Nucleotide diversity of the TNF gene region in an African village

Size: px
Start display at page:

Download "Nucleotide diversity of the TNF gene region in an African village"

Transcription

1 (2001) 2, Nature Publishing Group All rights reserved /01 $ Nucleotide diversity of the TNF gene region in an African village A Richardson 1, F Sisay-Joof 2, H Ackerman 1, S Usen 2, P Katundu 3, T Taylor 3, M Molyneux 3, M Pinder 2 and D Kwiatkowski 1 1 Wellcome Trust Centre for Human Genetics, Oxford University, UK; 2 MRC Laboratories, Fajara, The Gambia; 3 Wellcome Trust Research Laboratories and Malawi Project, College of Medicine, University of Malawi, Blantyre, Malawi The wide variety of disease associations reported at the TNF locus raises the question of how much variation exists within a single population. To address this question, we sequenced the entire TNF gene in 72 chromosomes from healthy residents of a village in The Gambia, West Africa. We found 12 polymorphisms in 4393 nucleotides, of which five have not been previously described, giving an estimated nucleotide diversity ( ) of A significantly higher frequency of polymorphisms was found in the promoter region than in the coding region (8/1256 vs 0/882 nucleotides, P = 0.02). All polymorphisms with the exception of one rare allele were found to be present in Malawi, which is both geographically and genetically distant from The Gambia. Genotyping of 424 Gambian and 121 Malawian adults showed a significant frequency difference between the two populations for eight of the 12 polymorphisms, but the average fixation index across the variable sites was relatively low (F ST = 0.007). We conclude that, at the TNF locus, the nucleotide diversity found within a single African village is similar to the global value for human autosomal genes sampled across different continents. (2001) 2, Keywords: The Gambia; TNF gene; Malawi Introduction TNF, the gene encoding tumour necrosis factor (TNF), resides in the central part (class III region) of the major histocompatibility complex (MHC) surrounded by a large number of other immunological genes. 1 Many disease associations have been reported with HLA alleles that are in linkage disequilibrium with TNF and in recent years there have been growing reports of disease linkage and association with microsatellite polymorphisms and single nucleotide polymorphisms close to the TNF gene itself A precise description of the nucleotide diversity of this region is therefore fundamental to investigations of genetic susceptibility to infectious and inflammatory disease. As well as serving as a genetic marker for the surrounding gene region, TNF polymorphisms may be of intrinsic functional relevance. TNF is a key mediator of the inflammatory response and is critical for host defence against a wide variety of pathogenic microbes. The dual role of TNF, acting as an agent of both innate immunity and inflammatory pathology, poses a considerable challenge for gene regulation. When exposed to a serious infection, the survival of the host depends on an adequate but not excessive level of TNF production. This optimal response is likely to vary for different infectious diseases, resulting in conflicting evolutionary pressures that might be expected to generate phenotypic diversity Correspondence: Prof D Kwiatkowski, Wellcome Trust Centre for Human Genetics, Roosevelt Drive, Oxford OX3 7BN,UK dominic.kwiatkowski paediatrics.ox.ac.uk This work was funded by the Medical Research Council. Received 3 May 2001; revised and accepted 11 July 2001 in TNF regulation. There is strong evidence that individuals vary in their level of TNF responsiveness to standard stimuli such as bacterial lipopolysaccharide, and that this has a significant heritable component. 12 Many papers have been published on the relationship between TNF polymorphisms and levels of TNF production, based on various human investigations and experimental models of gene regulation, but there is currently little consensus concerning whether any specific polymorphism is truly functional and, if so, how it operates (reviewed in Knight and Kwiatkowski 8 ). These observations raise the question of exactly how much nucleotide diversity exists at the TNF locus within a single population. Considering the large body of literature on disease associations with human TNF polymorphisms, there is a surprising lack of data to address this topic. Although eight polymorphisms are known to exist in the 5 flanking region, we are not aware of any systematic analysis of the level of nucleotide diversity throughout the coding, intronic and flanking regions. African populations are typically more diverse than Caucasian or Asian populations, 13 and the Gambian TNF locusisofparticularinterest because of the various TNF and MHC associations that have been observed with susceptibility to malaria and chlamydial infection in this population. 2,5 7,14 We therefore sequenced the entire TNF gene in 36 healthy residents of a single West African village. The total sequence under investigation was 4393 nt, extending from 1389 nt 5 of the transcription start site to nt 3 of the polyadenylation site.

2 Nucleotide diversity of the TNF gene region 344 Figure 1 Schematic of the TNF locus, taken from Genbank accession no. M Black bars represent translated sequence; grey bars represent the 5 and 3 untranslated regions of the primary transcript. Results Figure 1 depicts the polymorphisms identified by sequencing 72 Gambian chromosomes, and Table 1 describes the primer pairs used to genotype them. All locations refer to the transcription start site of the TNF gene as identified on Genbank accession no. M16441: 15 thus we refer to nucleotide 4095 on that sequence as +1, and nucleotide 4094 as 1. All polymorphisms found by sequencing were heterozygous and were confirmed by sequencing in the reverse direction. The polymorphisms at 1031, 863, 857, 376, 308, 244 and 238 nt have been previously described. In this sample we did not detect the polymorphisms at , +70 and +488 nt reported by other investigators in different populations. The polymorphisms at 1073, +467, +851, +943 and nt are novel. The 12 polymorphisms detected by sequencing represent an overall frequency of 1 per 338 nucleotides. Eight were located in the promoter region, defined here as the 1256 nt sequence extending from the TNF transcriptional start site to the polyadenylation site of the LTa gene (1 per 157 nucleotides). Four polymorphisms were found in the three introns which comprise 1094 bases (1 per 273 nucleotides). No polymorphisms were found with four exons covering 882 bases or in the 3 UTR which covers 789 bases. The difference between the frequency of promoter polymorphisms and the frequency of coding polymorphisms (8/1256 vs 0/882) is statistically significant (P = 0.02 by two-tailed Fisher s exact test). For comparison of nucleotide diversity with other gene regions, we used the normalised number of variant sites as employed by Cargill et al: 13 = K/ n 1 i=1 i 1 L where K is the observed number of variant sites (12), L is the total sequence length (4393 nt) and n is the number of chromosomes sequenced (72). The respective values are: for the whole of the region; 0 for the coding region; for the non-coding region overall; for the introns; and for the 5 flanking region. To obtain a more accurate estimate of allele frequencies in this population, a sequence specific oligonucleotide PCR method was used to determine genotypes for an independent sample of 424 unrelated healthy Gambian adults. The results are shown in Table 2. All alleles detected by sequencing were found by genotyping in this separate group of individuals, with the exception of the TNF+943 polymorphism which was detected by genotyp- Table 1 Consensus primer sequences were located as follows: for SNPs 1077 to 863, consensus primer at 637 nt; for SNP 857, consensus primer at 1129; for SNPs 376 to 244, consensus primer at 2; for SNP 238, consensus primer at 637; for SNPs +467 and +488, consensus primer at +820 con; for SNPs +846 and +938, consensus primer +1274; for SNP +1299, consensus primer at con sense. All reactions included the positive control primers 63 and 64 which amplify a conserved 796 bp segment of exon 3 of the HLA-DRB1 gene Allele 1 primer Allele 2 primer Conserved primer TNF 1073 GGA CTC ACC AGG TGA GGC C GGA CTC ACC AGG TGA GGC T CCG GGA ATT CAC AGA CCC C TNF 1031 CAA AGG AGA AGC TGA GAA GAT CAA AGG AGA AGC TGA GAA GAC CCG GGA ATT CAC AGA CCC C TNF 863 CGA GTA TGG GGA CCC CCC GAG TAT GGG GAC CCC CA CCG GGA ATT CAC AGA CCC C TNF 857 TCT ACA TGG CCC TGT CTT CG TCT ACA TGG CCC TGT CTT CA AAG GAT AAG GGC TCA GAG AG TNF 376 CCT GCA TCC TGT CTG GAA G TCC TGC ATC CTG TCT GGA AA GGC TGG GTG TGC CAA CAA C TNF 308 ATA GGT TTT GAG GGG CAT GG TAG GTT TTG AGG GGC ATG A GGC TGG GTG TGC CAA CAA C TNF 244 CCA GAA GAC CCC CCT CG CCA GAA GAC CCC CCT CA GGC TGG GTG TGC CAA CAA C TNF 238 CCC CAT CCT CCC TGC TCC CCC CAT CCT CCC TGC TCT GGG GTC TGT GAA TTC CCG G TNF+467 GTG CGC TGA TAG GGA GGG GTG CGC TGA TAG GGA GGA CTC TTT CCC TGA GTG TCT TC TNF+851 TGC TGG AAG GTG AAT ACA CG ATG CTG GAA GGT GAA TAC ACA AAG ACA CAT CCT CAG AGC TC TNF+943 CTT TAA GGG TGA CTC CCT CG CTT TAA GGG TGA CTC CCT CA AAG ACA CAT CCT CAG AGC TC TNF+1304 CCA TCA GCC GGG CTT CAA T CCA TCA GCC GGG CTT CAA C GTA AGT GTC TCC AAA CCT CTT Control TGC CAA GTG GAG CAC CCA A GCA TCT TGC TCT GTG CAG AT 63/64

3 Nucleotide diversity of the TNF gene region Table 2 Polymorphisms detected by sequencing 36 Gambian adults throughout the region 1389 nt to nt in relation to the TNF transcriptional start site identified on Genbank accession no. M The column entitled variants seen on sequencing lists the number of occurences of the rare allele on sequencing 72 Gambian chromosomes. The differentiation of Gambians and Malawians is quantified by Wright s fixation index (F ST ) and by the P value of the 2 test comparing allele frequencies in the two populations 345 Position Region Common/ Variants Gambia Malawi Gambia vs Malawi rare allele seen on sequencing n Homozygotes/ Allele n Homozygotes/ Allele F ST P heterozygotes frequency heterozygotes frequency for rare allele for rare allele FR C/T /34 4% 121 0/14 6% NS FR T/C /99 14% 119 7/46 25% FR C/A /42 6% 121 0/33 14% FR C/T /45 4% 120 0/1 0% FR G/A /21 3% 119 0/15 6% FR G/A /30 17% 120 1/24 11% FR G/A /25 2% 118 0/20 8% FR G/A /62 8% 118 0/24 10% NS +467 Intron 1 G/A /25 2% 116 0/6 3% NS +851 Intron 1 A/G /81 12% 119 4/32 17% Intron 1 G/A /0 0% 120 0/0 0% NS Intron 3 A/G /83 11% 118 4/31 17% ing only in the individual who was originally found to have this polymorphism by sequencing. All allele frequencies were consistent with Hardy Weinberg equilibrium. Allele frequencies for the same polymorphisms were determined in 121 unrelated healthy Malawian adults. All of the Gambian polymorphisms were also found in Malawi apart from the rare TNF+943A allele. However eight of the polymorphisms showed a significant difference in allele frequency between the two populations when analysed by chi-squared test. In particular, the 1031C allele and the 863A allele were approximately double the frequency in Malawi compared to that in The Gambia (25% vs 14% and 14% vs 6% respectively, P for both comparisons). To quantify the effect of population substructure we calculated Wright s fixation index for each of the variable sites, comparing the level of heterozygosity observed within each of the two subpopulations to that observed in the total data set. 16 This gave values of F ST ranging from zero to 0.016, with an average of across all 12 polymorphisms. From these genotypic data it is not possible to determine exact values for linkage disequilibrium, but an impression of strongly linked alleles may be gained by simple pairwise comparison of individual loci. This is illustrated in Table 3, which gives the odds ratio of carrying the rare allele (in either homozygous or heterozygous state) at locus 1 if an individual carries the rare allele (in either homozygous or heterozygous state) at locus 2. In the table, the shaded cells highlight those pairwise comparisons which give P 0.01 by chi-squared test. A very similar pattern of association emerges in both Gambian and Malawian populations. The TNF 1031C, 863A, 376A, 238A, +851G, and +1304G alleles appear to be linked to each other in both populations. Additionally, TNF 244A appears to be linked to TNF 376A, 238A, +851G and +1304G in Malawi, and TNF 1073T appears linked to 857T in The Gambia. Table 3 Odds ratio of carrying the rare allele (in either homozygous or heterozygous state) at one locus if an individual carries the rare allele (in either homozygous or heterozygous state) at the other locus. An asterisk denotes too few observations to infer an odds ratio. Shaded cells highlight those pairwise comparisons which give P 0.01 by 2 test

4 346 Discussion Nucleotide diversity of the TNF gene region In this systematic survey of 72 chromosomes sampled in the Gambian village of Sukuta, we found an overall nucleotide diversity ( ) of in the TNF gene region. This compares to the average value of obtained by Cargill et al 13 among 106 genes distributed throughout the genome, and obtained by Halushka et al 17 among 75 genes. In both of these studies, the various ethnic groups from around the world were sampled. Thus the level of nucleotide diversity at the TNF locus within a single African village is comparable to the global value for human autosomal genes across different continents. These data do not allow us to draw firm conclusions about the relative nucleotide diversity of TNF compared to other loci, or about the overall level of genetic diversity in Sukuta compared to other communities, and systematic surveys of multiple gene loci in other well-defined communities are needed to address these issues. However an emerging body of data suggests that many of the common variable sites in the human genome may be found within a single African community, unless it happens to derive from a small number of founders and is highly inbred, and our present findings would be highly consistent with this notion. In this Gambian study population, we found a significantly higher frequency of polymorphic sites in the TNF promoter region compared to the TNF coding region (8 per 1256 nt vs 0 per 873 nt, P = 0.01). The corresponding values of are for the promoter region and 0 for the coding region, which is a wider difference than observed in most other gene regions: Cargill et al 13 report average values of and for noncoding and coding regions respectively. However approximately 10% of genes studied by these authors had a nucleotide diversity of in the non-coding region, while over 5% had no observed nucleotide diversity in the coding region. Taken together, it would seem that the TNF promoter region may be somewhat more variable and the coding region rather less variable than average, but both are within the range of values observed elsewhere in the genome. All of the polymorphisms that we identified in the Gambian population were also found in Malawians, with the exception of a rare TNF+943A allele which was present in only one of the 576 individuals that we analysed. Malawi and The Gambia are geographically remote and their populations are known to be genetically different, 18 so it is not surprising that eight of the 12 TNF polymorphisms are at significantly different frequency in the two populations. However the level of population differentiation was relatively low when assessed by Wright s fixation index, with an F ST value of averaged across the 12 variable sites, compared to values in the region of 0.07 for a variety of other genes compared across different populations worldwide (Goddard et al 19 and G McVean, personal communication). Further data from other African and non-african populations may shed light on the demographic history of the TNF locus, including the notion that specific TNF alleles may confer selective advantage or disadvantage in relation to malaria and other infectious diseases. A growing number of disease associations have been reported for polymorphisms in the TNF promoter region. These include associations between infectious diseases and the TNF 308A allele, the TNF 238A allele and the TNF 376A allele. 2 8 To give a few examples of associations with non-infectious diseases, asthma has been associated with the TNF 308A allele, 9 multiple sclerosis with the TNF 376A allele, 10 rheumatoid joint damage with TNF 238G homozygotes, and Crohn s disease with the TNF 1031C allele. 11,20 There has been some debate as to the functional significance of these associations: for example, as the TNF 308A allele has been reported to increase transcriptional activation in some experimental systems 21,22 but not others. 23,24 We have found that the TNF 376A allele acts to recruit the transcription factor OCT-1 to this part of the TNF promoter region 7 and this appears to be associated with a modest increase in basal gene expression in the human monocyte line MonoMac6. Allele-specific binding of OCT-1 has also been observed to the TNF- 857A allele. 25 We have recently noted that the TNF 863A allele acts to reduce the binding of NF- B p50/p50, with little effect on p65/p50 binding, to this part of the TNF promoter region. 26 The effect appears to be to increase inducible TNF expression in primary human monocytes: this is consistent with observations by some investigators 27 but not others. 28,29 It remains to be determined whether these different observations are true inconsistencies, or simply reflect the true functional heterogeneity of varied cell types under different conditions of stimulation. The uncertain state of the functional evidence means that, if the above disease associations are replicated in independent studies, investigators must seriously consider the possibility that they relate to functional polymorphisms outside the TNF promoter region. In the case of disease associations within Caucasian populations, the true effect might turn out to map to a distant part of the MHC because of the strong linkage disequilibrium that exists across this region in Caucasians. The main import of the present study is to show that, at least in Africans, it is unlikely that the disease associations with TNF promoter polymorphisms can be ascribed to functional variation elsewhere in the TNF gene, except perhaps to two new intronic polymorphisms that we have identified at +851 and nt, that have allele frequencies as high as 17% in the Malawian population. We are currently carrying out a family analysis of polymorphisms of TNF and adjacent genes, with the goal of determining the precise extent of linkage disequilibrium at the TNF locus in Africans, and of building a detailed haplotypic map that will allow disease associations at this locus to be analysed with greater confidence. Methods Subjects To screen for novel polymorphisms, blood samples were obtained from 36 healthy individuals aged 2 to 44 years, all residents of the peri-urban village of Sukuta in the Western division of The Gambia. A sample size of 36 individuals, ie 72 chromosomes, gives 95% probability of detecting an allele of 4% frequency. To estimate allele frequencies, blood samples were obtained from 424 unrelated healthy Gambian adults and 121 unrelated healthy Malawian adults. All subjects gave informed consent and the study was approved by the Gambia Govern-

5 ment/medical Research Council Joint Ethical Committee and the College of Medicine Research Committee of the University of Malawi. Sequencing The first round of PCR amplification used genomic DNA (100 ng), oligonucleotide primers (0.5 M), dntps (0.8 mm), MgCl 2 (2.5 or 3.75 mm) and AmpliTaq Gold (1.25 U; Perkin Elmer, CA, USA) in 20 l PCR buffer (Perkin Elmer). Primer pairs were: 1389 (5 AGG CTG ACC AAG AGA GAA AG 3 ) and 484 (5 TTG AGT CCT GAG GCC TGT GT 3 ); 952 (5 GTT ACA GGA GAC CTC TGG GG 3 ) and +125 (5 GGA AGA GAA CCT GCC TGG C 3 ); 88 (5 AGGAAGTTTTCCGCTGGTTG3 ) and+1565 (5 TCA GCT TGA GGG TTT GCT GG 3 ); (5 ATA CTC AGA ACG TCA TGG CC 3 ) and+3004 (5 GAG TTG GAA ATT CCC ATG CC 3 ). An MJ Tetrad was programmed as follows: 95 C for 12 minutes; followed by 35 cycles of 94 C for 30 s, 58 C for 45 s and 70 C for1min; finishing with 10 min at 72 C before holding at 15 C. The second round of PCR amplification used firstround PCR product diluted 1:10 in distilled water (1 l), primers (0.5 M), dntps (0.8 mm), MgCl 2 (3 mm) and AmpliTaq Gold (1.25 U; Perkin Elmer) in 30 l PCR buffer (Perkin Elmer). Primer pairs were: 1389 (as above but with the M13 21 sequence added at the 5 end) and 900 (5 M13REV GAC ATT CTC CTA CCC ATT GC 3 ); 952 ( 21M13 5 GTT ACA GGA GAC CTC TGG GG 3 ) and 484 (as above but with the M13REV sequence added at the 5 end); 352 ( 21M13 5 TCC CCA AAA GAA ATG GAG GC 3 ) and +125 (as above but with the M13REV sequence added at the 5 end); 562 ( 21M13 5 TTT CCT GAG GCC TCA AGC CT 3 ) and 188 (M13REV 5 GTT GGG GAC ACA CAA GCA TC 3 ); 88 ( 21M13 5 AGG AAG TTT TCC GCT GGT TG 3 ) and +522 (M13REV 5 TCT CTT GCG TCT CCA TTT CC 3 ); +279 ( 21M13 5 TCT TCT CCT TCC TGA TCG TG 3 ) and +846 (M13REV 5 TGT GTA TTC ACC TTC CAG GC 3 ); +773 ( 21M13 5 AAG AAG ATA GGG TGT CTG GC 3 ) and (M13REV 5 AAG TTC TGC CTA CCA TCA GC 3 ); ( 21M13 5 CAT GTT GTA GGT AAG AGC TC 3 ) and (M13REV 5 TCA GCT TGA GGG TTT GCT GG 3 ); ( 21M13 5 ATA CTC AGA ACG TCA TGG CC 3 ) and (M13REV 5 ACC TTG GTC TGG TAG GAG AC 3 ); ( 21M13 5 TGT ACC TCA TCT ACT CCC AG 3 ) and (M13REV 5 TCA GGG ATC AAA GCT GTA GG 3 ); ( 21M13 5 TGG GAT TCA GGA ATG TGT GG 3 ) and (M13REV 5 CAG TTG GTC ACC AAA TCA GC 3 ); ( 21M13 5 ATT TGG GAG ACC GGG GTA TC 3 ) and (M13REV 5 GAG TTG GAA ATT CCC ATG CC 3 ). An MJ Tetrad was programmed as follows: 95 C for 12 min; followed by 5 cycles of 94 C for 30 s, 57 C for 30 s and 72 C for 45 s; then 30 cycles of 94 C for 1 min, 72 C for 1 min; finishing with 10 min at 72 C before holding at 15 C. DNA sequencing was performed on an ABI377 automated sequencer using M13 Dye primer and M13 Big dye primer sequencing kits (Perkin Elmer) and analysed using Factura and Sequence Navigator. Genotyping The amplification refractory mutation system (ARMS) method was used to genotype the polymorphisms identified at the previous stage of analysis. Primer sequences are given in Table 1. PCR amplification was performed Nucleotide diversity of the TNF gene region in 15 l reaction volume containing approximately 15 ng genomic DNA plus: 0.4 mm total dntps; 16.6 mm ammonium sulphate; 1.9 mm magnesium chloride; 67.9 mm Tris-base (ph 8.9); 0.1% v/v Tween 20; 20 ng of each allele specific and consensus primer; 5 ng of each positive control primer; 0.25 units of Bioline Taq. An MJ Tetrad PCR was programmed as follows: 96 C for 1 min; five cycles of 96 C for 35 s, 70 C for 45 s, 72 C for 35 s; 21 cycles of 96 C for 25 s, 65 C for 50 s, 72 C for 40 s; six cycles of 96 C for 35 s, 55 C for 1 min, 72 C for 1.5 min and hold at 15 C. The accuracy of the ARMS PCR method was tested on sequenced individuals before extending it to DNA samples of unknown genotype. Acknowledgements We thank the inhabitants of Sukuta for making this study possible, and Simon Correa, Idi Sambou, Yaya Dibba and Isatou Drammeh for excellent technical help and field work. FS-J is a WHO Training Fellow. References 1 Complete sequence and gene map of a human major histocompatibility complex. The MHC sequencing consortium [In Process Citation]. Nature 1999; 401: McGuire W, Hill AV, Allsopp CE, Greenwood BM, Kwiatkowski D. Variation in the TNF-alpha promoter region associated with susceptibility to cerebral malaria. Nature 1994; 371: Cabrera M, Shaw MA, Sharples CJ et al. Polymorphism in tumor necrosis factor genes associated with mucocutaneous leishmaniasis. J Exp Med 1995; 182: Nadel S, Newport MJ, Booy R, Levin M. Variation in the tumor necrosis factor-alpha gene promoter region may be associated with death from meningococcal disease. J Infect Dis 1996; 174: Conway DJ, Holland MJ, Bailey RL et al. Scarring trachoma is associated with polymorphism in the tumor necrosis factor alpha (TNF-alpha) gene promoter and with elevated TNF-alpha levels in tear fluid. Infect Immun 1997; 65: McGuire W, Knight JC, Hill AV, Allsopp CE, Greenwood BM, Kwiatkowski D. Severe malarial anemia and cerebral malaria are associated with different tumor necrosis factor promoter alleles. J Infect Dis 1999; 179: Knight JC, Udalova I, Hill AV et al. A polymorphism that affects OCT-1 binding to the TNF promoter region is associated with severe malaria. Nat Genet 1999; 22: Knight JC, Kwiatkowski D. Inherited variability of tumor necrosis factor production and susceptibility to infectious disease. Proc Assoc Am Physicians 1999; 111: Moffatt MF, Cookson WO. Tumour necrosis factor haplotypes and asthma. Hum Mol Genet 1997; 6: Fernandez-Arquero M, Arroyo R, Rubio A et al. Primary association of a TNF gene polymorphism with susceptibility to multiple sclerosis. Neurology 1999; 53: Negoro K, Kinouchi Y, Hiwatashi N et al. Crohn s disease is associated with novel polymorphisms in the 5 -flanking region of the tumor necrosis factor gene. Gastroenterology 1999; 117: Westendorp RG, Langermans JA, Huizinga TW et al. Genetic influence on cytokine production and fatal meningococcal disease [published erratum appears in Lancet 1997; 349: 656]. Lancet 1997; 349: Cargill M, Altshuler D, Ireland J et al. Characterization of singlenucleotide polymorphisms in coding regions of human genes. Nat Genet 1999; 22: Hill AV, Allsopp CE, Kwiatkowski D et al. Common West African HLA antigens are associated with protection from severe malaria. Nature 1991; 352:

6 348 Nucleotide diversity of the TNF gene region 15 Nedospasov SA, Shakhov AN, Turetskaya RL et al. Tandem arrangement of genes coding for tumor necrosis factor (TNFalpha) and lymphotoxin (TNF-beta) in the human genome. Cold Spring Harb Symp Quant Biol 1986; 51: Wright S. Systems of mating. Genetics 1921; 6: Halushka MK, Fan JB, Bentley K et al. Patterns of single-nucleotide polymorphisms in candidate genes for blood-pressure homeostasis. Nat Genet 1999; 22: Hill AV, Allsopp CE, Kwiatkowski D et al. Extensive genetic diversity in the HLA class II region of Africans, with a focally predominant allele, DRB1*1304. Proc Natl Acad Sci USA 1992; 89: Goddard KA, Hopkins PJ, Hall JM, Witte JS. Linkage disequilibrium and allele-frequency distributions for 114 single-nucleotide polymorphisms in five populations. Am J Hum Genet 2000; 66: Kawasaki A, Tsuchiya N, Hagiwara K, Takazoe M, Tokunaga K. Independent contribution of HLA-DRB1 and TNF alpha promoter polymorphisms to the susceptibility to Crohn s disease. Genes Immun 2000; 1: Wilson AG, Symons JA, McDowell TL, McDevitt HO, Duff GW. Effects of a polymorphism in the human tumor necrosis factor alpha promoter on transcriptional activation. Proc Natl Acad Sci USA 1997; 94: Abraham LJ, Kroeger KM. Impact of the 308 TNF promoter polymorphism on the transcriptional regulation of the TNF gene: relevance to disease. J Leukoc Biol 1999; 66: Brinkman BM, Zuijdeest D, Kaijzel EL, Breedveld FC, Verweij CL. Relevance of the tumor necrosis factor alpha (TNF alpha) 308 promoter polymorphism in TNF alpha gene regulation. J Inflamm 1995; 46: Stuber F, Udalova IA, Book M et al. 308 tumor necrosis factor (TNF) polymorphism is not associated with survival in severe sepsis and is unrelated to lipopolysaccharide inducibility of the human TNF promoter. J Inflamm 1996; 46: Hohjoh H, Tokunaga K. Allele-specific binding of the ubiquitous transcription factor OCT-1 to the functional single nucleotide polymorphism (SNP) sites in the tumor necrosis factor-alpha gene (TNFA) promoter. Genes Immun 2001; 2: Udalova IA, Richardson A, Denys A et al. Functional consequences of a polymorphism affecting NF-kappaB p50-p50 binding to the TNF promoter region. Mol Cell Biol 2000; 20: Higuchi T, Seki N, Kamizono S et al. Polymorphism of the 5 flanking region of the human tumor necrosis factor (TNF)-alpha gene in Japanese. Tissue Antigens 1998; 51: Skoog T, van t Hooft FM, Kallin B et al. A common functional polymorphism (C A substitution at position 863) in the promoter region of the tumour necrosis factor-alpha (TNF-alpha) gene associated with reduced circulating levels of TNF-alpha. Hum Mol Genet 1999; 8: Uglialoro AM, Turbay D, Pesavento PA et al. Identification of three new single nucleotide polymorphisms in the human tumor necrosis factor-alpha gene promoter. Tissue Antigens 1998; 52:

Supplementary Document

Supplementary Document Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.

More information

Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.

Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed. Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons

More information

c Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP

c Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP Supplementary Figure 1 Establishment of the gain- and loss-of-function experiments and cell survival assays. a Relative expression of mature mir-484 30 20 10 0 **** **** NCP mir- 484P NCP mir- 484P b Relative

More information

Supplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N

Supplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N MYC YFP N PIF5 YFP C N-TIC TIC Supplemental Data. Shin et al. Plant Cell. ()..5/tpc..95 Supplemental Figure. TIC interacts with MYC in the nucleus. Bimolecular fluorescence complementation assay using

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate

More information

a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53

a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,

More information

Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most

Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most differentially expressed between human synovial fibroblasts

More information

Supplementary Figure 1 a

Supplementary Figure 1 a Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control

More information

Supplementary Materials

Supplementary Materials Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi

More information

Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at

Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at different concentrations for 30 min and analyzed for

More information

Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.

Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification. Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA

More information

Supplementary Table 2. Conserved regulatory elements in the promoters of CD36.

Supplementary Table 2. Conserved regulatory elements in the promoters of CD36. Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG

More information

Table S1. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9. Assay (s) Target Name Sequence (5 3 ) Comments

Table S1. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9. Assay (s) Target Name Sequence (5 3 ) Comments SUPPLEMENTAL INFORMATION 2 3 Table S. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9 genes. Assay (s) Target Name Sequence (5 3 ) Comments CDC M InfA Forward (NS), CDC M

More information

BIOLOGY 621 Identification of the Snorks

BIOLOGY 621 Identification of the Snorks Name: Date: Block: BIOLOGY 621 Identification of the Snorks INTRODUCTION: In this simulation activity, you will examine the DNA sequence of a fictitious organism - the Snork. Snorks were discovered on

More information

Figure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and

Figure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and Figure S1. Analysis of genomic and sequences of the targeted regions in and indicated mutant KI cells, with WT and corresponding mutant sequences underlined. (A) cells; (B) K21E-KI cells; (C) D33A-KI cells;

More information

Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards

Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards incubated in 100 % ethanol overnight at 4 C and embedded in

More information

Citation for published version (APA): Oosterveer, M. H. (2009). Control of metabolic flux by nutrient sensors Groningen: s.n.

Citation for published version (APA): Oosterveer, M. H. (2009). Control of metabolic flux by nutrient sensors Groningen: s.n. University of Groningen Control of metabolic flux by nutrient sensors Oosterveer, Maaike IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it.

More information

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3' Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA

More information

Culture Density (OD600) 0.1. Culture Density (OD600) Culture Density (OD600) Culture Density (OD600) Culture Density (OD600)

Culture Density (OD600) 0.1. Culture Density (OD600) Culture Density (OD600) Culture Density (OD600) Culture Density (OD600) A. B. C. D. E. PA JSRI JSRI 2 PA DSAM DSAM 2 DSAM 3 PA LNAP LNAP 2 LNAP 3 PAO Fcor Fcor 2 Fcor 3 PAO Wtho Wtho 2 Wtho 3 Wtho 4 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB

More information

Beta Thalassemia Case Study Introduction to Bioinformatics

Beta Thalassemia Case Study Introduction to Bioinformatics Beta Thalassemia Case Study Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline v Hemoglobin v Alpha

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. H3F3B expression in lung cancer. a. Comparison of H3F3B expression in relapsed and non-relapsed lung cancer patients. b. Prognosis of two groups of lung cancer

More information

Beta Thalassemia Sami Khuri Department of Computer Science San José State University Spring 2015

Beta Thalassemia Sami Khuri Department of Computer Science San José State University Spring 2015 Bioinformatics in Medical Product Development SMPD 287 Three Beta Thalassemia Sami Khuri Department of Computer Science San José State University Hemoglobin Outline Anatomy of a gene Hemoglobinopathies

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature05883 SUPPLEMENTARY INFORMATION Supplemental Figure 1 Prostaglandin agonists and antagonists alter runx1/cmyb expression. a-e, Embryos were exposed to (b) PGE2 and (c) PGI2 (20μM) and

More information

Mutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients

Mutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients Mutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients Shuichi OTABE, Karine CLEMENT, Séverine DUBOIS, Frederic LEPRETRE, Veronique PELLOUX,

More information

Nature Immunology: doi: /ni.3836

Nature Immunology: doi: /ni.3836 Supplementary Figure 1 Recombinant LIGHT-VTP induces pericyte contractility and endothelial cell activation. (a) Western blot showing purification steps for full length murine LIGHT-VTP (CGKRK) protein:

More information

Astaxanthin prevents and reverses diet-induced insulin resistance and. steatohepatitis in mice: A comparison with vitamin E

Astaxanthin prevents and reverses diet-induced insulin resistance and. steatohepatitis in mice: A comparison with vitamin E Supplementary Information Astaxanthin prevents and reverses diet-induced insulin resistance and steatohepatitis in mice: A comparison with vitamin E Yinhua Ni, 1,2 Mayumi Nagashimada, 1 Fen Zhuge, 1 Lili

More information

Supplemental Information. Th17 Lymphocytes Induce Neuronal. Cell Death in a Human ipsc-based. Model of Parkinson's Disease

Supplemental Information. Th17 Lymphocytes Induce Neuronal. Cell Death in a Human ipsc-based. Model of Parkinson's Disease Cell Stem Cell, Volume 23 Supplemental Information Th17 Lymphocytes Induce Neuronal Cell Death in a Human ipsc-based Model of Parkinson's Disease Annika Sommer, Franz Maxreiter, Florian Krach, Tanja Fadler,

More information

Supplementary Figure 1a

Supplementary Figure 1a Supplementary Figure 1a Hours: E-cadherin TGF-β On TGF-β Off 0 12 24 36 48 24 48 72 Vimentin βactin Fig. S1a. Treatment of AML12 cells with TGF-β induces EMT. Treatment of AML12 cells with TGF-β results

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG

More information

Relationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia

Relationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia elationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia H.J. Ou 1, G. Huang 2, W. Liu 3, X.L. Ma 2, Y. Wei 4, T. Zhou 5 and Z.M. Pan 3 1 Department of Neurology, The

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. Lats1/2 deleted ihbs and ihps showed decreased transcripts of hepatocyte related genes (a and b) Western blots (a) and recombination PCR (b) of control and

More information

Detection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany

Detection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany HLA ISSN 2059-2302 BRIEF COMMUNICATION Detection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany C. J. Hernández-Frederick 1, N. Cereb 2,A.S.Giani 1, J.

More information

A smart acid nanosystem for ultrasensitive. live cell mrna imaging by the target-triggered intracellular self-assembly

A smart acid nanosystem for ultrasensitive. live cell mrna imaging by the target-triggered intracellular self-assembly Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 A smart ZnO@polydopamine-nucleic acid nanosystem for ultrasensitive live cell mrna imaging

More information

www.lessonplansinc.com Topic: Protein Synthesis - Sentence Activity Summary: Students will simulate transcription and translation by building a sentence/polypeptide from words/amino acids. Goals & Objectives:

More information

Cross-talk between mineralocorticoid and angiotensin II signaling for cardiac

Cross-talk between mineralocorticoid and angiotensin II signaling for cardiac ONLINE SUPPLEMENT TO Crosstalk between mineralocorticoid and angiotensin II signaling for cardiac remodeling An Di ZHANG,,3, Aurelie NGUYEN DINH CAT*,,3, Christelle SOUKASEUM *,,3, Brigitte ESCOUBET, 4,

More information

*To whom correspondence should be addressed. This PDF file includes:

*To whom correspondence should be addressed.   This PDF file includes: www.sciencemag.org/cgi/content/full/science.1212182/dc1 Supporting Online Material for Partial Retraction to Detection of an Infectious Retrovirus, XMRV, in Blood Cells of Patients with Chronic Fatigue

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice

More information

Supporting Information

Supporting Information Supporting Information Malapeira et al. 10.1073/pnas.1217022110 SI Materials and Methods Plant Material and Growth Conditions. A. thaliana seedlings were stratified at 4 C in the dark for 3 d on Murashige

More information

Baseline clinical characteristics for the 81 CMML patients Routine diagnostic testing and statistical analyses... 3

Baseline clinical characteristics for the 81 CMML patients Routine diagnostic testing and statistical analyses... 3 Next-Generation Sequencing Technology Reveals a Characteristic Pattern of Molecular Mutations in 72.8% of Chronic Myelomonocytic Leukemia (CMML) by Detecting Frequent Alterations in TET2, CBL, RAS, and

More information

Supplementary Figure 1

Supplementary Figure 1 Metastatic melanoma Primary melanoma Healthy human skin Supplementary Figure 1 CD22 IgG4 Supplementary Figure 1: Immunohisochemical analysis of CD22+ (left) and IgG4 (right), cells (shown in red and indicated

More information

Supplementary Information. Bamboo shoot fiber prevents obesity in mice by. modulating the gut microbiota

Supplementary Information. Bamboo shoot fiber prevents obesity in mice by. modulating the gut microbiota Supplementary Information Bamboo shoot fiber prevents obesity in mice by modulating the gut microbiota Xiufen Li 1,2, Juan Guo 1, Kailong Ji 1,2, and Ping Zhang 1,* 1 Key Laboratory of Tropical Plant Resources

More information

Nucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10

Nucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10 J. gen. Virol. (1988), 69, 945-949. Printed in Great Britain 945 Key words: BTV/genome segment lo/nucleotide sequence Nucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10 By

More information

Supplemental Information. Cancer-Associated Fibroblasts Neutralize. the Anti-tumor Effect of CSF1 Receptor Blockade

Supplemental Information. Cancer-Associated Fibroblasts Neutralize. the Anti-tumor Effect of CSF1 Receptor Blockade Cancer Cell, Volume 32 Supplemental Information Cancer-Associated Fibroblasts Neutralize the Anti-tumor Effect of CSF1 Receptor Blockade by Inducing PMN-MDSC Infiltration of Tumors Vinit Kumar, Laxminarasimha

More information

CIRCRESAHA/2004/098145/R1 - ONLINE 1. Validation by Semi-quantitative Real-Time Reverse Transcription PCR

CIRCRESAHA/2004/098145/R1 - ONLINE 1. Validation by Semi-quantitative Real-Time Reverse Transcription PCR CIRCRESAHA/2004/098145/R1 - ONLINE 1 Expanded Materials and Methods Validation by Semi-quantitative Real-Time Reverse Transcription PCR Expression patterns of 13 genes (Online Table 2), selected with respect

More information

Integration Solutions

Integration Solutions Integration Solutions (1) a) With no active glycosyltransferase of either type, an ii individual would not be able to add any sugars to the O form of the lipopolysaccharide. Thus, the only lipopolysaccharide

More information

Single-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast

Single-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast Supplemental Figures, Tables and Results Single-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast Sami Hocine 1, Pascal Raymond 2, Daniel Zenklusen 2, Jeffrey A. Chao 1 &

More information

Supplementary information

Supplementary information Supplementary information Unique polypharmacology nuclear receptor modulator blocks inflammatory signaling pathways Mi Ra Chang 1, Anthony Ciesla 1, Timothy S. Strutzenberg 1, Scott J. Novick 1, Yuanjun

More information

SUPPORTING INFORMATION

SUPPORTING INFORMATION SUPPORTING INFORMATION Biology is different in small volumes: endogenous signals shape phenotype of primary hepatocytes cultured in microfluidic channels Amranul Haque, Pantea Gheibi, Yandong Gao, Elena

More information

Journal of Cell Science Supplementary information. Arl8b +/- Arl8b -/- Inset B. electron density. genotype

Journal of Cell Science Supplementary information. Arl8b +/- Arl8b -/- Inset B. electron density. genotype J. Cell Sci. : doi:.4/jcs.59: Supplementary information E9. A Arl8b /- Arl8b -/- Arl8b Arl8b non-specific band Gapdh Tbp E7.5 HE Inset B D Control al am hf C E Arl8b -/- al am hf E8.5 F low middle high

More information

RESEARCH COMMUNICATION. Genotype Frequencies of Cyclooxygenease 2 (COX2) Rare Polymorphisms for Japanese with and without Colorectal Cancer

RESEARCH COMMUNICATION. Genotype Frequencies of Cyclooxygenease 2 (COX2) Rare Polymorphisms for Japanese with and without Colorectal Cancer COX2 Rare Polymorphisms and Colorectal Cancer RESEARCH COMMUNICATION Genotype Frequencies of Cyclooxygenease 2 (COX2) Rare Polymorphisms for Japanese with and without Colorectal Cancer Nobuyuki Hamajima

More information

A basic helix loop helix transcription factor controls cell growth

A basic helix loop helix transcription factor controls cell growth A basic helix loop helix transcription factor controls cell growth and size in root hairs Keke Yi 1,2, Benoît Menand 1,3, Elizabeth Bell 1, Liam Dolan 1,4 Supplementary note Low soil phosphate availability

More information

Lezione 10. Sommario. Bioinformatica. Lezione 10: Sintesi proteica Synthesis of proteins Central dogma: DNA makes RNA makes proteins Genetic code

Lezione 10. Sommario. Bioinformatica. Lezione 10: Sintesi proteica Synthesis of proteins Central dogma: DNA makes RNA makes proteins Genetic code Lezione 10 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Lezione 10: Sintesi proteica Synthesis of proteins Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università La Sapienza

More information

BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL

BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL 1 2 3 4 Materials and Methods Cell culture BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) 5 supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL 6 penicillin-streptomycin.

More information

What do you think of when you here the word genome?

What do you think of when you here the word genome? What do you think of when you here the word genome? What do you think of when you here the word genome? Personal Genomics Outline Review of pre-lab work Genomics and Medicine Case Overview & Assignment

More information

Cancer Genetics 204 (2011) 45e52

Cancer Genetics 204 (2011) 45e52 Cancer Genetics 204 (2011) 45e52 Exon scanning by reverse transcriptaseepolymerase chain reaction for detection of known and novel EML4eALK fusion variants in nonesmall cell lung cancer Heather R. Sanders

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION BASELINE ISCHAEMIA a b Phd2 +/- c d Collateral growth and maintenance SMC recruitment SMC proliferation Phd2 +/- NF- B off NF- B on NF- B on NF- B on Endothelial cell Smooth muscle cell Pro-arteriogenic

More information

Mutation analysis of a Chinese family with oculocutaneous albinism

Mutation analysis of a Chinese family with oculocutaneous albinism /, 2016, Vol. 7, (No. 51), pp: 84981-84988 Mutation analysis of a Chinese family with oculocutaneous albinism Xiong Wang 1, Yaowu Zhu 1, Na Shen 1, Jing Peng 1, Chunyu Wang 1, Haiyi Liu 2, Yanjun Lu 1

More information

Supplementary Materials and Methods

Supplementary Materials and Methods DD2 suppresses tumorigenicity of ovarian cancer cells by limiting cancer stem cell population Chunhua Han et al. Supplementary Materials and Methods Analysis of publicly available datasets: To analyze

More information

TetR repressor-based bioreporters for the detection of doxycycline using Escherichia

TetR repressor-based bioreporters for the detection of doxycycline using Escherichia Supplementary materials TetR repressor-based bioreporters for the detection of doxycycline using Escherichia coli and Acinetobacter oleivorans Hyerim Hong and Woojun Park * Department of Environmental

More information

Isolate Sexual Idiomorph Species

Isolate Sexual Idiomorph Species SUPLEMENTARY TABLE 1. Isolate identification, sexual idiomorph and species of each isolate used for MAT locus distribution in Paracoccidioides species. Isolate Sexual Idiomorph Species Pb01 MAT1-1 P. lutzii

More information

Expression of Selected Inflammatory Cytokine Genes in Bladder Biopsies

Expression of Selected Inflammatory Cytokine Genes in Bladder Biopsies Borneo Journal of Resource Science and Technology (2013) 3(2): 15-20 Expression of Selected Inflammatory Cytokine Genes in Bladder Biopsies EDMUND UI-HANG SIM *1, NUR DIANA ANUAR 2, TENG-AIK ONG 3, GUAN-

More information

Characterizing intra-host influenza virus populations to predict emergence

Characterizing intra-host influenza virus populations to predict emergence Characterizing intra-host influenza virus populations to predict emergence June 12, 2012 Forum on Microbial Threats Washington, DC Elodie Ghedin Center for Vaccine Research Dept. Computational & Systems

More information

Phylogenetic analysis of human and chicken importins. Only five of six importins were studied because

Phylogenetic analysis of human and chicken importins. Only five of six importins were studied because Supplementary Figure S1 Phylogenetic analysis of human and chicken importins. Only five of six importins were studied because importin-α6 was shown to be testis-specific. Human and chicken importin protein

More information

Supporting Information. Mutational analysis of a phenazine biosynthetic gene cluster in

Supporting Information. Mutational analysis of a phenazine biosynthetic gene cluster in Supporting Information for Mutational analysis of a phenazine biosynthetic gene cluster in Streptomyces anulatus 9663 Orwah Saleh 1, Katrin Flinspach 1, Lucia Westrich 1, Andreas Kulik 2, Bertolt Gust

More information

SUPPLEMENTAL METHODS Cell culture RNA extraction and analysis Immunohistochemical analysis and laser capture microdissection (LCM)

SUPPLEMENTAL METHODS Cell culture RNA extraction and analysis Immunohistochemical analysis and laser capture microdissection (LCM) SUPPLEMENTAL METHODS Cell culture Human peripheral blood mononuclear cells were isolated from healthy donors by Ficoll density gradient centrifugation. Monocyte differentiation to resting macrophages ()

More information

Mechanistic and functional insights into fatty acid activation in Mycobacterium tuberculosis SUPPLEMENTARY INFORMATION

Mechanistic and functional insights into fatty acid activation in Mycobacterium tuberculosis SUPPLEMENTARY INFORMATION Mechanistic and functional insights into fatty acid activation in Mycobacterium tuberculosis Pooja Arora 1, Aneesh Goyal 2, Vivek T atarajan 1, Eerappa Rajakumara 2, Priyanka Verma 1, Radhika Gupta 3,

More information

Resistance to Tetracycline Antibiotics by Wangrong Yang, Ian F. Moore, Kalinka P. Koteva, Donald W. Hughes, David C. Bareich and Gerard D. Wright.

Resistance to Tetracycline Antibiotics by Wangrong Yang, Ian F. Moore, Kalinka P. Koteva, Donald W. Hughes, David C. Bareich and Gerard D. Wright. Supplementary Data for TetX is a Flavin-Dependent Monooxygenase Conferring Resistance to Tetracycline Antibiotics by Wangrong Yang, Ian F. Moore, Kalinka P. Koteva, Donald W. Hughes, David C. Bareich and

More information

TBX21 gene variants increase childhood asthma risk in combination with HLX1 variants

TBX21 gene variants increase childhood asthma risk in combination with HLX1 variants TBX21 gene variants increase childhood asthma risk in combination with HLX1 variants Kathrin Suttner, MSc, a Philip Rosenstiel, MD, b Martin Depner, MSc, c Michaela Schedel, PhD, a Leonardo A. Pinto, MD,

More information

Frequency of mosaicism points towards mutation prone early cleavage cell divisions.

Frequency of mosaicism points towards mutation prone early cleavage cell divisions. Frequency of mosaicism points towards mutation prone early cleavage cell divisions. Chad Harland, Wouter Coppieters, Latifa Karim, Carole Charlier, Michel Georges Germ-line de novo mutations Definition:

More information

Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables

Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were

More information

Enhanced detection and serotyping of Streptococcus pneumoniae using multiplex polymerase chain reaction

Enhanced detection and serotyping of Streptococcus pneumoniae using multiplex polymerase chain reaction Original article http://dx.doi.org/10.3345/kjp.2012.55.11.424 Korean J Pediatr 2012;55(11):424-429 eissn 1738-1061 pissn 2092-7258 Enhanced detection and serotyping of Streptococcus pneumoniae using multiplex

More information

The Clinical Performance of Primary HPV Screening, Primary HPV Screening Plus Cytology Cotesting, and Cytology Alone at a Tertiary Care Hospital

The Clinical Performance of Primary HPV Screening, Primary HPV Screening Plus Cytology Cotesting, and Cytology Alone at a Tertiary Care Hospital The Clinical Performance of Primary HPV Screening, Primary HPV Screening Plus Cytology Cotesting, and Cytology Alone at a Tertiary Care Hospital Jung-Woo Choi MD, PhD; Younghye Kim MD, PhD; Ju-Han Lee

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/10/473/eaai7696/dc1 Supplementary Materials for Astrocyte-shed extracellular vesicles regulate the peripheral leukocyte response to inflammatory brain lesions

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature10743 Supplementary Figures and Legends Supplementary Figure 1. CYP17A1 (red boxes) lies at the intersection of steroid hormone biosynthetic pathways. CYP17A1

More information

SUPPLEMENTAL FIGURE 1

SUPPLEMENTAL FIGURE 1 SUPPLEMENTL FIGURE 1 C Supplemental Figure 1. pproach for removal of snorns from Rpl13a gene. () Wild type Rpl13a exonintron structure is shown, with exo in black and intronic snorns in red rectangles.

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1: Cryopreservation alters CD62L expression by CD4 T cells. Freshly isolated (left) or cryopreserved PBMCs (right) were stained with the mix of antibodies described

More information

Loyer, et al. microrna-21 contributes to NASH Suppl 1/15

Loyer, et al. microrna-21 contributes to NASH Suppl 1/15 Loyer, et al. microrna-21 contributes to NASH Suppl 1/15 SUPPLEMENTARY MATERIAL: Liver MicroRNA-21 is Overexpressed in Non Alcoholic Steatohepatitis and Contributes to the Disease in Experimental Models

More information

University of Groningen. Vasoregression in incipient diabetic retinopathy Pfister, Frederick

University of Groningen. Vasoregression in incipient diabetic retinopathy Pfister, Frederick University of Groningen Vasoregression in incipient diabetic retinopathy Pfister, Frederick IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from

More information

Supplementary Information

Supplementary Information Supplementary Information Remodeling of heterochromatin structure slows neuropathological progression and prolongs survival in an animal model of Huntington s disease Junghee Lee, Yu Jin Hwang, Yunha Kim,

More information

ice-cold 70% ethanol with gentle vortexing, incubated at -20 C for 4 hours, and washed with PBS.

ice-cold 70% ethanol with gentle vortexing, incubated at -20 C for 4 hours, and washed with PBS. Cell cycle analysis For cell cycle analysis, single cell suspensions of E12.5 fetal liver cells were suspended in 4 ml ice-cold 7% ethanol with gentle vortexing, incubated at -2 C for 4 hours, and washed

More information

Bacterial Gene Finding CMSC 423

Bacterial Gene Finding CMSC 423 Bacterial Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would

More information

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG

More information

Genetic characterisation of invasive breast cancer: a comparison of CGH and PCR based multiplex microsatellite analysis

Genetic characterisation of invasive breast cancer: a comparison of CGH and PCR based multiplex microsatellite analysis 836 Gerhard-Domagk- Institute of Pathology, University of Münster, 48149 Münster, Germany H Buerger W Boecker Institute of Clinical Chemistry and Laboratory Medicine, University of Münster H Schmidt A

More information

Deciphering the Clinical Significance of BRCA Variants. A Senior Honors Thesis

Deciphering the Clinical Significance of BRCA Variants. A Senior Honors Thesis Deciphering the Clinical Significance of BRCA Variants A Senior Honors Thesis Presented in Partial Fulfillment of the Requirements for graduation with research distinction in Biology in the undergraduate

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementry Figure S Tissue weights (g).... Liver Hert Brin Pncres Len mss (g) 8 6 -% +% 8 6 Len mss Len mss (g) (% ody weight) Len mss (% ody weight) c Tiilis nterior weight (g).6...... Qudriceps weight

More information

Sequence Variations in the Mu-opioid Receptor Gene (OPRM1) Associated with Human Addiction to Heroin

Sequence Variations in the Mu-opioid Receptor Gene (OPRM1) Associated with Human Addiction to Heroin HUMAN MUTATION Mutation in Brief #497 (2002) Online MUTATION IN BRIEF Sequence Variations in the Mu-opioid Receptor Gene (OPRM1) Associated with Human Addiction to Heroin Jinxiu Shi 1, Lijian Hui 1, Yonghai

More information

SUPPLEMENTARY RESULTS

SUPPLEMENTARY RESULTS SUPPLEMENTARY RESULTS Supplementary Table 1. hfpr1- Flpln-CHO hfpr2-flpln-cho pec 50 E max (%) Log( /K A) Log( /K A) N pec 50 E max (%) Log( /K A) Log( /K A) n ERK1/2 phosphorylation fmlp 9.0±0.6 80±7

More information

Isolation and Genetic Characterization of New Reassortant H3N1 Swine Influenza Virus from Pigs in the Midwestern United States

Isolation and Genetic Characterization of New Reassortant H3N1 Swine Influenza Virus from Pigs in the Midwestern United States JOURNAL OF VIROLOGY, May 2006, p. 5092 5096 Vol. 80, No. 10 0022-538X/06/$08.00 0 doi:10.1128/jvi.80.10.5092 5096.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved. Isolation

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Autonomous Multistep Organic Synthesis in a Single Isothermal Solution Mediated by a DNA Walker Yu He and David R. Liu* Supplementary Methods General Methods. DNA oligonucleotides

More information

Supplementary Figure 1: GPCR profiling and G q signaling in murine brown adipocytes (BA). a, Number of GPCRs with 2-fold lower expression in mature

Supplementary Figure 1: GPCR profiling and G q signaling in murine brown adipocytes (BA). a, Number of GPCRs with 2-fold lower expression in mature Supplementary Figure 1: GPCR profiling and G q signaling in murine brown adipocytes (BA). a, Number of GPCRs with 2-fold lower expression in mature BA vs. preadipocytes. b, Number of GPCRs with 2-fold

More information

Ho Young Jung Hye Seung Han Hyo Bin Kim 1 Seo Young Oh 1 Sun-Joo Lee 2 Wook Youn Kim

Ho Young Jung Hye Seung Han Hyo Bin Kim 1 Seo Young Oh 1 Sun-Joo Lee 2 Wook Youn Kim Journal of Pathology and Translational Medicine 2016; 50: 138-146 ORIGINAL ARTICLE Comparison of Analytical and Clinical Performance of HPV 9G DNA Chip, PANArray HPV Genotyping Chip, and Hybrid-Capture

More information

Citation for published version (APA): Hofstra, R. M. W. (1995). The RET gene and its associated diseases s.n.

Citation for published version (APA): Hofstra, R. M. W. (1995). The RET gene and its associated diseases s.n. University of Groningen The RET gene and its associated diseases Hofstra, Robert Martinus Wouter IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite

More information

Supporting Information

Supporting Information Supporting Information Molecular Recognition Based DNA Nanoassemblies on the Surfaces of Nanosized Exosomes Shuo Wan,, Liqin Zhang,,, Sai Wang, Yuan Liu,, Cuichen Wu, Cheng Cui, Hao Sun, Muling Shi, Ying

More information

University of Texas Southwestern Medical Center at Dallas, Dallas, Texas, USA

University of Texas Southwestern Medical Center at Dallas, Dallas, Texas, USA Primary research Cytokine, activation marker, and chemokine receptor expression by individual CD4 + memory T cells in rheumatoid arthritis synovium Toshihiro Nanki and Peter E Lipsky University of Texas

More information

McAlpine PERK-GSK3 regulates foam cell formation. Supplemental Material. Supplementary Table I. Sequences of real time PCR primers.

McAlpine PERK-GSK3 regulates foam cell formation. Supplemental Material. Supplementary Table I. Sequences of real time PCR primers. Mclpine PERK-GSK3 regulates foam cell formation Supplemental Material Supplementary Table I. Sequences of real time PCR primers. Primer Name Primer Sequences (5-3 ) Product Size (bp) GRP78 (human) Fwd:

More information

mir-1202: A Primate Specific and Brain Enriched mirna Involved in Major Depression and Antidepressant Treatment. Supplementary Information

mir-1202: A Primate Specific and Brain Enriched mirna Involved in Major Depression and Antidepressant Treatment. Supplementary Information Title: mir-1202: A Primate Specific and Brain Enriched mirna Involved in Major Depression and Antidepressant Treatment. Authors: Juan Pablo Lopez 1, Raymond Lim 3, Cristiana Cruceanu 1, Liam Crapper 1,

More information

Supplementary Material Hofko M et al., Detection of carbapenemases by real-time PCR and melt-curve analysis on the BD MAX TM System

Supplementary Material Hofko M et al., Detection of carbapenemases by real-time PCR and melt-curve analysis on the BD MAX TM System Supplementary Material Hofko M et al., Detection of carbapenemases by real-time PCR and melt-curve analysis on the BD MAX TM System Supplementary Material and Methods Characterization of isolates by the

More information

Viral hepatitis, which affects half a billion people

Viral hepatitis, which affects half a billion people GASTROENTEROLOGY 2006;130:435 452 BASIC LIVER, PANCREAS, AND BILIARY TRACT Natural Killer Cells Ameliorate Liver Fibrosis by Killing Activated Stellate Cells in NKG2D-Dependent and Tumor Necrosis Factor

More information

Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis

Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis Supplementary Data Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis Keqiang Chen, Mingyong Liu, Ying Liu, Teizo Yoshimura, Wei Shen, Yingying Le, Scott

More information