IKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1
|
|
- Rosemary Ross
- 5 years ago
- Views:
Transcription
1 Supplemental Figures BLOOD/2014/ IKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1 Hsieh M-Y and Van Etten RA Supplemental Figure S1. Titers of retroviral stocks co-expressing dominant-negative inhibitors of NF-κB signaling. (A) Proviral copy number of genomic DNA from NIH 3T3 cells transduced with the indicated serial dilutions of the different retroviral stocks, assessed by Southern blotting with an ABL1 probe as described in Materials and methods. Con are DNAs from two different Ba/F3 cell clones each carrying a single BCR-ABL1 provirus, while Un is DNA from untransduced cells. (B) Proviral copy number in genomic DNA from primary mouse BM cells transduced with the indicated retroviral stocks at relative dilutions estimated from panel A to match their transduction efficiency.
2 Supplemental Figure S2. No increase in apoptosis in primary BCR-ABL1-transformed B-lymphoid progenitors co-expressing IκBαSR. Primary B-lymphoid cell cultures transformed with BCR-ABL1/GFP (n=3) or BCR-ABL1/IκBαSR (n=1) retrovirus (Figure 1E, F) or with BCR-ABL1/IKKαKM (n=2) retrovirus (Figure 4A) growing on stroma were assessed at 96h for levels of apoptosis using fluorescent SR-VAD- FMK to detect activated capases. The difference in apoptosis levels between BCR-ABL1/GFP transformed and BCR-ABL1/IKKαKM transformed B-lymphoid cells was not significant (t-test).
3 Supplemental Figure S3. Histopathological features of BCR-ABL1-induced B-ALL and CML-like MPN in the retroviral BMT model. (A) Peripheral blood smear from a moue with B-ALL induced by BCR-ABL1 (Wright/Giemsa stain, magnification 1000x). Note the leukocytosis composed of medium-sized lymphoblasts. (B) Histopathology of precursor B-cell acute leukemia/lymphoma induced by BCR-ABL1, involving a cervical lymph node (hematoxylin and eosin stain, magnification 4 00x). Note the monomorphic replacement of the node with medium-sized lymphoblasts with prominent nucleoli and scant cytoplasm. The malignant cells express CD19, CD20, B220, and BP1 by flow cytometric analysis (data not shown). (C) Peripheral blood smear from a mouse with CML-like MPN induced by BCR-ABL1 (Wright/Giemsa stain, magnification 1000x). Note the leukocytosis with maturing myeloid cells of the neutrophil lineage. (D-F) Histopathology (hematoxylin and eosin stains) of CML-like MPN, depicting spleen (D), liver (E) and lungs (F). Note the infiltration of organs with maturing myeloid and erythroid cells, and parenchymal hemorrhages in the lungs (magnification: B and C, 200x; D, 50x).
4 Supplemental Figure S4. Decreased nuclear RelA expression in leukemic cells from mice with B- ALL induced by BCR-ABL1/IκBαSR. (A) Representative confocal immunofluorescence photomicrographs of primary pleural effusion lymphoblasts from mice with B-ALL induced by BCR-ABL1/GFP and BCR- ABL1/IκBαSR retrovirus. Cells were stained with antibody against RelA (Red) and counterstained with Hoechst dye (blue) as described in Methods. Scale bars = 10 µm. (B) Quantification of nuclear RelA fluorescence intensity per cell in the populations shown in panel A, presented as mean fluorescence intensity (MFI) of nuclear RelA staining relative to cells expressing BCR-ABL1/GFP. The difference between BCR-ABL1/GFP- and BCR-ABL1/IκBαSR-expressing leukemic cells was significant (*P < , t-test).
5 Supplemental Figure S5. Co-expression of IκBαSR or kinase-inactive IKK mutants reduces the size of transformed B-lymphoid colonies induced by BCR-ABL1. BM transduced with the indicated virus was plated (2 106 cells/plate) in agarose as described in Materials and methods, and colony formation assessed 14 days later. Depicted are representative photomicrographs of the relative sizes of the colonies (grid size = 2 mm), indicated by red arrowheads.
SUPPLEMENTARY INFORMATION GENOTOXICITY. In vitro Genotoxicity Studies
SUPPLEMENTARY INFORMATION GENOTOXICITY In vitro Genotoxicity Studies The in vitro immortalisation (IVIM) assay relies on the induction of a survival advantage by insertional activation of cellular proto-oncogenes,
More informationSupplementary Figures and Tables
Supplementary Figures and Tables Supplementary Figure S1. CNTRL-FGFR1 fusion kinase induces both T-cell lymphoma and AML. A) Peripheral blood smears from a CNTRL-FGFR1 mouse, showing predominance of immature
More informationThe BCR/ABL fusion oncogene, the product of the
The P190, P210, and P230 Forms of the BCR/ABL Oncogene Induce a Similar Chronic Myeloid Leukemia like Syndrome in Mice but Have Different Lymphoid Leukemogenic Activity By Shaoguang Li,* Robert L. Ilaria,
More informationSupplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
More informationSupplementary Figure 1. Successful excision of genes from WBM lysates and
Supplementary Information: Supplementary Figure 1. Successful excision of genes from WBM lysates and survival of mice with different genotypes. (a) The proper excision of Pten, p110α, p110α and p110δ was
More informationSupplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)
Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number
More informationTITLE: Effects of Hematopoietic Stem Cell Age on CML Disease Progression
AD Award Number: W81XWH-04-1-0795 TITLE: Effects of Hematopoietic Stem Cell Age on CML Disease Progression PRINCIPAL INVESTIGATOR: Kenneth Dorshkind, Ph.D. CONTRACTING ORGANIZATION: University of California,
More informationNature Immunology: doi: /ni eee Supplementary Figure 1
eee Supplementary Figure 1 Hyphae induce NET release, but yeast do not. (a) NET release by human peripheral neutrophils stimulated with a hgc1 yeast-locked C. albicans mutant (yeast) or pre-formed WT C.
More informationSUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.
Supplementary Data SUPPLEMENTARY FIG. S1. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of anpcs. A panel of lineage-specific markers were used
More informationsequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
More informationSupplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
More informationSupporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
More informationSupplementary Information. Supplementary Figure 1
Supplementary Information Supplementary Figure 1 1 Supplementary Figure 1. Functional assay of the hcas9-2a-mcherry construct (a) Gene correction of a mutant EGFP reporter cell line mediated by hcas9 or
More informationDC were seeded into tissue culture dishes in IMDM 2% FCS, and added with PMN. (1:1; PMN: DC) for 16h also in the presence of DNAse (100 U/ml); DC were
Supplementary methods Flow cytometric analysis of DCs. DC were seeded into tissue culture dishes in IMDM 2% FCS, and added with PMN (1:1; PMN: DC) for 16h also in the presence of DNAse (100 U/ml); DC were
More informationactivation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows
Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the
More informationChapter 4 Cellular Oncogenes ~ 4.6 -
Chapter 4 Cellular Oncogenes - 4.2 ~ 4.6 - Many retroviruses carrying oncogenes have been found in chickens and mice However, attempts undertaken during the 1970s to isolate viruses from most types of
More informationSupplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
More informationVETERINARY HEMATOLOGY ATLAS OF COMMON DOMESTIC AND NON-DOMESTIC SPECIES COPYRIGHTED MATERIAL SECOND EDITION
VETERINARY HEMATOLOGY ATLAS OF COMMON DOMESTIC AND NON-DOMESTIC SPECIES SECOND EDITION COPYRIGHTED MATERIAL CHAPTER ONE HEMATOPOIESIS GENERAL FEATURES All blood cells have a finite life span, but in normal
More informationFigure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with
More informationHematopathology Case Study
www.medfusionservices.com Hematopathology Case Study CV3515-14 JUNE Clinical Presentation: Clinical Information: A 42 year old male with history of chronic myelogenous leukemia (CML) presents with an elevated
More informationProblem Set 8 Key 1 of 8
7.06 2003 Problem Set 8 Key 1 of 8 7.06 2003 Problem Set 8 Key 1. As a bright MD/PhD, you are interested in questions about the control of cell number in the body. Recently, you've seen three patients
More informationSUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
More informationCase 3. Ann T. Moriarty,MD
Case 3 Ann T. Moriarty,MD Case 3 59 year old male with asymptomatic cervical lymphadenopathy. These images are from a fine needle biopsy of a left cervical lymph node. Image 1 Papanicolaou Stained smear,100x.
More informationImpaired DNA replication within progenitor cell pools promotes leukemogenesis
Impaired DNA replication within progenitor cell pools promotes leukemogenesis Ganna Bilousova, University of Colorado Andriy Marusyk, University of Colorado Christopher Porter, Emory University Robert
More informationWBCs Disorders 1. Dr. Nabila Hamdi MD, PhD
WBCs Disorders 1 Dr. Nabila Hamdi MD, PhD ILOs Compare and contrast ALL, AML, CLL, CML in terms of age distribution, cytogenetics, morphology, immunophenotyping, laboratory diagnosis clinical features
More informationMyeloproliferative Disorders - D Savage - 9 Jan 2002
Disease Usual phenotype acute leukemia precursor chronic leukemia low grade lymphoma myeloma differentiated Total WBC > 60 leukemoid reaction acute leukemia Blast Pro Myel Meta Band Seg Lymph 0 0 0 2
More informationBone marrow aspiration as the initial diagnostic tool in the diagnosis of leukemia - A case study
Original Research Article Bone marrow aspiration as the initial diagnostic tool in the diagnosis of leukemia - A case study Priyanka Poonam 1*, N.K. Bariar 2 1 Tutor, Department of Pathology, Patna Medical
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Representative images of an in vitro comparison of several AAV serotypes regarding egfp expression in cochlear explants of CBA/CaJ mice. (A-F): Results after incubation at equal
More informationStem cells: units of development and regeneration. Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research.
Stem cells: units of development and regeneration Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research Concepts 1. Embryonic vs. adult stem cells 2. Hematopoietic stem
More informationGenome of Hepatitis B Virus. VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department
Genome of Hepatitis B Virus VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department Proto Oncogen and Oncogen Oncogen Proteins that possess the ability to cause
More informationAcute Lymphoblastic Leukaemia
Acute Lymphoblastic Leukaemia Terri Boyer 17 th October 2006 Overview Disease information: Aetiology of ALL proposed theory, contributing factors Symptoms Complications Diagnostic approaches - morphology
More informationRelative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC
Supplementary Figure 1. SOD1 activity is significantly increased relative to SOD1 levels. SOD1 and SOD2 activities in the infected mork13 cells are shown normalised to their corresponding levels and relative
More informationEffective Targeting of Quiescent Chronic Myelogenous
Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,
More informationHematology Unit Lab 2 Review Material
Objectives Hematology Unit Lab 2 Review Material - 2018 Laboratory Instructors: 1. Assist students during lab session Students: 1. Review the introductory material 2. Study the case histories provided
More informationSUPPLEMENTARY INFORMATION
a. Smo+/+ b. Smo+/+ 5.63 5.48 c. Lin- d. e. 6 5 4 3 Ter119 Mac B T Sca1 Smo+/+ 25 15 2 o BMT 2 1 5 * Supplementary Figure 1: Deletion of Smoothened does not alter the frequency of hematopoietic lineages
More informationDone By : WESSEN ADNAN BUTHAINAH AL-MASAEED
Done By : WESSEN ADNAN BUTHAINAH AL-MASAEED Acute Myeloid Leukemia Firstly we ll start with this introduction then enter the title of the lecture, so be ready and let s begin by the name of Allah : We
More informationADx Bone Marrow Report. Patient Information Referring Physician Specimen Information
ADx Bone Marrow Report Patient Information Referring Physician Specimen Information Patient Name: Specimen: Bone Marrow Site: Left iliac Physician: Accession #: ID#: Reported: 08/19/2014 - CHRONIC MYELOGENOUS
More informationNature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.
Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic
More informationNature Immunology: doi: /ni.3412
Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell
More informationProgrammed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationTbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationDistinct stem cell myeloproliferative/t lymphoma syndromes induced by ZNF198-FGFR1 and BCR-FGFR1 fusion genes from 8p11 translocations
Distinct stem cell myeloproliferative/t lymphoma syndromes induced by ZNF198-FGFR1 and BCR-FGFR1 fusion genes from 8p11 translocations Sergei Roumiantsev, 1,8 Daniela S. Krause, 2,8 Carola A. Neumann,
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationZhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
More informationSupporting Information
Supporting Information Chan et al. 1.173/pnas.9654916 A Patient B Xenograft C * remaining feature of normal lymph node * * * D lymphocytes Infiltrating transitional carcinoma cells E Enlarged axillary
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationSupplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
More information0.0 All T-lymph B-lymph Sarcomas Carcinomas Germ cell. Tumor type
Fig S1 A B Tumors per mouse 1.2 1.0 0.8 0.6 0.4 0.2 0.0 All T-lymph B-lymph Sarcomas Carcinomas Germ cell Tumor type -/- (n = 46) Q/- (n = 76) Q/Q (n = 31) Tumors per mouse 1.2 1.0 0.8 0.6 0.4 0.2 0.0
More informationSUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28
Supp. Fig. 1 a APC b APC ICOS ICOS TCR CD28 mir P TCR CD28 P T cell Tolerance Roquin WT SG Icos mrna T cell Autoimmunity Roquin M199R SG Icos mrna www.nature.com/nature 1 Supp. Fig. 2 CD4 + CD44 low CD4
More informationMolecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML
Molecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML Imran Mirza, MD, MS, FRCPC Pathology & Laboratory Medicine Institute Sheikh Khalifa Medical City, Abu Dhabi, UAE. imirza@skmc.ae
More informationCase #16: Diagnosis. T-Lymphoblastic lymphoma. But wait, there s more... A few weeks later the cytogenetics came back...
Case #16: Diagnosis T-Lymphoblastic lymphoma But wait, there s more... A few weeks later the cytogenetics came back... 46,XY t(8;13)(p12;q12)[12] Image courtesy of Dr. Xinyan Lu Further Studies RT-PCR
More information3/24/2017 DENDRITIC CELL NEOPLASMS: HISTOLOGY, IMMUNOHISTOCHEMISTRY, AND MOLECULAR GENETICS. Disclosure of Relevant Financial Relationships
DENDRITIC CELL NEOPLASMS: HISTOLOGY, IMMUNOHISTOCHEMISTRY, AND MOLECULAR GENETICS Jason L. Hornick, M.D., Ph.D. Director of Surgical Pathology and Immunohistochemistry Brigham and Women s Hospital Professor
More informationMass Histology Service
Mass Histology Service A complete anatomical pathology laboratory www.masshistology.com Telephone: (877) 286-6004 Report on Pathology A Time Course Study of the Local Effects of Intramuscular XXXXXXX Injection
More informationGroup of malignant disorders of the hematopoietic tissues characteristically associated with increased numbers of white cells in the bone marrow and
Group of malignant disorders of the hematopoietic tissues characteristically associated with increased numbers of white cells in the bone marrow and / or peripheral blood Classified based on cell type
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationJuvenile Myelomonocytic Leukemia (JMML)
Juvenile Myelomonocytic Leukemia (JMML) JMML: Definition Monoclonal hematopoietic disorder of childhood characterized by proliferation of the granulocytic and monocytic lineages Erythroid and megakaryocytic
More informationCD4 and CD8 T cells show a similar accumulation in the tumor stroma.
Fig S1 CD4 Fibronectin EpCM CD8 CD4 and CD8 T cells show a similar accumulation in the tumor stroma. Fluorescently-labeled CD4 (CMFD, green) and CD8 (Hoechst, yellow) T cells were added to a human lung
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. MADM labeling of thalamic clones.
Supplementary Figure 1 MADM labeling of thalamic clones. (a) Confocal images of an E12 Nestin-CreERT2;Ai9-tdTomato brain treated with TM at E10 and stained for BLBP (green), a radial glial progenitor-specific
More informationSupplementary Figure 1
Supplementary Figure 1 Dox Cis Cam Pac 0 15 1 15 1 15 1 15 1 15 µmole/l Ub p53 Cytotoxic anticancer agents increase p53 levels but do not generally promote the accumulation of ubiquitinated. Western blots
More informationHematopoiesis. Hematopoiesis. Hematopoiesis
Chapter. Cells and Organs of the Immune System Hematopoiesis Hematopoiesis- formation and development of WBC and RBC bone marrow. Hematopoietic stem cell- give rise to any blood cells (constant number,
More informationHSP90 is a therapeutic target in JAK2- dependent myeloproliferative neoplasms in mice and humans
HSP90 is a therapeutic target in JAK2- dependent myeloproliferative neoplasms in mice and humans Sachie Marubayashi,, Gabriela Chiosis, Ross L. Levine J Clin Invest. 2010;120(10):3578-3593. https://doi.org/10.1172/jci42442.
More informationNature Medicine: doi: /nm.4322
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure
More informationPathology #07. Hussein Al-Sa di. Dr. Sohaib Al-Khatib. Mature B-Cell Neoplasm. 0 P a g e
Pathology #07 Mature B-Cell Neoplasm Hussein Al-Sa di Dr. Sohaib Al-Khatib 0 P a g e Thursday 18/2/2016 Our lecture today (with the next 2 lectures) will be about lymphoid tumors This is a little bit long
More informationSupplementary figure 1. Supplementary Figure 1. Flowchart of experimental procedures of in situ hybridization using ViewRNA technology.
Supplementary figure 1 Supplementary Figure 1. Flowchart of experimental procedures of in situ hybridization using ViewRNA technology. Supplementary figure 2 Supplementary Figure 2. Evidence for existence
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
More informationHematopathology Lab. Third year medical students
Hematopathology Lab Third year medical students Objectives Identify the lesion Know the specific name of the lesion Know associated disease Know relevant pathologic background Spherocytes: appear small,
More informationSupplementary Table 1. Characterization of HNSCC PDX models established at MSKCC
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete
More informationSupplementary Material
Supplementary Material Supplementary Figure 1. NOS2 -/- mice develop an analogous Ghon complex after infection in the ear dermis and show dissemination of Mtb to the lung. (A) WT and NOS2 -/- mice were
More informationMixed Phenotype Acute Leukemias
Mixed Phenotype Acute Leukemias CHEN GAO; AMY M. SANDS; JIANLAN SUN NORTH AMERICAN JOURNAL OF MEDICINE AND SCIENCE APR 2012 VOL 5 NO.2 INTRODUCTION Most cases of acute leukemia can be classified based
More informationMacrophages form functional vascular mimicry channels in vivo. SI Figures and Legend
Macrophages form functional vascular mimicry channels in vivo Authors: *Faith H. Barnett, *Mauricio Rosenfeld, Malcolm Wood, William Kiosses, Yoshihiko Usui, Valentina Marchetti, Edith Aguilar, and Martin
More informationSupplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right
More informationWBCs Disorders. Dr. Nabila Hamdi MD, PhD
WBCs Disorders Dr. Nabila Hamdi MD, PhD ILOs Compare and contrast ALL, AML, CLL, CML in terms of age distribution, cytogenetics, morphology, immunophenotyping, laboratory diagnosis clinical features and
More informationFigure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
More informationProlonged mitotic arrest induces a caspase-dependent DNA damage
SUPPLEMENTARY INFORMATION Prolonged mitotic arrest induces a caspase-dependent DNA damage response at telomeres that determines cell survival Karolina O. Hain, Didier J. Colin, Shubhra Rastogi, Lindsey
More informationONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function.
ONLINE SUPPLEMENT MATERIAL CD7 limits atherosclerosis and promotes macrophage function. Holger Winkels* 1,2, Svenja Meiler* 1,2, Esther Smeets* 2, Dirk Lievens 1, David Engel 3, Charlotte Spitz 1, Christina
More informationNature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
More informationMECHANISMS OF HUMAN DISEASE: LABORATORY SESSIONS LYMPHOMA. April 16, 2008
MECHANISMS OF HUMAN DISEASE: LABORATORY SESSIONS LYMPHOMA April 16, 2008 FACULTY COPY GOAL: Learn the appearance of normal peripheral blood elements and lymph nodes. Recognize abnormal peripheral blood
More informationPresentation material is for education purposes only. All rights reserved URMC Radiology Page 1 of 98
Presentation material is for education purposes only. All rights reserved. 2011 URMC Radiology Page 1 of 98 Radiology / Pathology Conference February 2011 Brooke Koltz, Cytopathology Resident Presentation
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE
More informationSupplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
More informationBy Dr. Mohamed Saad Daoud
By Dr. Mohamed Saad Daoud Part I Introduction Types of White Blood Cells Genesis of the White Blood Cells Life Span of the White Blood Cells Dr. Mohamed Saad Daoud 2 Leucocytes Introduction: Infectious
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Pleiotrophin Regulates the Expansion and Regeneration of Hematopoietic Stem Cells Heather A Himburg 1, Garrett G Muramoto 1 *, Pamela Daher 1*, Sarah K Meadows 1, J. Lauren Russell
More informationSupplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
More informationHematopathology Case Study
Hematopathology Case Study AMP Outreach Course 2009 AMP Annual Meeting John Greg Howe Ph.D. Department of Laboratory Medicine Yale University School of Medicine November 19, 2009 HISTORY Case History An
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
More informationCD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas
a CD4 + T cells recovered in Rag2 / recipient ( 1 5 ) Heart Lung Pancreas.5 1 2 4 6 2 4 6 Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas b Heart Lung Pancreas Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas
More informationHematopoie)c System. Kris)ne Kra2s, M.D.
Hematopoie)c System Kris)ne Kra2s, M.D. Hematopoie)c System Lecture Objec)ves Describe the developmental stages of erythropoiesis. Describe the developmental stages of granulopoiesis. Describe the differences
More informationCarolyn Lutzko, 1,2 * Dinithi Senadheera, 1 Dianne Skelton, 1 Denise Petersen, 1 and Donald B. Kohn 1,2
JOURNAL OF VIROLOGY, July 2003, p. 7341 7351 Vol. 77, No. 13 0022-538X/03/$08.00 0 DOI: 10.1128/JVI.77.13.7341 7351.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved. Lentivirus
More informationSupplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining
More informationA20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis
A20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis Mourad Matmati 1,2 *, Peggy Jacques 3 *, Jonathan Maelfait 1,2, Eveline Verheugen 3, Mirjam Kool
More information4. TEXTBOOK: ABUL K. ABBAS. ANDREW H. LICHTMAN. CELLULAR AND MOLECULAR IMMUNOLOGY. 5 TH EDITION. Chapter 2. pg
LECTURE: 03 Title: CELLS INVOLVED IN THE IMMUNE RESPONSE LEARNING OBJECTIVES: The student should be able to: Identify the organs where the process of the blood formation occurs. Identify the main cell
More informationClassification of Hematologic Malignancies. Patricia Aoun MD MPH
Classification of Hematologic Malignancies Patricia Aoun MD MPH Objectives Know the basic principles of the current classification system for hematopoietic and lymphoid malignancies Understand the differences
More informationPeli1 negatively regulates T-cell activation and prevents autoimmunity
Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang
More informationDifferential diagnosis of hematolymphoid tumors composed of medium-sized cells. Brian Skinnider B.C. Cancer Agency, Vancouver General Hospital
Differential diagnosis of hematolymphoid tumors composed of medium-sized cells Brian Skinnider B.C. Cancer Agency, Vancouver General Hospital Lymphoma classification Lymphoma diagnosis starts with morphologic
More informationRCPA Research Award Final Progress Review
RCPA Research Award 2010-2011 Final Progress Review Name: Dr Craig Wallington-Beddoe Degree/Institution/Year: PhD, The University of Sydney, Year 2 Research Project Title: New Therapeutic Strategies for
More informationJAK2 V617F analysis. Indication: monitoring of therapy
JAK2 V617F analysis BCR-ABL genotyping The exact chromosomal defect in Philadelphia chromosome is a translocation. Parts of two chromosomes, 9 and 22, switch places. The result is a fusion gene, created
More informationSupplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
More information