum. Each value represents the mean±sem of three independent experiments with triplicates each. An unpaired (equalvariance) t test was performed on PTEN-WT and PTEN mutant clones compared to the vector control (***, P <0.001), and on PTEN-WT compared to PTEN-K 254 R (*, P<0.05). 8

9 Supplementary Figure S6. SUMO-site mutation impairs PTEN function in downregulation of AKT phosphorylation. 293T cells stably expressing wild-type and mutants of PTEN were starved for 24h, and then lysed for immunoblotting analysis of AKT phosphorylation at Ser 473 and Thr 308, AKT, PTEN and GAPDH. The p-akt levels (at both T 308 and S 473 ) in the PTEN- K 266 R were as high comparable to those of the Lenti-Vector, whereas PTEN-WT significantly decreased the p-akt levels and PTEN-K 254 R also decreased the p-akt levels between the PTEN-K 266 R and PTEN-WT. 9

10 Fold change SENP1+/+ SENP1-/- p-akt(t308) p-akt(s473) Supplementary Figure S7. SUMOylated PTEN can more effectively reduce the levels of AKT phosphorylation in SENP1 -/- MEFs. SENP1 +/+ and SENP1 -/- MEFs were starved for 24h, and then lysed for immunoblotting with anti-akt, anti-p-akt(t 308 ) and anti-p-akt(s 473 ) antibodies. Quantitation was analyzed by ImageJ and the p-akt bands were normalized with the AKT bands. 10

11 SENP1-/- SENP1+/+ PTEN PIP3 PTEN PIP3 Supplementary Figure S8. Subcellular localizations of PTEN and PIP3 in SENP1 -/- and SENP1 +/+ MEFs were immunostained (with DAPI, anti-pten and anti-pip3), and monitored by confocal microscopy. The 4 images of bottom panel are cropped from those of top panel, respectively, and show enlargements of selected box portions of each field. The arrows represent PTEN (red) or PIP3 (green) membrane localization. All images were identically processed and the same scale bar (50 µm) was used in all images. The 4 images of bottom panel are also presented in Fig. 4d. 11

12 SENP1-/- SENP1+/+ LY (20µM) Vehicle Supplementary Figure S9. The PI3K inhibitor LY blocks PIP3 immunofluorescence. Subcellular localizations of PTEN and PIP3 in SENP1 -/- and SENP1 +/+ MEFs were immunostained (with DAPI, anti-pten and anti-pip3), and monitored by confocal microscopy. Compared to vehicle (top panel), PIP3 immunofluorescence which is completely blocked (bottom panel) when the cells are treated with the PI3K inhibitor LY (20 µm) for 30 min. The arrows represent PTEN (red) or PIP3 (green) membrane localization. All images were identically processed and the same scale bar (50 µm) was used in all images. 12

13 Supplementary Methods Reagents and antibodies. Antibodies to PTEN (26H9, 138G6), phospho-akt-s 473 (#4060), phospho-akt-t 308 (#9275), His-Tag (#2365), Akt1 (2H10), Flag M2 (#2368) and Acetylated lysine (#9441) were from Cell Signaling Technology. Monoclonal anti-flag M2 (#F1804), antiβ-actin (AC-15), inhibitors LY and trichostatin A (TSA), were from Sigma. Anti-IGF- IRβ (H-60) and HA probe (12CA5) was from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti-GAPDH (Rabbit IgG, #ab37168) was from Abcam. Anti-PI(3,4,5)P 3 (Z-P345b) was Echelon Biosciences Inc (Salt Lake City, UT, USA). Alex Flour 488, 568, 594 (goat anti Rabbit or mouse), and Vectashield DAPI were from Invitrogen. For Western blotting analysis, anti-β- Actin and anti-gapdh were used at a 1/5000 dilution, other primary antibodies were used at a 1/1000 dilution. For immunofluorescene staining, Anti-PI(3,4,5)P 3 antibody was used at a 1/50 filution. Plasmids. The human PTEN mutants, K 254 R, K 266 R and K 254 R/K 266 R were created by sitedirected mutagenesis employing a PCR-based strategy from the plasmid pcmv5-flag-pten. Wild-type and mutants of PTEN were amplified with a pair of primers (FW primer: 5 - ggggaattcgccaccatggactacaaggacgacga-3 and RE primer: 5 -gggggatcctcagacttttgtaatttgtg-3 ) and sub-cloned into the expression lenti-vector pcdh-cmv-ef1-copgfp-t2a-puro or pcdh- EF1-MCS-T2A-Puro (from System Biosciences). Lenti-control-shRNA and Lenti-PTEN-shRNA Plasmids were from Sigma. 13

14 To generate Flag-tagged SUMO1-PTEN, SUMO1 (amino acids 2-96) was amplified by PCR with the forward primer gggtctagagccaccatggattacaaggatgacgacgataagtctgaccaggaggcaaaacct (containing XbaI site, Kozak, Flag sequences and SUMO1 5 -terminal sequences corresponding to amino acids 2 8) and the reverse primer gggggatccccccgtttgttcctgataaac (containing BamHI site and SUMO1 sequences corresponding to amino acids 96 90), and cloned into the expression lenti-vector pcdh-cmv-ef1-copgfp-t2a-puro. Wild-type and mutated PTEN were then amplified by PCR with the forward primer gggggatccacagccatcatcaaagagatc (containing BamHI site and PTEN 5 -terminal sequences corresponding to amino acids 2 8) and the reverse primer ggggcggccgctcagacttttgtaatttgtgt (containing NotI site and PTEN 3 - terminal sequences corresponding to amino acids Stop 398), and cloned downstream of SUMO1 in frame. Generation of PTEN lentivirus and infection of cells. To generate a high titer of viral stocks, the expression Lenti-Vector pcdh, or pcdh-pten-wt, or pcdh-pten-k 254 R or pcdh- PTEN-K 266 R together with the packaging plasmids (pmd2g+pcmvdr8) was transfected into 293FT cells using Lipofectamine Approximately 48 h after the beginning of transfection, the supernatants were harvested, and cleared by filtering through 0.45 mm filter or by spinning in a 15-ml tube at 3000 RPM for 5 minutes, and used for infection or stored in aliquots at -80 C for later use. PC3 or PC3 luc cells in 6-well plates at 60% confluence were incubated for 18 h with 50% of viral supernatants plus 50% of complete medium in the presence of polybrene (Sigma) at a final concentration of 5µg/ml. The infected cells were then kept in complete medium for 48 h. And then transduced colonies were selected by 2-5 µg/ml of puromycin for 3-4 days. The 14

15 infected PC3 luc cells can be analyzed for transient expression of PTEN using Western blotting, or determined the percentage of an internal copgfp expression in infected cells by counting fluorescing cells by flow cytometry. Mouse tumour histological analysis. Protocols for paraffin-embedded sample preparation, hematoxylin and eosin Staining (H&E), and paraffin section immunohistochemistry were described in detail elsewhere 11. Antibodies PTEN (26H9) and phospho-akt (Ser473) 1:50 were incubated for overnight. Statistical analysis. All data are presented as means±standard deviation (SD) for Western blotting and Phosphatase Assays, or means±standard error of the mean (SEM) for Mouse xenograft model and Soft agar colony assay. Statistical calculations were performed with Microsoft Excel analysis tools. Differences between individual groups are analyzed using the t- test (two-tailed and unpaired). A P value of < 0.05 (*), < 0.01 (**), or < (***) is considered significant. 15