IKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1

Size: px
Start display at page:

Download "IKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1"

Transcription

1 Supplemental Figures BLOOD/2014/ IKK-dependent activation of NF-κB contributes to myeloid and lymphoid leukemogenesis by BCR-ABL1 Hsieh M-Y and Van Etten RA Supplemental Figure S1. Titers of retroviral stocks co-expressing dominant-negative inhibitors of NF-κB signaling. (A) Proviral copy number of genomic DNA from NIH 3T3 cells transduced with the indicated serial dilutions of the different retroviral stocks, assessed by Southern blotting with an ABL1 probe as described in Materials and methods. Con are DNAs from two different Ba/F3 cell clones each carrying a single BCR-ABL1 provirus, while Un is DNA from untransduced cells. (B) Proviral copy number in genomic DNA from primary mouse BM cells transduced with the indicated retroviral stocks at relative dilutions estimated from panel A to match their transduction efficiency.

2 Supplemental Figure S2. No increase in apoptosis in primary BCR-ABL1-transformed B-lymphoid progenitors co-expressing IκBαSR. Primary B-lymphoid cell cultures transformed with BCR-ABL1/GFP (n=3) or BCR-ABL1/IκBαSR (n=1) retrovirus (Figure 1E, F) or with BCR-ABL1/IKKαKM (n=2) retrovirus (Figure 4A) growing on stroma were assessed at 96h for levels of apoptosis using fluorescent SR-VAD- FMK to detect activated capases. The difference in apoptosis levels between BCR-ABL1/GFP transformed and BCR-ABL1/IKKαKM transformed B-lymphoid cells was not significant (t-test).

3 Supplemental Figure S3. Histopathological features of BCR-ABL1-induced B-ALL and CML-like MPN in the retroviral BMT model. (A) Peripheral blood smear from a moue with B-ALL induced by BCR-ABL1 (Wright/Giemsa stain, magnification 1000x). Note the leukocytosis composed of medium-sized lymphoblasts. (B) Histopathology of precursor B-cell acute leukemia/lymphoma induced by BCR-ABL1, involving a cervical lymph node (hematoxylin and eosin stain, magnification 4 00x). Note the monomorphic replacement of the node with medium-sized lymphoblasts with prominent nucleoli and scant cytoplasm. The malignant cells express CD19, CD20, B220, and BP1 by flow cytometric analysis (data not shown). (C) Peripheral blood smear from a mouse with CML-like MPN induced by BCR-ABL1 (Wright/Giemsa stain, magnification 1000x). Note the leukocytosis with maturing myeloid cells of the neutrophil lineage. (D-F) Histopathology (hematoxylin and eosin stains) of CML-like MPN, depicting spleen (D), liver (E) and lungs (F). Note the infiltration of organs with maturing myeloid and erythroid cells, and parenchymal hemorrhages in the lungs (magnification: B and C, 200x; D, 50x).

4 Supplemental Figure S4. Decreased nuclear RelA expression in leukemic cells from mice with B- ALL induced by BCR-ABL1/IκBαSR. (A) Representative confocal immunofluorescence photomicrographs of primary pleural effusion lymphoblasts from mice with B-ALL induced by BCR-ABL1/GFP and BCR- ABL1/IκBαSR retrovirus. Cells were stained with antibody against RelA (Red) and counterstained with Hoechst dye (blue) as described in Methods. Scale bars = 10 µm. (B) Quantification of nuclear RelA fluorescence intensity per cell in the populations shown in panel A, presented as mean fluorescence intensity (MFI) of nuclear RelA staining relative to cells expressing BCR-ABL1/GFP. The difference between BCR-ABL1/GFP- and BCR-ABL1/IκBαSR-expressing leukemic cells was significant (*P < , t-test).

5 Supplemental Figure S5. Co-expression of IκBαSR or kinase-inactive IKK mutants reduces the size of transformed B-lymphoid colonies induced by BCR-ABL1. BM transduced with the indicated virus was plated (2 106 cells/plate) in agarose as described in Materials and methods, and colony formation assessed 14 days later. Depicted are representative photomicrographs of the relative sizes of the colonies (grid size = 2 mm), indicated by red arrowheads.

SUPPLEMENTARY INFORMATION GENOTOXICITY. In vitro Genotoxicity Studies

SUPPLEMENTARY INFORMATION GENOTOXICITY. In vitro Genotoxicity Studies SUPPLEMENTARY INFORMATION GENOTOXICITY In vitro Genotoxicity Studies The in vitro immortalisation (IVIM) assay relies on the induction of a survival advantage by insertional activation of cellular proto-oncogenes,

More information

Supplementary Figures and Tables

Supplementary Figures and Tables Supplementary Figures and Tables Supplementary Figure S1. CNTRL-FGFR1 fusion kinase induces both T-cell lymphoma and AML. A) Peripheral blood smears from a CNTRL-FGFR1 mouse, showing predominance of immature

More information

The BCR/ABL fusion oncogene, the product of the

The BCR/ABL fusion oncogene, the product of the The P190, P210, and P230 Forms of the BCR/ABL Oncogene Induce a Similar Chronic Myeloid Leukemia like Syndrome in Mice but Have Different Lymphoid Leukemogenic Activity By Shaoguang Li,* Robert L. Ilaria,

More information

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in

More information

Supplementary Figure 1. Successful excision of genes from WBM lysates and

Supplementary Figure 1. Successful excision of genes from WBM lysates and Supplementary Information: Supplementary Figure 1. Successful excision of genes from WBM lysates and survival of mice with different genotypes. (a) The proper excision of Pten, p110α, p110α and p110δ was

More information

Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)

Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g) Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number

More information

TITLE: Effects of Hematopoietic Stem Cell Age on CML Disease Progression

TITLE: Effects of Hematopoietic Stem Cell Age on CML Disease Progression AD Award Number: W81XWH-04-1-0795 TITLE: Effects of Hematopoietic Stem Cell Age on CML Disease Progression PRINCIPAL INVESTIGATOR: Kenneth Dorshkind, Ph.D. CONTRACTING ORGANIZATION: University of California,

More information

Nature Immunology: doi: /ni eee Supplementary Figure 1

Nature Immunology: doi: /ni eee Supplementary Figure 1 eee Supplementary Figure 1 Hyphae induce NET release, but yeast do not. (a) NET release by human peripheral neutrophils stimulated with a hgc1 yeast-locked C. albicans mutant (yeast) or pre-formed WT C.

More information

SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs.

SUPPLEMENTARY FIG. S2. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of dnscs. Supplementary Data SUPPLEMENTARY FIG. S1. Representative counting fields used in quantification of the in vitro neural differentiation of pattern of anpcs. A panel of lineage-specific markers were used

More information

sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5

sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC

More information

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse

Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic

More information

Supporting Information Table of Contents

Supporting Information Table of Contents Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting

More information

Supplementary Information. Supplementary Figure 1

Supplementary Information. Supplementary Figure 1 Supplementary Information Supplementary Figure 1 1 Supplementary Figure 1. Functional assay of the hcas9-2a-mcherry construct (a) Gene correction of a mutant EGFP reporter cell line mediated by hcas9 or

More information

DC were seeded into tissue culture dishes in IMDM 2% FCS, and added with PMN. (1:1; PMN: DC) for 16h also in the presence of DNAse (100 U/ml); DC were

DC were seeded into tissue culture dishes in IMDM 2% FCS, and added with PMN. (1:1; PMN: DC) for 16h also in the presence of DNAse (100 U/ml); DC were Supplementary methods Flow cytometric analysis of DCs. DC were seeded into tissue culture dishes in IMDM 2% FCS, and added with PMN (1:1; PMN: DC) for 16h also in the presence of DNAse (100 U/ml); DC were

More information

activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows

activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the

More information

Chapter 4 Cellular Oncogenes ~ 4.6 -

Chapter 4 Cellular Oncogenes ~ 4.6 - Chapter 4 Cellular Oncogenes - 4.2 ~ 4.6 - Many retroviruses carrying oncogenes have been found in chickens and mice However, attempts undertaken during the 1970s to isolate viruses from most types of

More information

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated

More information

VETERINARY HEMATOLOGY ATLAS OF COMMON DOMESTIC AND NON-DOMESTIC SPECIES COPYRIGHTED MATERIAL SECOND EDITION

VETERINARY HEMATOLOGY ATLAS OF COMMON DOMESTIC AND NON-DOMESTIC SPECIES COPYRIGHTED MATERIAL SECOND EDITION VETERINARY HEMATOLOGY ATLAS OF COMMON DOMESTIC AND NON-DOMESTIC SPECIES SECOND EDITION COPYRIGHTED MATERIAL CHAPTER ONE HEMATOPOIESIS GENERAL FEATURES All blood cells have a finite life span, but in normal

More information

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min

Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with

More information

Hematopathology Case Study

Hematopathology Case Study www.medfusionservices.com Hematopathology Case Study CV3515-14 JUNE Clinical Presentation: Clinical Information: A 42 year old male with history of chronic myelogenous leukemia (CML) presents with an elevated

More information

Problem Set 8 Key 1 of 8

Problem Set 8 Key 1 of 8 7.06 2003 Problem Set 8 Key 1 of 8 7.06 2003 Problem Set 8 Key 1. As a bright MD/PhD, you are interested in questions about the control of cell number in the body. Recently, you've seen three patients

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION 1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,

More information

Case 3. Ann T. Moriarty,MD

Case 3. Ann T. Moriarty,MD Case 3 Ann T. Moriarty,MD Case 3 59 year old male with asymptomatic cervical lymphadenopathy. These images are from a fine needle biopsy of a left cervical lymph node. Image 1 Papanicolaou Stained smear,100x.

More information

Impaired DNA replication within progenitor cell pools promotes leukemogenesis

Impaired DNA replication within progenitor cell pools promotes leukemogenesis Impaired DNA replication within progenitor cell pools promotes leukemogenesis Ganna Bilousova, University of Colorado Andriy Marusyk, University of Colorado Christopher Porter, Emory University Robert

More information

WBCs Disorders 1. Dr. Nabila Hamdi MD, PhD

WBCs Disorders 1. Dr. Nabila Hamdi MD, PhD WBCs Disorders 1 Dr. Nabila Hamdi MD, PhD ILOs Compare and contrast ALL, AML, CLL, CML in terms of age distribution, cytogenetics, morphology, immunophenotyping, laboratory diagnosis clinical features

More information

Myeloproliferative Disorders - D Savage - 9 Jan 2002

Myeloproliferative Disorders - D Savage - 9 Jan 2002 Disease Usual phenotype acute leukemia precursor chronic leukemia low grade lymphoma myeloma differentiated Total WBC > 60 leukemoid reaction acute leukemia Blast Pro Myel Meta Band Seg Lymph 0 0 0 2

More information

Bone marrow aspiration as the initial diagnostic tool in the diagnosis of leukemia - A case study

Bone marrow aspiration as the initial diagnostic tool in the diagnosis of leukemia - A case study Original Research Article Bone marrow aspiration as the initial diagnostic tool in the diagnosis of leukemia - A case study Priyanka Poonam 1*, N.K. Bariar 2 1 Tutor, Department of Pathology, Patna Medical

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Nature Biotechnology: doi: /nbt Supplementary Figure 1 Supplementary Figure 1 Representative images of an in vitro comparison of several AAV serotypes regarding egfp expression in cochlear explants of CBA/CaJ mice. (A-F): Results after incubation at equal

More information

Stem cells: units of development and regeneration. Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research.

Stem cells: units of development and regeneration. Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research. Stem cells: units of development and regeneration Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research Concepts 1. Embryonic vs. adult stem cells 2. Hematopoietic stem

More information

Genome of Hepatitis B Virus. VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department

Genome of Hepatitis B Virus. VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department Genome of Hepatitis B Virus VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department Proto Oncogen and Oncogen Oncogen Proteins that possess the ability to cause

More information

Acute Lymphoblastic Leukaemia

Acute Lymphoblastic Leukaemia Acute Lymphoblastic Leukaemia Terri Boyer 17 th October 2006 Overview Disease information: Aetiology of ALL proposed theory, contributing factors Symptoms Complications Diagnostic approaches - morphology

More information

Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC

Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC Supplementary Figure 1. SOD1 activity is significantly increased relative to SOD1 levels. SOD1 and SOD2 activities in the infected mork13 cells are shown normalised to their corresponding levels and relative

More information

Effective Targeting of Quiescent Chronic Myelogenous

Effective Targeting of Quiescent Chronic Myelogenous Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,

More information

Hematology Unit Lab 2 Review Material

Hematology Unit Lab 2 Review Material Objectives Hematology Unit Lab 2 Review Material - 2018 Laboratory Instructors: 1. Assist students during lab session Students: 1. Review the introductory material 2. Study the case histories provided

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION a. Smo+/+ b. Smo+/+ 5.63 5.48 c. Lin- d. e. 6 5 4 3 Ter119 Mac B T Sca1 Smo+/+ 25 15 2 o BMT 2 1 5 * Supplementary Figure 1: Deletion of Smoothened does not alter the frequency of hematopoietic lineages

More information

Done By : WESSEN ADNAN BUTHAINAH AL-MASAEED

Done By : WESSEN ADNAN BUTHAINAH AL-MASAEED Done By : WESSEN ADNAN BUTHAINAH AL-MASAEED Acute Myeloid Leukemia Firstly we ll start with this introduction then enter the title of the lecture, so be ready and let s begin by the name of Allah : We

More information

ADx Bone Marrow Report. Patient Information Referring Physician Specimen Information

ADx Bone Marrow Report. Patient Information Referring Physician Specimen Information ADx Bone Marrow Report Patient Information Referring Physician Specimen Information Patient Name: Specimen: Bone Marrow Site: Left iliac Physician: Accession #: ID#: Reported: 08/19/2014 - CHRONIC MYELOGENOUS

More information

Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.

Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic

More information

Nature Immunology: doi: /ni.3412

Nature Immunology: doi: /ni.3412 Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell

More information

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

Distinct stem cell myeloproliferative/t lymphoma syndromes induced by ZNF198-FGFR1 and BCR-FGFR1 fusion genes from 8p11 translocations

Distinct stem cell myeloproliferative/t lymphoma syndromes induced by ZNF198-FGFR1 and BCR-FGFR1 fusion genes from 8p11 translocations Distinct stem cell myeloproliferative/t lymphoma syndromes induced by ZNF198-FGFR1 and BCR-FGFR1 fusion genes from 8p11 translocations Sergei Roumiantsev, 1,8 Daniela S. Krause, 2,8 Carola A. Neumann,

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

Zhu et al, page 1. Supplementary Figures

Zhu et al, page 1. Supplementary Figures Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior

More information

Supporting Information

Supporting Information Supporting Information Chan et al. 1.173/pnas.9654916 A Patient B Xenograft C * remaining feature of normal lymph node * * * D lymphocytes Infiltrating transitional carcinoma cells E Enlarged axillary

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent

More information

0.0 All T-lymph B-lymph Sarcomas Carcinomas Germ cell. Tumor type

0.0 All T-lymph B-lymph Sarcomas Carcinomas Germ cell. Tumor type Fig S1 A B Tumors per mouse 1.2 1.0 0.8 0.6 0.4 0.2 0.0 All T-lymph B-lymph Sarcomas Carcinomas Germ cell Tumor type -/- (n = 46) Q/- (n = 76) Q/Q (n = 31) Tumors per mouse 1.2 1.0 0.8 0.6 0.4 0.2 0.0

More information

SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28

SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28 Supp. Fig. 1 a APC b APC ICOS ICOS TCR CD28 mir P TCR CD28 P T cell Tolerance Roquin WT SG Icos mrna T cell Autoimmunity Roquin M199R SG Icos mrna www.nature.com/nature 1 Supp. Fig. 2 CD4 + CD44 low CD4

More information

Molecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML

Molecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML Molecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML Imran Mirza, MD, MS, FRCPC Pathology & Laboratory Medicine Institute Sheikh Khalifa Medical City, Abu Dhabi, UAE. imirza@skmc.ae

More information

Case #16: Diagnosis. T-Lymphoblastic lymphoma. But wait, there s more... A few weeks later the cytogenetics came back...

Case #16: Diagnosis. T-Lymphoblastic lymphoma. But wait, there s more... A few weeks later the cytogenetics came back... Case #16: Diagnosis T-Lymphoblastic lymphoma But wait, there s more... A few weeks later the cytogenetics came back... 46,XY t(8;13)(p12;q12)[12] Image courtesy of Dr. Xinyan Lu Further Studies RT-PCR

More information

3/24/2017 DENDRITIC CELL NEOPLASMS: HISTOLOGY, IMMUNOHISTOCHEMISTRY, AND MOLECULAR GENETICS. Disclosure of Relevant Financial Relationships

3/24/2017 DENDRITIC CELL NEOPLASMS: HISTOLOGY, IMMUNOHISTOCHEMISTRY, AND MOLECULAR GENETICS. Disclosure of Relevant Financial Relationships DENDRITIC CELL NEOPLASMS: HISTOLOGY, IMMUNOHISTOCHEMISTRY, AND MOLECULAR GENETICS Jason L. Hornick, M.D., Ph.D. Director of Surgical Pathology and Immunohistochemistry Brigham and Women s Hospital Professor

More information

Mass Histology Service

Mass Histology Service Mass Histology Service A complete anatomical pathology laboratory www.masshistology.com Telephone: (877) 286-6004 Report on Pathology A Time Course Study of the Local Effects of Intramuscular XXXXXXX Injection

More information

Group of malignant disorders of the hematopoietic tissues characteristically associated with increased numbers of white cells in the bone marrow and

Group of malignant disorders of the hematopoietic tissues characteristically associated with increased numbers of white cells in the bone marrow and Group of malignant disorders of the hematopoietic tissues characteristically associated with increased numbers of white cells in the bone marrow and / or peripheral blood Classified based on cell type

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

Juvenile Myelomonocytic Leukemia (JMML)

Juvenile Myelomonocytic Leukemia (JMML) Juvenile Myelomonocytic Leukemia (JMML) JMML: Definition Monoclonal hematopoietic disorder of childhood characterized by proliferation of the granulocytic and monocytic lineages Erythroid and megakaryocytic

More information

CD4 and CD8 T cells show a similar accumulation in the tumor stroma.

CD4 and CD8 T cells show a similar accumulation in the tumor stroma. Fig S1 CD4 Fibronectin EpCM CD8 CD4 and CD8 T cells show a similar accumulation in the tumor stroma. Fluorescently-labeled CD4 (CMFD, green) and CD8 (Hoechst, yellow) T cells were added to a human lung

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. MADM labeling of thalamic clones.

Nature Neuroscience: doi: /nn Supplementary Figure 1. MADM labeling of thalamic clones. Supplementary Figure 1 MADM labeling of thalamic clones. (a) Confocal images of an E12 Nestin-CreERT2;Ai9-tdTomato brain treated with TM at E10 and stained for BLBP (green), a radial glial progenitor-specific

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Dox Cis Cam Pac 0 15 1 15 1 15 1 15 1 15 µmole/l Ub p53 Cytotoxic anticancer agents increase p53 levels but do not generally promote the accumulation of ubiquitinated. Western blots

More information

Hematopoiesis. Hematopoiesis. Hematopoiesis

Hematopoiesis. Hematopoiesis. Hematopoiesis Chapter. Cells and Organs of the Immune System Hematopoiesis Hematopoiesis- formation and development of WBC and RBC bone marrow. Hematopoietic stem cell- give rise to any blood cells (constant number,

More information

HSP90 is a therapeutic target in JAK2- dependent myeloproliferative neoplasms in mice and humans

HSP90 is a therapeutic target in JAK2- dependent myeloproliferative neoplasms in mice and humans HSP90 is a therapeutic target in JAK2- dependent myeloproliferative neoplasms in mice and humans Sachie Marubayashi,, Gabriela Chiosis, Ross L. Levine J Clin Invest. 2010;120(10):3578-3593. https://doi.org/10.1172/jci42442.

More information

Nature Medicine: doi: /nm.4322

Nature Medicine: doi: /nm.4322 1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure

More information

Pathology #07. Hussein Al-Sa di. Dr. Sohaib Al-Khatib. Mature B-Cell Neoplasm. 0 P a g e

Pathology #07. Hussein Al-Sa di. Dr. Sohaib Al-Khatib. Mature B-Cell Neoplasm. 0 P a g e Pathology #07 Mature B-Cell Neoplasm Hussein Al-Sa di Dr. Sohaib Al-Khatib 0 P a g e Thursday 18/2/2016 Our lecture today (with the next 2 lectures) will be about lymphoid tumors This is a little bit long

More information

Supplementary figure 1. Supplementary Figure 1. Flowchart of experimental procedures of in situ hybridization using ViewRNA technology.

Supplementary figure 1. Supplementary Figure 1. Flowchart of experimental procedures of in situ hybridization using ViewRNA technology. Supplementary figure 1 Supplementary Figure 1. Flowchart of experimental procedures of in situ hybridization using ViewRNA technology. Supplementary figure 2 Supplementary Figure 2. Evidence for existence

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α

More information

Hematopathology Lab. Third year medical students

Hematopathology Lab. Third year medical students Hematopathology Lab Third year medical students Objectives Identify the lesion Know the specific name of the lesion Know associated disease Know relevant pathologic background Spherocytes: appear small,

More information

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete

More information

Supplementary Material

Supplementary Material Supplementary Material Supplementary Figure 1. NOS2 -/- mice develop an analogous Ghon complex after infection in the ear dermis and show dissemination of Mtb to the lung. (A) WT and NOS2 -/- mice were

More information

Mixed Phenotype Acute Leukemias

Mixed Phenotype Acute Leukemias Mixed Phenotype Acute Leukemias CHEN GAO; AMY M. SANDS; JIANLAN SUN NORTH AMERICAN JOURNAL OF MEDICINE AND SCIENCE APR 2012 VOL 5 NO.2 INTRODUCTION Most cases of acute leukemia can be classified based

More information

Macrophages form functional vascular mimicry channels in vivo. SI Figures and Legend

Macrophages form functional vascular mimicry channels in vivo. SI Figures and Legend Macrophages form functional vascular mimicry channels in vivo Authors: *Faith H. Barnett, *Mauricio Rosenfeld, Malcolm Wood, William Kiosses, Yoshihiko Usui, Valentina Marchetti, Edith Aguilar, and Martin

More information

Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in

Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right

More information

WBCs Disorders. Dr. Nabila Hamdi MD, PhD

WBCs Disorders. Dr. Nabila Hamdi MD, PhD WBCs Disorders Dr. Nabila Hamdi MD, PhD ILOs Compare and contrast ALL, AML, CLL, CML in terms of age distribution, cytogenetics, morphology, immunophenotyping, laboratory diagnosis clinical features and

More information

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6. Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,

More information

Prolonged mitotic arrest induces a caspase-dependent DNA damage

Prolonged mitotic arrest induces a caspase-dependent DNA damage SUPPLEMENTARY INFORMATION Prolonged mitotic arrest induces a caspase-dependent DNA damage response at telomeres that determines cell survival Karolina O. Hain, Didier J. Colin, Shubhra Rastogi, Lindsey

More information

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function.

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function. ONLINE SUPPLEMENT MATERIAL CD7 limits atherosclerosis and promotes macrophage function. Holger Winkels* 1,2, Svenja Meiler* 1,2, Esther Smeets* 2, Dirk Lievens 1, David Engel 3, Charlotte Spitz 1, Christina

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence. Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin

More information

MECHANISMS OF HUMAN DISEASE: LABORATORY SESSIONS LYMPHOMA. April 16, 2008

MECHANISMS OF HUMAN DISEASE: LABORATORY SESSIONS LYMPHOMA. April 16, 2008 MECHANISMS OF HUMAN DISEASE: LABORATORY SESSIONS LYMPHOMA April 16, 2008 FACULTY COPY GOAL: Learn the appearance of normal peripheral blood elements and lymph nodes. Recognize abnormal peripheral blood

More information

Presentation material is for education purposes only. All rights reserved URMC Radiology Page 1 of 98

Presentation material is for education purposes only. All rights reserved URMC Radiology Page 1 of 98 Presentation material is for education purposes only. All rights reserved. 2011 URMC Radiology Page 1 of 98 Radiology / Pathology Conference February 2011 Brooke Koltz, Cytopathology Resident Presentation

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

By Dr. Mohamed Saad Daoud

By Dr. Mohamed Saad Daoud By Dr. Mohamed Saad Daoud Part I Introduction Types of White Blood Cells Genesis of the White Blood Cells Life Span of the White Blood Cells Dr. Mohamed Saad Daoud 2 Leucocytes Introduction: Infectious

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Pleiotrophin Regulates the Expansion and Regeneration of Hematopoietic Stem Cells Heather A Himburg 1, Garrett G Muramoto 1 *, Pamela Daher 1*, Sarah K Meadows 1, J. Lauren Russell

More information

Supplemental Table 1. Primer sequences for transcript analysis

Supplemental Table 1. Primer sequences for transcript analysis Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC

More information

Hematopathology Case Study

Hematopathology Case Study Hematopathology Case Study AMP Outreach Course 2009 AMP Annual Meeting John Greg Howe Ph.D. Department of Laboratory Medicine Yale University School of Medicine November 19, 2009 HISTORY Case History An

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells

More information

CD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas

CD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas a CD4 + T cells recovered in Rag2 / recipient ( 1 5 ) Heart Lung Pancreas.5 1 2 4 6 2 4 6 Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas b Heart Lung Pancreas Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas

More information

Hematopoie)c System. Kris)ne Kra2s, M.D.

Hematopoie)c System. Kris)ne Kra2s, M.D. Hematopoie)c System Kris)ne Kra2s, M.D. Hematopoie)c System Lecture Objec)ves Describe the developmental stages of erythropoiesis. Describe the developmental stages of granulopoiesis. Describe the differences

More information

Carolyn Lutzko, 1,2 * Dinithi Senadheera, 1 Dianne Skelton, 1 Denise Petersen, 1 and Donald B. Kohn 1,2

Carolyn Lutzko, 1,2 * Dinithi Senadheera, 1 Dianne Skelton, 1 Denise Petersen, 1 and Donald B. Kohn 1,2 JOURNAL OF VIROLOGY, July 2003, p. 7341 7351 Vol. 77, No. 13 0022-538X/03/$08.00 0 DOI: 10.1128/JVI.77.13.7341 7351.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved. Lentivirus

More information

Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast

Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining

More information

A20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis

A20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis A20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis Mourad Matmati 1,2 *, Peggy Jacques 3 *, Jonathan Maelfait 1,2, Eveline Verheugen 3, Mirjam Kool

More information

4. TEXTBOOK: ABUL K. ABBAS. ANDREW H. LICHTMAN. CELLULAR AND MOLECULAR IMMUNOLOGY. 5 TH EDITION. Chapter 2. pg

4. TEXTBOOK: ABUL K. ABBAS. ANDREW H. LICHTMAN. CELLULAR AND MOLECULAR IMMUNOLOGY. 5 TH EDITION. Chapter 2. pg LECTURE: 03 Title: CELLS INVOLVED IN THE IMMUNE RESPONSE LEARNING OBJECTIVES: The student should be able to: Identify the organs where the process of the blood formation occurs. Identify the main cell

More information

Classification of Hematologic Malignancies. Patricia Aoun MD MPH

Classification of Hematologic Malignancies. Patricia Aoun MD MPH Classification of Hematologic Malignancies Patricia Aoun MD MPH Objectives Know the basic principles of the current classification system for hematopoietic and lymphoid malignancies Understand the differences

More information

Peli1 negatively regulates T-cell activation and prevents autoimmunity

Peli1 negatively regulates T-cell activation and prevents autoimmunity Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang

More information

Differential diagnosis of hematolymphoid tumors composed of medium-sized cells. Brian Skinnider B.C. Cancer Agency, Vancouver General Hospital

Differential diagnosis of hematolymphoid tumors composed of medium-sized cells. Brian Skinnider B.C. Cancer Agency, Vancouver General Hospital Differential diagnosis of hematolymphoid tumors composed of medium-sized cells Brian Skinnider B.C. Cancer Agency, Vancouver General Hospital Lymphoma classification Lymphoma diagnosis starts with morphologic

More information

RCPA Research Award Final Progress Review

RCPA Research Award Final Progress Review RCPA Research Award 2010-2011 Final Progress Review Name: Dr Craig Wallington-Beddoe Degree/Institution/Year: PhD, The University of Sydney, Year 2 Research Project Title: New Therapeutic Strategies for

More information

JAK2 V617F analysis. Indication: monitoring of therapy

JAK2 V617F analysis. Indication: monitoring of therapy JAK2 V617F analysis BCR-ABL genotyping The exact chromosomal defect in Philadelphia chromosome is a translocation. Parts of two chromosomes, 9 and 22, switch places. The result is a fusion gene, created

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information