P323-B1 CDK4-HMGA2-MDM2
|
|
- Rhoda Knight
- 5 years ago
- Views:
Transcription
1 SALSA MLPA probemix P323-B1 CDK4-HMGA2-MDM2 Lot B1-0714, B As compared to previous test version (lot A1-0508), this probemix has been completely redesigned. Probes for HMGA2 and several other genes at 12p and 12q have been included. In addition, the 88 and 96 nt control fragments have been replaced (QDX2). Sarcomas represent a relatively rare group of cancers occurring in different types of tissues, such as fat, bones, muscles, nerves. Alteration of CDK4, MDM2 and HMGA2 genes are suggested to be diagnostically, clinically and prognostically relevant in liposarcoma, osteosarcoma, rhabdomyosarcoma, adenomas/ carcinomas of salivary gland and pituitary adenomas. In well-differentiated (WDLPS) and dedifferentiated (DDLPS) types of liposarcomas, MDM2 and HMGA2 genes are consistently amplified, which can differentiate those from benign lipomas (Italiano A. et al Int J. Cancer). Moreover, DDLPS and WDLPS patients with only MDM2-HMGA2 amplification have a favourable prognosis compared to patients with both HMGA2- MDM2 and CDK4 amplifications (Italiano A. et al. 2009, Clin Cancer Res). In osteosarcoma (OS), MDM2- CDK4 amplification can be used in differential diagnostics, as MDM2-CDK4 amplification seems to be most prevalent in parosteal OS (Mejia-Guerrero S. et al. 2010, Genes Chromosomes Cancer). Amplifications of 12q13-14 region (including CDK4, HMGA2, MDM2, TSPAN31 and GLI1 genes) are common in leiomyosarcoma and alveolar, embryonal and sclerosing rhabdomyosarcoma, and correlate with poor survival in alveolar rhabdomyosarcoma (Barr F. et al. 2009, Genes Chromosomes Cancer). HMGA2 amplifications are characteristic for pituitary adenomas, and especially to prolactiomas (Finelli P. et al. 2002, Cancer Res). HMGA2 amplifications are also observed in adenomas and carcinomas of salivary glands (Persson F. et al. 2009, Genes Chromosomes Cancer). This P323-B1 CDK4-HMGA2-MDM2 probemix contains 34 probes for detecting copy number changes of chromosome 12, including two probes for CDK4, five probes for HMGA2 (one for each exon) and four probes for the MDM2 gene. In addition, 12 reference probes have been included in this probemix, detecting 12 different autosomal chromosomal locations which are relatively stable in sarcomas. However, it should be noticed that tumour karyotypes typically harbour multiple numerical and structural aberrations, which can complicate interpretation of these reference probes. This SALSA probemix is designed to detect copy number changes of one or more sequences in the above mentioned genes and chromosomal regions in a DNA sample. Heterozygous deletions of recognition sequences should give a 35-50% reduced relative peak height of the amplification product of that probe. Note that a mutation or polymorphism in the sequence detected by a probe can also cause a reduction in relative peak height, even when not located exactly on the ligation site! In addition, some probe signals are more sensitive to sample purity and small changes in experimental conditions. Therefore, deletions and duplications detected by MLPA should always be confirmed by other methods. Not all deletions and duplications detected by MLPA will be pathogenic; users should always verify the latest scientific literature when interpreting their findings. We have no information on what percentage of defects in these genes is caused by deletions/duplications of complete exons. Finally, note that most defects in this gene are expected to be small (point) mutations which will not be detected by this SALSA test. SALSA probemixes and reagents are sold by for research purposes and to demonstrate the possibilities of the MLPA technique. They are not CE/FDA certified for use in diagnostic procedures. Purchase of the SALSA test probemixes and reagents includes a limited license to use these products for research purposes. The use of this SALSA probemix and reagents requires a thermocycler with heated lid and sequence type electrophoresis equipment. Different fluorescent PCR primers are available. The MLPA technique has been first described in Nucleic Acid Research 30, e57 (2002). Related SALSA probemixes P419 CDKN2A/2B-CDK4: Contains more probes for CDK4 gene, involved in sarcomas P175 Tumour Gain: Contains two other probes for MDM2 gene, involved in sarcomas References for SALSA P323-B1 CDK4-HMGA2-MDM2 probemix Fusco I et al Variations in the high-mobility group-a2 gene (HMGA2) are associated with idiopathic short stature. Pediatr Res. PMID: [Epub ahead of print] SALSA probemix P323 CDK4-HMGA2-MDM2 Page 1 of 6
2 More information Website : info@mlpa.com (information & technical questions); order@mlpa.com (for orders) Mail : bv; Willem Schoutenstraat 1, 1057 DL Amsterdam, the Netherlands Data analysis The P323-B1 CDK4-HMGA2-MDM2 probemix contains 46 MLPA probes with amplification products between 122 and 456 nt. In addition, it contains 9 control fragments generating an amplification product smaller than 120 nt: four DNA Quantity fragments (Q-fragments) at nt, three DNA Denaturation control fragments (D-fragments) at nt, one X-fragment at 100 nt and one Y-fragment at 105 nt. More information on how to interpret observations on these control fragments can be found in the MLPA protocol. Data generated by this probemix should be normalised with a more robust method, as the target sites of the reference probes maybe gained or lost. (1) Intra-sample normalisation should be performed by dividing the signal of each target-specific probe by the signal of every single reference probe in that sample, thus creating as many ratios per target-specific probe as there are reference probes. Subsequently, the median of all these produced ratios per probe should be taken; this is the probe s Normalisation Constant. (2) Secondly, inter-sample comparison should be performed by dividing the Normalisation Constant of each probe in a given sample by the average Normalisation Constant of that probe in all the reference samples. Data normalisation should be performed within one experiment. Always use sample and reference DNA extracted with the same method and derived from the same source of tissue. Confirmation of deletions, duplications and amplifications can be done by e.g. Southern blotting, long range PCR, qpcr, FISH. Note that Coffalyser, the MLPA analysis tool developed at, can be downloaded free of charge from our website Warning: MLPA analysis on tumour samples provides information on the average situation in the cells from which the DNA sample was purified. Gains or losses of genomic regions or genes may not be detected if the percentage of tumour cells is low. Furthermore, although reference probes are located in silent regions that are not frequently altered in copy number in various sarcoma types, there is always a possibility that one or more reference probes do show a copy number alteration in a sample. Normal copy number variation in healthy individuals is described in the database of genomic variants: When in doubt, users should always verify the latest updates of the database and scientific literature when interpreting their findings. This probemix was developed by H. Yigittop at. In case the results obtained with this probemix lead to a scientific publication, it would be very much appreciated if the probemix designer could be included as co-author. Info/remarks/suggestions for improvement: info@mlpa.com. SALSA probemix P323 CDK4-HMGA2-MDM2 Page 2 of 6
3 Table 1. SALSA MLPA P323-B1 CDK4-HMGA2-MDM2 probemix Length Chromosomal position MV location SALSA MLPA probe (nt) reference 12p 12q (HG18) Q-fragments: DNA quantity; only visible with less than 100 ng sample DNA D-fragments: Low signal of 88 or 96 nt fragment indicates incomplete denaturation 100 X-fragment: Specific for the X chromosome 105 Y-fragment: Specific for the Y chromosome 122 Reference probe L q Reference probe L q MAP3K12 probe L q «CDK4 probe L q HMGA2 probe L q GLI1 probe L q ± TBX5 probe L q Reference probe L q CCND2 probe L p Reference probe L q KRAS probe L p MDM2 probe L q Reference probe L q TSPAN31 probe L q ALX1 probe L q Reference probe L q PIWIL1 probe L q FOXM1 probe L p CHFR probe L q Reference probe L p HNF1A probe L q MDM2 probe L q CDK4 probe L q YEATS4 probe L q HMGA2 probe L q Reference probe L q RAN probe L q IGF1 probe L q CDKN1B probe L p MIR26A2 probe L q DDIT3 probe L q MDM2 probe L q GLI1 probe L q RAN probe L q KIF21A probe L q MDM2 probe L q Reference probe L p Reference probe L p CCND2 probe L p CDK2 probe L q PTPN11 probe L q «HMGA2 probe L q HMGA2 probe L q Reference probe L q HMGA2 probe L q Reference probe L q «This probe is located within, or close to, a very strong CpG island. A low signal of this probe can be due to incomplete sample DNA denaturation, e.g. due to the presence of salt in the sample DNA. ± SNP rs and rs could influence the probe signal. In case of apparent deletions, it is recommended to sequence the region targeted by this probe. The sequence targeted by this reference probe has been reported to be frequently affected by copy number changes in sarcoma samples. Data analysis should be performed with caution for this probe. SALSA probemix P323 CDK4-HMGA2-MDM2 Page 3 of 6
4 Table 2. P323 probes arranged according to chromosomal location Length SALSA MLPA Location/ Partial sequence Distance to Gene /Exon (nt) probe Ligation site (24 nt adjacent to ligation site) next probe Reference probes on chr. 2, 3, 4, 5 and L20366 PAX8 2q13 TTGCAGATGCTA-GGACACAAGAGA L06889 POU1F1 3p11.2 TCCTATACACCA-GCCTCTTCTGGC kb L04688 PROS1 3q11.1 CATTTAAATCCC-CAGCATAAATCA L04183 GNRHR 4q13.2 TGGAACATTACA-GTCCAATGGTAT L13645 IL4 5q31.1 ATCGACACCTAT-TAATGGGTCTCA L04927 RET 10q11.21 CCTGCAACTGCT-TCCCTGAGGAGG 12p chromosomal arm L18686 FOXM1, ex 4 12p13.33 CCATGATACAAT-TCGCCATCAACA kb L02516 CCND2, ex 1 NM_ ; AGACCAGTTTTA-AGGGGAGGACCG 29.9 kb L18979 CCND2, ex 5 NM_ ; TAACAGCCAAGA-AGCCTGCAGGAG kb L18978 CDKN1B, ex 1 12p13.1 CGCGCTCCTAGA-GCTCGGGCCGTG kb L11071 KRAS, ex 2 12p12.1 ATTTTGTGGACG-AATATGATCCAA kb 12q chromosomal arm L18394 KIF21A, ex 38 12q12 AGGCTCGCAATT-TGCAAGATGGTC kb L17994 MAP3K12, ex 2 12q13.13 GCATCCAGAGTT-CGAGCTGACGAG kb L16087 CDK2, ex 1 12q13.2 CATTGTTTCAAG-TTGGCCAAATTG kb L17995 GLI1, ex 4 NM_ ; ACTCGCGATGCA-CATCTCCAGGAG 4.8 kb L18001 GLI1, ex 11 NM_ ; GGACCAGCTACA-TCAACTCCGGCC 47.1 kb L20363 DDIT3, ex 3 12q13.3 CCTCTCACTAGT-GCCAATGATGTG kb L18385 TSPAN31, ex 2 12q14.1 TCCACATCATCG-GCGGAGTCATTG 2.8 kb L18392 CDK4, ex 8 NM_ ; TGCTGACTTTTA-ACCCACACAAGC 2.7 kb L02512 CDK4, ex 3 NM_ ; AACCCTGGTGTT-TGAGCATGTAGA 73.4 kb L20362 MIR26A2, ex 1 12q14.1 AGGCCTCACAGA-TGGAAACAGCCT kb L16821 HMGA2, ex 1 NM_ ; CCGCCTAACATT-TCAAGGGACACA 3.2 kb L16832 HMGA2, ex 2 NM_ ; GACCCAGGGGAA-GACCCAAAGGCA 10.5 kb L16838 HMGA2, ex 3 NM_ ; AGCCACTGGAGA-AAAACGGCCAAG 76.8 kb L16849 HMGA2, ex 4 NM_ ; CCAAGATGTAGT-TTCACTGCTACC 48.0 kb L16847 HMGA2, ex 5 NM_ ; AGTGACCACTTA-TTCTGTATTGCC kb L20364 MDM2, ex 1 NM_ ; CGAGATCCTGCT-GCTTTCGCAGCC 16.1 kb L18786 MDM2, ex 6 NM_ : GTACATCTGTGA-GTGAGAACAGGT 0.2 kb L06791 MDM2, ex 7 NM_ ; GAGAAACCTTCA-TCTTCACATTTG 4.2 kb L18784 MDM2, ex 8 NM_ ; GAAAACGCCACA-AATCTGATAGTA kb L18393 YEATS4, ex 1 12q15 TATGTTCAAGAG-AATGGCCGAATT kb L16627 ALX1, ex 1 12q21.31 GTCTGCAGGCAA-ATGCGTGCAGGC kb L01834 IGF1, ex 2 12q23.2 AGGTAGAAGAGA-TGCGAGGAGGAC kb L13573 PTPN11, ex 1 12q24.13 CAGGAGGAAGCA-AGGATGCTTTGG kb 160 ± L05136 TBX5, ex 8 12q24.21 GTGAGGCAAAAA-GTGGCCTCCAAC kb L18390 HNF1A, ex 9 12q24.31 GCCTCAGTGTCT-GAGGTGAAGACC kb L18685 PIWIL1, ex 21 12q24.33 CAGAGAGCCAAA-TCTGTCACTGTC kb L18397 RAN, ex 3 12q24.33 GTGTTTTTCAAC-AGCTTGTATTGG 1.7 kb L18002 RAN, ex 5 12q24.33 GTACTAATTCCC-ACAAATGTTTCT kb L18389 CHFR, ex 1 12q24.33 GGCGGCGGCGCT-CACCAAGAGCGG Reference probes on chr. 14, 15, 16, 18 and L06628 RPGRIP1 14q11.2 CTACATCAGGAG-ACTTGCCAGTTA L15951 OCA2 15q13.1 GCCGCGATGAGA-CAGAGCATGATG L20365 TGFB1I1 16p11.2 CAGGAACTTAAT-GCCACTCAGTTC L05359 RNMT 18p11.21 TACAATGAACTT-CAGGAAGTTGGT kb L02274 NPC1 18q11.2 GACGAGTCTGTG-GATGAGGTCACA L18386 SDHAF1 19q13.12 AGCGTCTCTGCT-TAGCCGCGGTCA ± SNP rs and rs could influence the probe signal. In case of apparent deletions, it is recommended to sequence the region targeted by this probe. The sequence targeted by this reference probe has been reported to be frequently affected by copy number changes in sarcoma samples. Data analysis should be performed with caution for this probe. SALSA probemix P323 CDK4-HMGA2-MDM2 Page 4 of 6
5 Note: Exon numbering may differ from literature! Complete probe sequences are available on request: Please notify us of any mistakes: SALSA MLPA probemix P323-B1 CDK4-HMGA2-MDM2 sample picture Figure 1. Capillary electrophoresis pattern from a sample of approximately 50 ng human male control DNA analysed with SALSA MLPA probemix P323-B1 CDK4-HMGA2-MDM2 (lot B1-0714). SALSA probemix P323 CDK4-HMGA2-MDM2 Page 5 of 6
6 Implemented Changes compared to the previous product description version(s). Version 07 (T08) 11 December Product description adapted to a new lot (lot number added, small changes in Table 1 and Table 2, new picture included). - Reference added on page 2. - Warning added in Table 1 and 2, 160 nt probe L Warning added in Table 1 and 2 about reference probe at 436 nt (05504-L04927). - Various minor layout changes. - Mapview locations removed from Table 2 and added to Table 1. - Ligation sites and transcript numbers indicated for several probes in Table 2. Version 06 (48) 07 August Electropherogram picture(s) using the old MLPA buffer (replaced in December 2012) removed. Version 05 (48) - Warning added in Table 1, 142 nt probe L02512 and 418 nt probe L Version 04 (48) - Electropherogram pictures using the new MLPA buffer (introduced in December 2012) added. Version 03 (48) - Various minor textual changes on page 1. - Exon numbering of the DDIT3 and MAP3K12 genes have been changed in Table 2. - Small correction of chromosomal locations in Table 1 and 2. Version 02 (46) - Product description adapted to a new product version (version number changed, lot number added, changes in Table 1 and Table 2, new picture included). SALSA probemix P323 CDK4-HMGA2-MDM2 Page 6 of 6
MRC-Holland MLPA. Description version 06; 07 August 2015
SALSA MLPA probemix P323-B1 CDK4-HMGA2-MDM2 Lot B1-0711. As compared to version A1 (test version sent to test labs), this product has been completely redesigned. Probes for HMGA2 and several other genes
More informationMRC-Holland MLPA. Description version 08; 30 March 2015
SALSA MLPA probemix P351-C1 / P352-D1 PKD1-PKD2 P351-C1 lot C1-0914: as compared to the previous version B2 lot B2-0511 one target probe has been removed and three reference probes have been replaced.
More informationSALSA MLPA probemix P169-C2 HIRSCHSPRUNG-1 Lot C As compared to version C1 (lot C1-0612), the length of one probe has been adjusted.
mix P169-C2 HIRSCHSPRUNG-1 Lot C2-0915. As compared to version C1 (lot C1-0612), the length of one has been adjusted. Hirschsprung disease (HSCR), or aganglionic megacolon, is a congenital disorder characterised
More informationSALSA MLPA probemix P315-B1 EGFR
SALSA MLPA probemix P315-B1 EGFR Lot B1-0215 and B1-0112. As compared to the previous A1 version (lot 0208), two mutation-specific probes for the EGFR mutations L858R and T709M as well as one additional
More informationMRC-Holland MLPA. Description version 06; 23 December 2016
SALSA MLPA probemix P417-B2 BAP1 Lot B2-1216. As compared to version B1 (lot B1-0215), two reference probes have been added and two target probes have a minor change in length. The BAP1 (BRCA1 associated
More informationMRC-Holland MLPA. Description version 14; 28 September 2016
SALSA MLPA probemix P279-B3 CACNA1A Lot B3-0816. As compared to version B2 (lot B2-1012), one reference probe has been replaced and the length of several probes has been adjusted. Voltage-dependent calcium
More informationMRC-Holland MLPA. Description version 12; 13 January 2017
SALSA MLPA probemix P219-B3 PAX6 Lot B3-0915: Compared to version B2 (lot B2-1111) two reference probes have been replaced and one additional reference probe has been added. In addition, one flanking probe
More informationSALSA MLPA probemix P241-D2 MODY mix 1 Lot D As compared to version D1 (lot D1-0911), one reference probe has been replaced.
mix P241-D2 MODY mix 1 Lot D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent diabetes
More informationMRC-Holland MLPA. Description version 13;
SALSA MLPA probemix P027-C1 Uveal Melanoma Lot C1-0211: A large number of probes have been replaced by other probes in the same chromosomal regions as compared to previous lots, and several reference probes
More informationSALSA MLPA probemix P241-D2 MODY mix 1 Lot D2-0716, D As compared to version D1 (lot D1-0911), one reference probe has been replaced.
mix P241-D2 MODY mix 1 Lot D2-0716, D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent
More informationMRC-Holland MLPA. Description version 18; 09 September 2015
SALSA MLPA probemix P090-A4 BRCA2 Lot A4-0715, A4-0714, A4-0314, A4-0813, A4-0712: Compared to lot A3-0710, the 88 and 96 nt control fragments have been replaced (QDX2). This product is identical to the
More informationMRC-Holland MLPA. Description version 30; 06 June 2017
SALSA MLPA probemix P081-C1/P082-C1 NF1 P081 Lot C1-0517, C1-0114. As compared to the previous B2 version (lot B2-0813, B2-0912), 11 target probes are replaced or added, and 10 new reference probes are
More informationMRC-Holland MLPA. Description version 29; 31 July 2015
SALSA MLPA probemix P081-C1/P082-C1 NF1 P081 Lot C1-0114. As compared to the previous B2 version (lot 0813 and 0912), 11 target probes are replaced or added, and 10 new reference probes are included. P082
More informationMRC-Holland MLPA. Description version 07; 26 November 2015
SALSA MLPA probemix P266-B1 CLCNKB Lot B1-0415, B1-0911. As compared to version A1 (lot A1-0908), one target probe for CLCNKB (exon 11) has been replaced. In addition, one reference probe has been replaced
More informationMRC-Holland MLPA. Description version 08; 18 November 2016
SALSA MLPA probemix P122-D1 NF1 AREA Lot D1-1016. As compared to lot C2-0312, four probes in the NF1 area and one reference probe have been removed, four reference probes have been replaced and several
More informationMRC-Holland MLPA. Description version 08; 07 May 2015
mix P185-C1 Intersex Lot C1-0611: As compared to the previous version B2 (lot B2-0311), s for CYP21A2 have been removed and s for the CXorf21 gene as well as additional s for NR0B1, NR5A1 and the Y chromosome
More informationMost severely affected will be the probe for exon 15. Please keep an eye on the D-fragments (especially the 96 nt fragment).
SALSA MLPA probemix P343-C3 Autism-1 Lot C3-1016. As compared to version C2 (lot C2-0312) five reference probes have been replaced, one reference probe added and several lengths have been adjusted. Warning:
More informationSALSA MLPA probemix P372-B1 Microdeletion Syndromes 6 Lot B1-1016, B
SALSA MLPA probemix P372-B1 Microdeletion Syndromes 6 Lot B1-1016, B1-0613. The purpose of the P372 probemix is to further investigate results found with the P245 Microdeletion Syndromes-1A probemix. The
More informationNew: P077 BRCA2. This new probemix can be used to confirm results obtained with P045 BRCA2 probemix.
SALSA MLPA KIT P045-B2 BRCA2/CHEK2 Lot 0410, 0609. As compared to version B1, four reference probes have been replaced and extra control fragments at 100 and 105 nt (X/Y specific) have been included. New:
More informationSALSA MLPA probemix P185-C2 Intersex Lot C2-1015: As compared to the previous version C1 (lot C1-0611), the lengths of four probes have been adjusted.
mix P185-C2 Intersex Lot C2-1015: As compared to the previous version C1 (lot C1-0611), the lengths of four s have been adjusted. The sex-determining region on chromosome Y (SRY) is the most important
More informationMRC-Holland MLPA. Description version 19;
SALSA MLPA probemix P6-B2 SMA Lot B2-712, B2-312, B2-111, B2-511: As compared to the previous version B1 (lot B1-11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). SPINAL
More informationSALSA MLPA probemix P371-A1 Microdeletion Syndromes 5 Lot A1-0509
mix P371-A1 Microdeletion Syndromes 5 Lot A1-0509 The purpose of the P371 mix is to further investigate results found with the P245 Microdeletion mix. The P245 mix provides a possibility to screen samples
More informationMRC-Holland MLPA. Related SALSA MLPA probemixes P190 CHEK2: Breast cancer susceptibility, genes included: CHEK2, ATM, PTEN, TP53.
SALSA MLPA probemix P056-C1 TP53 Lot C1-0215 & lot C1-0214. As compared to version B1 (lot B1-1011) most of the reference and flanking probes have been replaced and several have been added. Furthermore,
More informationSALSA MLPA KIT P060-B2 SMA
SALSA MLPA KIT P6-B2 SMA Lot 111, 511: As compared to the previous version B1 (lot 11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). Please note that, in contrast to the
More informationSALSA MLPA KIT P050-B2 CAH
SALSA MLPA KIT P050-B2 CAH Lot 0510, 0909, 0408: Compared to lot 0107, extra control fragments have been added at 88, 96, 100 and 105 nt. The 274 nt probe gives a higher signal in lot 0510 compared to
More informationMRC-Holland MLPA. Description version 29;
SALSA MLPA KIT P003-B1 MLH1/MSH2 Lot 1209, 0109. As compared to the previous lots 0307 and 1006, one MLH1 probe (exon 19) and four MSH2 probes have been replaced. In addition, one extra MSH2 exon 1 probe,
More informationSALSA MLPA Probemix P014-B1 Chromosome 8 Lot B and B
SALSA MLPA Probemix P014-B1 Chromosome 8 Lot B1-0916 and B1-0713. Copy number changes of the human chromosome 8 are common in many types of tumours. In most cases, losses of 8p sequences and gains of 8q
More informationSALSA MLPA KIT P078-B1 Breast Tumour Lot 0210, 0109
SALSA MLPA KIT P078-B1 Breast Tumour Lot 0210, 0109 This P078-B1 Breast Tumour probemix contains probes for several genes (including ERBB2, BIRC5, MYC, TOP2A, ESR1, MTDH, CCND1, CCNE1, EGFR and C11orf30)
More informationSALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A
SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A1-1011. This SALSA MLPA probemix is for basic research and intended for experienced MLPA users only! This probemix enables you to quantify genes
More informationSALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407
SALSA MS-MLPA KIT ME011-A1 Mismatch Repair genes (MMR) Lot 0609, 0408, 0807, 0407 The Mismatch Repair (MMR) system is critical for the maintenance of genomic stability. MMR increases the fidelity of DNA
More informationSALSA MLPA probemix P383-A1 T-ALL Lot A
SALSA MLPA probemix P383-A1 T-ALL Lot A1-0213. T-lineage acute lymphoblastic leukaemia (T-ALL) is a clonal malignant disorder of immature T-cells, which accounts for about 15% of paediatric and 25% of
More informationSALSA MLPA probemix P175-A3 Tumour Gain Lot A3-0714: As compared to the previous version A2 (lot A2-0411), nine probes have a small change in length.
SALSA MLPA probemix P175-A3 Tumour Gain Lot A3-0714: As compared to the previous version A2 (lot A2-0411), nine probes have a small change in length. This SALSA probemix is for basic research only! This
More informationMRC-Holland MLPA. Description version 52; 22 July 2015
SALSA MS-MLPA probemix ME028-B2 Prader-Willi/Angelman Lot B2-0413, lot B2-0811. As compared to version B1 (lot B1-0609), the control fragments have been replaced (QDX2). PRADER-WILLI SYNDROME (PWS) and
More informationPRADER WILLI/ANGELMAN
SALSA MS-MLPA probemix ME028-B2 PRADER WILLI/ANGELMAN Lot B2-0811: As compared to version B1 (lot B1-0609, B1-1108), the 88 and 96 nt control fragments have been replaced (QDX2). PRADER-WILLI SYNDROME
More informationMRC-Holland MLPA. Description version 23; 15 February 2018
SALSA MLPA probemix P225-D2 PTEN Lot D2-0315. As compared to the previous version (lot D1-0613), one probe has a small change in length but no change in the sequence detected. PTEN is a tumour suppressor
More informationMRC-Holland MLPA. Description version 05; 03 April 2019
SALSA MLPA probemix ME012-A1 MGMT-IDH1-IDH2 Lot A1-1215. Glioblastoma, the most common malignant primary brain tumour, is characterised by aggressive behaviour and a poor survival. Hypermethylation in
More informationProduct Description SALSA MLPA Probemix P027-C2 Uveal melanoma To be used with the MLPA General Protocol.
Product Description SALSA Probemix P027-C2 Uveal melanoma To be used with the MLPA General Protocol. Version C2. As compared to version C1, three reference probes have been replaced and the lengths of
More informationMRC-Holland MLPA. Description version 28; 4 January 2018
SALSA MLPA probemix ME011-B3 Mismatch Repair genes Lot B3-1017 and B3-0715. As compared to the previous version B2 (lot B2-0614), one probe has a small change in length but no change in the sequence detected.
More informationMRC-Holland MLPA. Description version 23; 26 January 2017
SALSA MLPA probemix ME024-B2 9p21 CDKN2A/2B region Lot B2-0615. As compared to the previous version B1 (lot B1-0411), one flanking probe is redesigned, two reference probes are replaced, and several probes
More informationProduct Description SALSA MLPA Probemix P055-D1 PAH To be used with the MLPA General Protocol.
Product Description SALSA Probemix P055-D1 PAH To be used with the MLPA General Protocol. Version D1. For complete product history see page 7. Catalogue numbers: P055-025R: SALSA MLPA probemix P055 PAH,
More informationMRC-Holland MLPA. Description version 10; 06 April 2018
Description version ; 6 April 8 mix P36-B Y-Chromosome Microdeletions Lot B-5. As compared to version A (Lot A-), all probes f DPY9L, one probe f RBMYCP and one probe f KDM5D have been removed, and one
More informationProduct Description SALSA MLPA Probemix P138-C1 SLC2A1-STXBP1 To be used with the MLPA General Protocol.
Product Description SALSA Probemix P138-C1 SLC2A1-STXBP1 To be used with the MLPA General Protocol. Version C1. For complete product history see page 7. Catalogue numbers: P138-025R: SALSA MLPA probemix
More informationProduct Description SALSA MLPA probemix P045-C1 BRCA2/CHEK2 To be used with the MLPA General Protocol.
Product Description SALSA probemix P045-C1 BRCA2/CHEK2 To be used with the MLPA General Protocol. Version C1. As compared to version B3, the probes for the BRCA2 upstream region and exons 8, 11, 12, 19
More informationProduct Description SALSA MS-MLPA Probemix ME028-C1 Prader-Willi/Angelman To be used with the MS-MLPA General Protocol.
Product Description SALSA MS- Probemix ME028-C1 Prader-Willi/Angelman To be used with the MS-MLPA General Protocol. Version C1. For complete product history see page 9. Catalogue numbers: ME028-025R: SALSA
More informationMRC-Holland MLPA. Description version 15;
probemix P036-E1 HUMAN TELOMERE-3 Lot E1-0910, E1-1208, E1-0808. As compared to version D2 (lot D2-0408), the probes for 1p and 4q have been replaced. Approximately 3-8% of all cases of mental retardation
More informationSALSA MLPA KIT P036-E1 HUMAN TELOMERE-3 Lot 0808: As compared to the previous version (P036-D2), the probes for 1p and 4q have been replaced.
SALSA MLPA KIT P036-E1 HUMAN TELOMERE-3 Lot 0808: As compared to the previous version (P036-D2), the probes for 1p and 4q have been replaced. MENTAL RETARDATION is caused by aberrant copy numbers of subtelomeric
More informationProduct Description SALSA MS-MLPA Probemix ME011-C1 Mismatch Repair Genes To be used with the MS-MLPA General Protocol.
Product Description SALSA MS- Probemix ME011-C1 Mismatch Repair Genes To be used with the MS-MLPA General Protocol. Version C1. As compared to the previous version (lot B3-1017), this probemix has been
More informationProduct Description SALSA MLPA Probemix P045-C1 BRCA2/CHEK2 To be used with the MLPA General Protocol.
Product Description SALSA Probemix P045-C1 BRCA2/CHEK2 To be used with the MLPA General Protocol. Version C1. As compared to version B3, the probes for the BRCA2 upstream region and exons 8, 11, 12, 19
More informationProduct Description SALSA MLPA Probemix P015-F2 MECP2 To be used with the MLPA General Protocol.
Product Description SALSA Probemix P015-F2 MECP2 To be used with the MLPA General Protocol. Version F2. Compared to version F1, two reference probes have been replaced and the 118 nt Y fragment has been
More informationProduct Description SALSA MLPA probemix P002-D1 BRCA1 To be used with the MLPA General Protocol.
Product Description SALSA probemix P002-D1 BRCA1 To be used with the MLPA General Protocol. Version D1. As compared to version C2, 12 extra BRCA1 probes and 3 probes for exon 24 have been included, and
More informationMolecular Genetics of Paediatric Tumours. Gino Somers MBBS, BMedSci, PhD, FRCPA Pathologist-in-Chief Hospital for Sick Children, Toronto, ON, CANADA
Molecular Genetics of Paediatric Tumours Gino Somers MBBS, BMedSci, PhD, FRCPA Pathologist-in-Chief Hospital for Sick Children, Toronto, ON, CANADA Financial Disclosure NanoString - conference costs for
More informationProduct Description SALSA MLPA Probemix P002-D1 BRCA1 To be used with the MLPA General Protocol.
Product Description SALSA Probemix P002-D1 BRCA1 To be used with the MLPA General Protocol. Version D1. For a complete product history see page 11. Catalogue numbers: P002-025R: SALSA MLPA probemix P002
More informationAbstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
More informationDisclosures. An update on ancillary techniques in the diagnosis of soft tissue tumors. Ancillary techniques. Introduction
Disclosures An update on ancillary techniques in the diagnosis of soft tissue tumors. I have nothing to disclose. Andrew Horvai, MD, PhD Clinical Professor, Pathology Introduction Ancillary techniques
More informationDisclosures. An update on ancillary techniques in the diagnosis of soft tissue tumors. Ancillary techniques. Introduction
Disclosures An update on ancillary techniques in the diagnosis of soft tissue tumors. I have nothing to disclose. Andrew Horvai, MD, PhD Clinical Professor, Pathology Introduction Ancillary techniques
More informationSharan Goobie, MD, MSc, FRCPC
Sharan Goobie, MD, MSc, FRCPC Chromosome testing in 2014 Presenter Disclosure: Sharan Goobie has no potential for conflict of interest with this presentation Objectives Review of standard genetic investigations
More informationMRC-Holland MLPA. Description version 24;
SALSA MLPA KIT P245-A2 Microdeletion Syndromes-1 Lot 0909, 0209, 1008. As compared to lot 1207, two extra control fragments at 100 and 105 nt have been added (X and Y-specific). The 108 nt Y probe has
More informationProduct Description SALSA MLPA Probemix P250-B2 DiGeorge To be used with the MLPA General Protocol.
Product Description SALSA Probemix P250-B2 DiGeorge To be used with the MLPA ral Protocol. Version B2. As compared to version B1, the control fragments have been adjusted. For complete product history
More informationApplication of Whole Genome Microarrays in Cancer: You should be doing this test!!
Application of Whole Genome Microarrays in Cancer: You should be doing this test!! Daynna Wolff, Ph.D. Director, Cytogenetics and Genomics Disclosures Clinical Laboratory Director and Employee, Medical
More informationCertificate of Analysis
COA Version 01; Issued on 30 June 2017 (v02) Certificate of Analysis SALSA probemix P064 Microdeletion Syndromes-1B Catalogue # Product name P064-025R, P064-50R, P064-100R Probemix P064 Microdeletion Syndromes-1B
More informationSupplemental Data: Detailed Characteristics of Patients with MKRN3. Patient 1 was born after an uneventful pregnancy. She presented in our
1 2 Supplemental Data: Detailed Characteristics of Patients with MKRN3 Mutations 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Patient 1 was born after an uneventful pregnancy. She presented
More informationDystrophin Is a Tumor Suppressor in Human Cancers with Myogenic Programs
SUPPLEMENTARY INFORMATION Dystrophin Is a Tumor Suppressor in Human Cancers with Myogenic Programs Yuexiang Wang 1, Adrian Marino-Enriquez 1, Richard R. Bennett 2, Meijun Zhu 1, Yiping Shen 3,4, Grant
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationFinancial disclosures
An update on immunohistochemical markers in mesenchymal neoplasms By Konstantinos Linos MD, FCAP, FASDP Assistant Professor of Pathology Geisel School of Medicine at Dartmouth Dartmouth-Hitchcock Medical
More informationSNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.
SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: LOSS,
More informationProduct Description SALSA MLPA Probemix P064-C2 Microdeletion Syndromes-1B To be used with the MLPA General Protocol.
Product Description SALSA Probemix P064-C2 Microdeletion Syndromes-1B To be used with the MLPA General Protocol. Version C2. Small change in sequence of two probes. For complete product history see page
More informationCorporate Medical Policy
Corporate Medical Policy Invasive Prenatal (Fetal) Diagnostic Testing File Name: Origination: Last CAP Review: Next CAP Review: Last Review: invasive_prenatal_(fetal)_diagnostic_testing 12/2014 3/2018
More informationChallenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014
Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical
More informationCytogenetics 101: Clinical Research and Molecular Genetic Technologies
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these
More informationUpdate On Lipomatous Tumors: Old Standbys and New Concepts
Update On Lipomatous Tumors: Old Standbys and New Concepts John R. Goldblum, M.D. Chairman, Department of Anatomic Pathology Cleveland Clinic Professor of Pathology Cleveland Clinic Lerner College of Medicine
More informationGlobal variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
More informationKarl Kashofer, Phd Institut für Pathologie Medizinische Universität Graz
Expanding on WHO guideline compliant molecular testing of central nervous system tumors by low density whole genome sequencing. Karl Kashofer, Phd Institut für Pathologie Medizinische Universität Graz
More informationThis is DUE: Come prepared to share your findings with your group.
Biology 160 Reading Guide 10: Population Dynamics, HIV NAME: This is DUE: Come prepared to share your findings with your group. *As before, please turn in only the Critical Thinking questions on a separate
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationClinical Validation of Cytocell Pathology Probes
Clinical Validation of Cytocell Pathology Probes Shivanand Richardson Specialized Technician Molecular Pathology Department of Pathology, University Medical Center Utrecht The Netherlands 5th annual Cytocell
More informationMutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
More informationPathology of Sarcoma ELEANOR CHEN, MD, PHD, ASSISTANT PROFESSOR DEPARTMENT OF PATHOLOGY UNIVERSITY OF WASHINGTON
Pathology of Sarcoma ELEANOR CHEN, MD, PHD, ASSISTANT PROFESSOR DEPARTMENT OF PATHOLOGY UNIVERSITY OF WASHINGTON Presentation outline Background and epidemiology of sarcomas Sarcoma classification Sarcoma
More informationFluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS
APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor
More informationGenomic analysis of childhood High grade glial (HGG) brain tumors
Genomic analysis of childhood High grade glial (HGG) brain tumors Linda D Cooley Children s Mercy, Kansas City The Children s Mercy Hospital, 2017 Genomic analysis of childhood High grade glial (HGG) brain
More informationLa chemioterapia neoadiuvante nei sarcomi: novità e attuali indicazioni Lorenzo D Ambrosio, MD PhD Divisione di Oncologia Medica Istituto di Candiolo
La chemioterapia neoadiuvante nei sarcomi: novità e attuali indicazioni Lorenzo D Ambrosio, MD PhD Divisione di Oncologia Medica Istituto di Candiolo Fondazione del Piemonte per l Oncologia. IRCCS 12 CONGRESSO
More informationNucleic Acid Testing - Oncology. Molecular Diagnosis. Gain/Loss of Nucleic Acid. Objectives. MYCN and Neuroblastoma. Molecular Diagnosis
Nucleic Acid Testing - Oncology Molecular Diagnosis Nucleic acid based testing in Oncology Gross alterations in DNA content of tumors (ploidy) Gain/Loss of nucleic acids Markers of Clonality Oncogene/Tumor
More informationMolecular Diagnosis. Nucleic acid based testing in Oncology
Molecular Diagnosis Nucleic acid based testing in Oncology Objectives Describe uses of NAT in Oncology Diagnosis, Prediction, monitoring. Genetics Screening, presymptomatic testing, diagnostic testing,
More informationPredictive biomarker profiling of > 1,900 sarcomas: Identification of potential novel treatment modalities
Predictive biomarker profiling of > 1,900 sarcomas: Identification of potential novel treatment modalities Sujana Movva 1, Wenhsiang Wen 2, Wangjuh Chen 2, Sherri Z. Millis 2, Margaret von Mehren 1, Zoran
More informationTable S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3.
Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3. MN1 (Accession No. NM_002430) MN1-1514F 5 -GGCTGTCATGCCCTATTGAT Exon 1 MN1-1882R 5 -CTGGTGGGGATGATGACTTC Exon
More informationClinical Interpretation of Cancer Genomes
IGENZ Ltd, Auckland, New Zealand Clinical Interpretation of Cancer Genomes Dr Amanda Dixon-McIver www.igenz.co.nz 1992 Slovenia and Croatia gain independence USA and Russia declare the Cold War over Steffi
More informationReporting TP53 gene analysis results in CLL
Reporting TP53 gene analysis results in CLL Mutations in TP53 - From discovery to clinical practice in CLL Discovery Validation Clinical practice Variant diversity *Leroy at al, Cancer Research Review
More informationCharacterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
More informationElucigene Male Factor Infertility Products Guide to Interpretation
Elucigene Male Factor Infertility Products Guide to Interpretation Manufactured by: Elucigene Diagnostics Citylabs Nelson Street Manchester M13 9NQ For Sales, Customer Service and Technical Support:- T:
More information5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff
5 th July 2016 ACGS Dr Michelle Wood Laboratory Genetics, Cardiff National molecular screening of patients with lung cancer for a national trial of multiple novel agents. 2000 NSCLC patients/year (late
More informationSNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.
SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: GAIN,
More informationNext Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters
Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters XXXth International Symposium on Technical Innovations in Laboratory Hematology Honolulu, Hawaii
More informationAuthor's response to reviews
Author's response to reviews Title: Dystonia, facial dysmorphism, intellectual disability and breast cancer associated with a chromosome 13q34 duplication and overexpression of TFDP1: Case report Authors:
More informationEpigenetics and Chromatin Remodeling
Epigenetics and Chromatin Remodeling Bradford Coffee, PhD, FACMG Emory University Atlanta, GA Speaker Disclosure Information Grant/Research Support: none Salary/Consultant Fees: none Board/Committee/Advisory
More informationDetection of copy number variations in PCR-enriched targeted sequencing data
Detection of copy number variations in PCR-enriched targeted sequencing data German Demidov Parseq Lab, Saint-Petersburg University of Russian Academy of Sciences, current: Center for Genomic Regulation
More informationFor in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection.
For in vitro Veterinary Diagnostics only. Kylt Rotavirus A Real-Time RT-PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Rotavirus A Real-Time RT-PCR Detection A. General Kylt Rotavirus A products are
More informationMEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)
Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)
More informationCHROMOSOMAL MICROARRAY (CGH+SNP)
Chromosome imbalances are a significant cause of developmental delay, mental retardation, autism spectrum disorders, dysmorphic features and/or birth defects. The imbalance of genetic material may be due
More informationBWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space
Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate
More informationApproach to Mental Retardation and Developmental Delay. SR Ghaffari MSc MD PhD
Approach to Mental Retardation and Developmental Delay SR Ghaffari MSc MD PhD Introduction Objectives Definition of MR and DD Classification Epidemiology (prevalence, recurrence risk, ) Etiology Importance
More informationLab Activity 36. Principles of Heredity. Portland Community College BI 233
Lab Activity 36 Principles of Heredity Portland Community College BI 233 Terminology of Chromosomes Homologous chromosomes: A pair, of which you get one from mom, and one from dad. Example: the pair of
More information