Yu Ping Feng San reverses cisplatin-induced multi-drug resistance in lung cancer cells via regulating drug transporters and p62/traf6 signaling
|
|
- August Ward
- 5 years ago
- Views:
Transcription
1 Yu Ping Feng San reverses cisplatin-induced multi-drug resistance in lung cancer cells via regulating drug transporters and p/traf signaling Jian-shu Lou,,LuYan, Cathy W. C. Bi,, Gallant K.L. Chan,Qi-YunWu, Yun-Le Liu,YunHuang,PingYao, Crystal Y.Q. Du,TinaT.X.Dong,Karl W.K. Tsim Division of Life Science, Center for Chinese Medicine, The Hong Kong University of Science and Technology, Clear Water Bay, Hong Kong, China Shenzhen Research Institute, The Hong Kong University of Science and Technology, Shenzhen, 87, China Department of Biology, Hanshan Normal University, Chaozhou, Guangdong, China Correspondence Prof. Karl W.K. Tsim Division of Life Science, and Center for Chinese Medicine, The Hong Kong University of Science and Technology, Clear Water Bay Road, Hong Kong, China Phone: Fax: botsim@ust.hk
2 A Intensity ( ) 8 7 Standards, 8,9 IS YPFS Intensity ( ) B IS Standards,7 YPFS, 8,9 IS IS,7 8 Time (min) 8 Time (min) Supplementary Figure. Typical RRLC QQQ MS/MS chromatograms of chemical markers in YPFS. (A): The identification of prim O glucosylcimifugin (), O methylvisammioside (), psoralen (), isopsoralen (), atractylenolide III (), atractylenolide II (9), atractylenolide I (8), crytotanshinone (IS, internal standard ) was made by a MS detector in the positive mode. (B): The identification of calycosin 7 O β D glucoside (), scopoletin (), ononin (), calycosin (), astragaloside III (), astragaloside IV (7), astragaloside II (), formononetin (), and aesculetin (IS, internal standard ) were made by a MS detector in the negative mode. Representative chromatograms are shown, n =. Fig.
3 Supplementary Figure. Chemical comparison of different YPFS formulae. The selected analytes were determined in the water extracts of different YPFS formulae. The amounts of analystes in YPFS-7, prescribed by Wei Yilin, are expressed as % of YPFS-7 (i.e. short form as YPFS as being analyzed here), prescribed by Zhu Danxi, where n =. Fig.
4 A Survival rate (%) 8 B mrna expression (% of comtrol) 8 MRP C mrna expression (% of comtrol) YPFS (mg/ml) 8.. BCRP YPFS (mg/ml) D mrna expression (% of comtrol) YPFS (mg/ml) P-gp YPFS (mg/ml) Supplementary Figure. The cell survival and mrna expression of transporters under YPFS. (A): A9/DDP cells, seeded in 9 well plates ( X cells/well), were allowed to adhere overnight, and subsequently which were treated with increasing concentration of DDP combined with YPFS ( mg/ml) for 8 hours. Values are in percentage of cell growth inhibition. (B): The mrna expression of MRP. (C): The mrna expression of BCRP. (D): The mrna expression of P gp. Cultured A9 cells were treated with the herbal extracts for hours. The expression levels of MRP,BCRP, and P gp were revealed by real time PCR. GAPDH was used as an internal control for normalization in RT PCR. Each point represents the Mean ± SEM, n =.p <. versus control. Fig.
5 Count A C HAX ser9 Phosphorylation ( Basal ) A9 A9/DDP 8 A9 A9/DDP DDP (μm) B D Mean fluorescence density Apurinic/Apyrimidinic sites Basal ) ( 8 DDP (μm) 8 A9 A9/DDP A9 A9/DDP DDP (μm) Supplementary Figure. DDP induces ROS formation and DNA damage on A9 and A9/DDP cell lines. (A): Cultured A9/DDP and A9 cells were treated with or without YPFS ( mg/ml) for hours, followed by hours of DDP treatment at various concentrations. The amount of ROS was detected by a flow cytometry. (B): Mean fluorescence density of ROS level was calibrated from (A). (C): Quantification of DNA damage by measuring HAXSer9 phosphorylation in the A9/DDP and A9 cells. Cultured A9/DDP cells were treated with or without YPFS ( mg/ml) for hours, followed by 8 hours of DDP treatment at various concentrations. Values are relative amount in fold of change (X Basal) to control (no drug treatment). (D): DNA damage determined by quantification of AP sites. The treatment was done as in (C). Values are relative amount in fold of change (X Basal) to control (no drug treatment).results are expressed as the Mean ± SEM from three separate experiments, n =.p <., or p <.. Fig.
6 Inhibition (%) 7 DDP (μm).. NAC ( μm) Supplementary Figure. The DDP-induced toxicity on A9/DDP cell is rescued by NAC. A9/DDP cells, seeded in 9-well plates ( X cells/well), were allowed to adhere overnight and subsequently were treated with increasing concentration of DDP in the absence or presence of min pre-treatment of mm N-acetyl-L-cysteine (NAC) for 8 hours. Values are in percentage of cell growth inhibition. Each point represents the Mean ± SEM, n =.p <., p <. versus DDP-treated alone. Fig.
7 YPFS DDP (μm) cl-parp 89 kda p kda Supplementary Figure. The full-length blots of cl-parp and p expression. Cultured A9/DDP cells were treated with DDP at different doses for 8 hours in the presence or absence of YPFS ( mg/ml; hours of pre treatment). Western blot analyses of cleaved (ci) PARP at ~89 kda and p at ~ kda. Fig.
Electronic Supplementary Information. Chemical inhibitors and stable knock-down of efflux transport leads to reduced
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Chemical inhibitors and stable knock-down of efflux
More informationSupporting Information
Copyright WILEY-VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 212. Supporting Information for Adv. Funct. Mater., DOI:.2/adfm.2122233 MnO Nanocrystals: A Platform for Integration of MRI and Genuine
More informationSupplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
More informationAstragaloside IV ameliorates 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced
Astragaloside IV ameliorates 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced colitis implicating regulation of energy metabolism Xu-Guang Jiang 1,2,, Kai Sun 1,3,4,5,, Yu-Ying Liu 1,4,5, Li Yan 1,4,5,
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationSupporting Information
Supporting Information Identification of Novel ROS Inducers: Quinone Derivatives Tethered to Long Hydrocarbon Chains Yeonsun Hong,, Sandip Sengupta,, Wooyoung Hur, *, Taebo Sim,, * KU-KIST Graduate School
More informationMechanical Stress-Dependent Autophagy Components Release via Extracellular
Supporting Information for Mechanical Stress-Dependent Autophagy Components Release via Extracellular Nanovesicles in Tumor Cells Kaizhe Wang,, Yuhui Wei,, Wenjing Liu,, Lin Liu,, Zhen Guo,, Chunhai Fan,,
More informationAn excessive increase in glutamate contributes to glucose-toxicity in. β-cells via activation of pancreatic NMDA receptors in rodent diabetes
An excessive increase in glutamate contributes to glucose-toxicity in β-cells via activation of pancreatic NMDA receptors in rodent diabetes Xiao-Ting Huang 1, Chen Li 1,3, Xiang-Ping Peng 1, Jia Guo 1,5,
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationPublication information Title ydrolysis of Glycosidic Flavonoids during the Preparation of Danggui Buxue Tang: An utcome of Moderate Boiling of Chinese erbal Mixture Author(s) Source Version DI Publisher
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationRelative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC
Supplementary Figure 1. SOD1 activity is significantly increased relative to SOD1 levels. SOD1 and SOD2 activities in the infected mork13 cells are shown normalised to their corresponding levels and relative
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More informationSupplementary Table 1. Characterization of HNSCC PDX models established at MSKCC
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete
More informationSupplementary material. Supplementary Figure legends
Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)
More informationSupplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
More informationDisrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development
Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development 1 Frankie Hang Fung Lee, 1 Ping Su, 1 Yu Feng Xie, 1 Kyle Ethan Wang, 2 Qi Wan and 1,3 Fang Liu 1 Campbell Research Institute, Centre
More informationSupplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells
Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Immunofluorescence staining of H3K9me3 and 53BP1 in PH and HGADFN003 (HG003) cells at 24 h after γ-irradiation. Scale bar,
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationPharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma
Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationSupplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.
Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William
More informationMesenchymal Stem Cells Reshape and Provoke Proliferation of Articular. State Key Laboratory of Bioreactor Engineering, East China University of
Mesenchymal Stem Cells Reshape and Provoke Proliferation of Articular Chondrocytes by Paracrine Secretion Lei Xu, Yuxi Wu, Zhimiao Xiong, Yan Zhou, Zhaoyang Ye *, Wen-Song Tan * State Key Laboratory of
More informationBerberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway
Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed
More informationA. Generation and characterization of Ras-expressing autophagycompetent
Supplemental Material Supplemental Figure Legends Fig. S1 A. Generation and characterization of Ras-expressing autophagycompetent and -deficient cell lines. HA-tagged H-ras V12 was stably expressed in
More informationSupplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
More informationLi et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108
Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108 https://doi.org/10.1186/s13046-018-0774-7 CORRECTION Correction to: Novel smac mimetic APG- 1387 elicits ovarian cancer cell killing
More informationHighly specific recognition of breast tumors by an RNA-cleaving fluorogenic DNAzyme probe
Supporting Information Highly specific recognition of breast tumors by an RNA-cleaving fluorogenic DNAzyme probe Shengnan He, Long Qu, Zhifa Shen, Ying Tan, Meiyun Zeng, Feng Liu *, and Yuyang Jiang ǁ
More informationElectronic Supplementary Information (ESI) A unique dansyl-based chromogenic chemosensor for rapid and ultrasensitive hydrazine detection
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information (ESI) A unique dansyl-based chromogenic
More informationEphrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry
SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41564-017-0080-8 In the format provided by the authors and unedited. Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus
More information- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)
Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of
More informationSulfate Radical-Mediated Degradation of Sulfadiazine by CuFeO 2 Rhombohedral Crystal-Catalyzed Peroxymonosulfate: Synergistic Effects and Mechanisms
Supporting Information for Sulfate Radical-Mediated Degradation of Sulfadiazine by CuFeO 2 Rhombohedral Crystal-Catalyzed Peroxymonosulfate: Synergistic Effects and Mechanisms Submitted by Yong Feng, Deli
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationA synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya
More informationSUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
More informationSupplementary Information. Effects of Perfluorooctanoic Acid on Metabolic Profiles in Brain and Liver of Mouse by a
Supplementary Information Effects of Perfluorooctanoic Acid on Metabolic Profiles in Brain and Liver of Mouse by a High-throughput Targeted Metabolomics Approach Nanyang Yu, Si Wei, *, Meiying Li, Jingping
More informationcondition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%
FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence
More informationImpact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan
Curcumin Protects Neonatal Rat Cardiomyocytes against High Glucose-Induced Apoptosis via PI3K/Akt Signalling Pathway Wei Yu,1,2 Wenliang Zha,1 Zhiqiang Ke,1 Qing Min,2 Cairong Li,1 Huirong Sun,3 and Chao
More informationW/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +
F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses
More informationSupplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
More informationLPS LPS P6 - + Supplementary Fig. 1.
P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence
More informationNLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin
NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following
More informationQuantitative Evaluation of the Effect of P-Glycoprotein on Oral Drug Absorption
Quantitative Evaluation of the Effect of P-Glycoprotein on Oral Drug Absorption -Assessment of Drug Permeability to Rat Small Intestine- College of Pharmacy, Setsunan University, Osaka, Japan Yoshiyuki
More informationm 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
More informationOriginal article: DEXMEDETOMIDINE INHIBITS INFLAMMATION IN MICROGLIA CELLS UNDER STIMULATION OF LPS AND ATP BY C-FOS/NLRP3/CASPASE-1 CASCADES
Supplementary material to Original article: DEXMEDETOMIDINE INHIBITS INFLAMMATION IN MICROGLIA CELLS UNDER STIMULATION OF LPS AND ATP BY C-FOS/NLRP3/CASPASE-1 CASCADES Hu Li 1, Xueping Zhang 2, Mingfu
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More information1 Analytical Methods 2 3 Electronic Supplementary Information Ultra-trace determination of sodium fluoroacetate (1080) as
Electronic Supplementary Material (ESI) for Analytical Methods. This journal is The Royal Society of Chemistry 018 1 Analytical Methods 3 Electronic Supplementary Information 4 5 6 Ultra-trace determination
More informationTargeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from
Supplementary Methods: Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from mouse tumor samples and analyzed as
More informationAmniotic fluid stem cells provide considerable advantages in epidermal. regeneration: B7H4 creates a moderate inflammation
Amniotic fluid stem cells provide considerable advantages in epidermal regeneration: B7H4 creates a moderate inflammation microenvironment to promote wound repair Qing Sun 1, +, Fang Li 1, +, Hong Li 2,
More informationSupplementary Figure S1. TRAIL-induced necroptosis at acidic phe is dependent on
Online supplementary information Supplementary Figure S1. TRAIL-induced necroptos at acidic phe is dependent on RIPK1 and RIPK3. (a) HT29 cells were tranently transfected with RIPK1, RIPK3, RIPK1/ RIPK3
More informationGallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity
Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity Yuhee Ryu 1,+, Li Jin 1,2+, Hae Jin Kee 1,, Zhe Hao Piao 3, Jae
More informationDoctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,
Cyclooxygenase 2 facilitates dengue virus replication and serves as a potential target for developing antiviral agents Chun-Kuang Lin 1,2, Chin-Kai Tseng 3,4, Yu-Hsuan Wu 3,4, Chih-Chuang Liaw 1,5, Chun-
More informationSupplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
More informationSupporting Information
Supporting Information A Systemic Study on the Biogenic Pathways of Yezo otogirins: Total Synthesis and Antitumor Activities of (±)-Yezo otogirin C and its Structural Analogues Wei Yang, Jingming Cao,
More informationEffect of BD Matrigel Matrix Overlay and BD Matrigel Matrix Thin Coat on CYP450 Activities in Cryo Human Hepatocytes. Rongjun Zuo.
Effect of BD Matrigel Matrix Overlay and BD Matrigel Matrix Thin Coat on CYP450 Activities in Cryo Human Hepatocytes Rongjun Zuo November 10, 2010 Topics Overview of Hepatocyte Products P450 Induction
More information(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),
Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells
More informationBile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response. Supplementary Results
Bile acids initiate cholestatic liver injury by triggering a hepatic specific inflammatory response Shi-Ying Cai 1, Xinshou Ouyang 1, Yonglin Chen 1, Carol J. Soroka 1, Juxian Wang 2, Albert Mennone 1,
More informationSupporting Information
Supporting Information A new series of cytotoxic pyrazoline derivatives as potential anticancer agents induces cell cycle arrest and apoptosis Hong Wang 1,, Jinhong Zheng 1,, Weijie Xu 1, Cheng Chen 1,
More informationSupporting Information For
Supporting Information For MicroRNA-Catalyzed Cancer Therapeutics Based on DNA-Programmed Nanoparticle Complex Xucheng Luo, 1 Zhi Li, 1 Ganglin Wang, 1 Xuewen He, 2,3 Xiaoqin Shen, 1 Quanhong Sun, 1 Li
More informationDanggui Buxue Tang. (Chinese Angelica Decoction): A Sample Trial in TCM Standardization. Abstract
Danggui Buxue Tang (Chinese Angelica Decoction): A Sample Trial in TCM Standardization by Karl W K Tsim Abstract The major stumbling block on the internationalization of Traditional Chinese Medicine (TCM)
More informationSLX4 + MUS81 SLX4 + GEN1 SLX4 CONTROL SLX4
GEN MUS8 GEN MUS8 GEN MUS8 GEN MUS8 GEN C LM MUS8 XPF (loading control) D H2AX Frequency of -positive bridges (% of anaphase cells) 6 4 2 p =.8 x -4 GM855 p =.27 PSNF5 E H2AX Figure S. Analysis of anaphase
More informationFigure S1A. Blood glucose levels in mice after glucose injection
## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose
More informationSupplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.
Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times. Western blots shown are representative results from 3 independent
More informationSUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
More informationPlasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
More informationProtection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
More informationFigure S1: Effects on haptotaxis are independent of effects on cell velocity A)
Supplemental Figures Figure S1: Effects on haptotaxis are independent of effects on cell velocity A) Velocity of MV D7 fibroblasts expressing different GFP-tagged Ena/VASP family proteins in the haptotaxis
More informationThe subcortical maternal complex controls symmetric division of mouse zygotes by
The subcortical maternal complex controls symmetric division of mouse zygotes by regulating F-actin dynamics Xing-Jiang Yu 1,2, Zhaohong Yi 1, Zheng Gao 1,2, Dan-dan Qin 1,2, Yanhua Zhai 1, Xue Chen 1,
More informationmarker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Characteristics of Subjects.
Supplementary Table 1. Characteristics of Subjects. a includes one patient who had an aqueous sample taken from the same eye twice b includes one patients who had an aqueous sample taken from the same
More informationmicrorna-200b and microrna-200c promote colorectal cancer cell proliferation via
Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.
More informationAlpha-Tubulin Housekeeping 10,000 tests
Headquarters & Europe Office Cisbio Bioassays Phone: +33 (0)4 66 79 67 05 Fax: +33 (0)4 66 79 19 20 bioassays@cisbio.com cisbio_dd_pi_64atubpeh USA Office Cisbio US, Inc. Phone: +1 888 963 4567 Fax: +1
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationThe effect of elemene reversing the multidurg resistance of A549/DDP lung cancer cells
213 12 33 12 TUMOR Vol. 33, December 213 www.tumorsci.org 161 Basic Research DOI: 1.3781/j.issn.1-7431.213.12. 5 Copyright 213 by TUMOR A549/DDP 1, 2 2 1 3 4 1 1 1. 3619 2. 355 3. 3611 4. 361 elemene cisplatin
More informationc Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
More informationSupplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
More informationSupplementary Figure S1
Supplementary Figure S1 12 1 8 6 4 2 1-3 1-2 1-1 1 1 1 1 2 1 3 PF-364422 (µm) U87 (EC 5 = 52.2 ± 8.8 µm) 12 1 8 6 4 2 1-4 1-3 1-2 1-1 1 1 1 1 2 CMPD1 (µm) Primary GM (EC 5 = 1.55 ±.3 µm) U138 (EC 5 = 1.7
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Artepillin C, is it a good marker for quality control of Brazilian Green Propolis? Cui-ping Zhang 1, Xiao-ge Shen 1, Jia-wei Chen 1, Xia-sen Jiang 1, Kai Wang 2, Fu-liang Hu 1 *
More informationEGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
More informationIntracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationDanggui Buxue Tang, an ancient Chinese herbal decoction, protects β-amyloidinduced cell death in cultured cortical neurons
Gong et al. BMC Complementary and Alternative Medicine (2019) 19:9 https://doi.org/10.1186/s12906-018-2411-6 RESEARCH ARTICLE Danggui Buxue Tang, an ancient Chinese herbal decoction, protects β-amyloidinduced
More informationROS Activity Assay Kit
ROS Activity Assay Kit Catalog Number KA3841 200 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials
More informationMarine Streptomyces sp. derived antimycin analogues. suppress HeLa cells via depletion HPV E6/E7 mediated by
Marine Streptomyces sp. derived antimycin analogues suppress HeLa cells via depletion HPV E6/E7 mediated by ROS-dependent ubiquitin proteasome system Weiyi Zhang 1, +, Qian Che 1, 2, +, Hongsheng Tan 1,
More informationSupplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid
More informationSupplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
More informationDetermination of Tetracyclines in Chicken by Solid-Phase Extraction and High-Performance Liquid Chromatography
Determination of Tetracyclines in Chicken by Solid-Phase Extraction and High-Performance Liquid Chromatography Application ote Food Safety Authors Chen-Hao Zhai and Yun Zou Agilent Technologies Co. Ltd.
More informationTrehalose, sucrose and raffinose are novel activators of autophagy in human. keratinocytes through an mtor-independent pathway
Title page Trehalose, sucrose and raffinose are novel activators of autophagy in human keratinocytes through an mtor-independent pathway Xu Chen 1*, Min Li 1*, Li Li 1, Song Xu 1, Dan Huang 1, Mei Ju 1,
More informationSupplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationSUPPORTING INFORMATION. For. ACS Applied Materials & Interfaces
SUPPRTIG IFRMATI For ACS Applied Materials & Interfaces S-1 Specific Fluorescence Probes for Lipid Droplets Based on Simple AIEgens Zhiming Wang,,,, # Chen Gui,,, Engui Zhao,, Jing Wang, # Xiaodong Li,
More informationProlonged mitotic arrest induces a caspase-dependent DNA damage
SUPPLEMENTARY INFORMATION Prolonged mitotic arrest induces a caspase-dependent DNA damage response at telomeres that determines cell survival Karolina O. Hain, Didier J. Colin, Shubhra Rastogi, Lindsey
More informationankylosing spondylitis Department of Clinical Immunology, Xijing Hospital, The Fourth Military
Functional defects in CD4 + CD25 high FoxP3 + regulatory cells in ankylosing spondylitis Huifang Guo 1, 2, 3, Ming Zheng 1, 2, 3, Kui Zhang 1, 3, Fengfan Yang 1, 3, Xin Zhang 1, 3, Qing Han 1, 3, Zhi-Nan
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More information<10. IL-1β IL-6 TNF + _ TGF-β + IL-23
3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More information1. Introduction. Clear Water Bay Road, Kowloon, Hong Kong 2 Department of Biology, Hanshan Normal University, Chaozhou, Guangdong , China
Evidence-Based Complementary and Alternative Medicine Volume 23, Article ID 483286, pages http://dx.doi.org/.55/23/483286 Research Article Chemical and Biological Assessment of Angelica Roots from Different
More informationSupplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationZhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
More information