Supplementary Materials for
|
|
- Egbert Caldwell
- 5 years ago
- Views:
Transcription
1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic, Xiaochun Li, James L. Paltridge, Suraya Roslan, David Herrmann, James R. W. Conway, Freya K. Gehling, Andrew G. Bert, Lesley A. Crocker, Anna Tsykin, Gelareh Farshid, Gregory J. Goodall, Paul Timpson, Roger J. Daly, Yeesim Khew-Goodall* The PDF file includes: *Corresponding author. Published 17 February 2015, Sci. Signal. 8, ra18 (2015) DOI: /scisignal Fig. S1. knockdown promotes invasiveness in MDA-MB-231 cells. Fig. S2. promotes the secretion of TGFβ in human breast cancer cell lines. Fig. S3. Relative cytokine abundance in conditioned media from breast cancer cells after overexpression or knockdown. Fig. S4. Relative abundance of cytokine mrna transcripts in breast cancer cells after overexpression or knockdown. Fig. S5. Schematic of the injection protocol used to test the effect of conditioned medium on the growth and metastasis of breast cancer cells in mice. Fig. S6. Identification of substrates by differential phosphoproteomics. Fig. S7. Total protein abundance of candidate substrates is unaffected by knockdown. Fig. S8. Western blot analyses to ascertain overexpression or knockdown efficiencies. Fig. S9. Correlation between technical replicate SILAC-MS experiments. Table S1. List of candidate (Pez) substrates from SILAC-MS screen. References (53 62)
2 Supplementary Materials. A B 231- Invasion Proliferation 231-sh Number of invaded cells *** sh Proliferative index [%] Cells within matrix sh Proliferative index [%] Cells on top of matrix *** sh Figure S1: knockdown promotes invasiveness in MDA-MB-231 cells. The invasive capacity of control MDA-MB-231 cells (231-) and knockdown cells (231-sh) was assessed by 3-D organotypic collagen I invasion assays. (A) Representative images of H&E stained sections from invasion assays after 12 days of invasion. Scale bars, 100 µm. Quantification of invasion (A), and proliferation (B) as measured by Ki67 staining of cells within or on top of the matrix. Data are means ± SEM from 3 independent experiments. **p<0.01, Student s t-test.
3 MDA-MB-468 MDA-MB-231 TGF-beta1 (pg/ml) TGF-beta1 (pg/ml) Figure S2: promotes the secretion of TGFβ in human breast cancer cell lines. Total TGFβ1 abundance in conditioned media from 468-EV, 468- (n=3 clones each), 231- and 231- sh clones (n=4 clones each) measured using a TGFβ1 ELISA. *p<0.05, two-tailed t-test.
4 Figure S3: Relative cytokine abundance in conditioned media from breast cancer cells after overexpression or knockdown. Quantitation of raw data (total pixels) from chemiluminenscent detection of array membranes for cytokine content in MDA-MB-468 CM pooled from 3 clones (top panel) and MDA-MB-231 CM pooled from 4 clones (bottom panel). Each symbol represents a duplicate spot on the array.
5 Relative mrna MDA-MB-468 p=0.02 * EV 0 6 MDA-MB-231 sh Relative mrna 4 2 p=0.009 ** p=0.01 * 0 Figure S4: Relative abundance of cytokine mrna transcripts in breast cancer cells after overexpression or knockdown. The abundance of mrna transcripts that encode cytokines displaying altered presence in conditioned medium upon overexpression or knockdown was quantified in 468-EV (n=3 clones), 468- (n=3 clones), 231-NC (n=4 clones) and 231-sh (n=4 clones) by quantitative RT-PCR, and normalized to β-actin internal control. P values were derived using a twotailed t-test.
6 Daily IP injections of CM for 3 days (pre-conditioning) Implant cells into MFP of both sets of mice cells Continued daily IP injections of CM for 30 days sh CM CM sh Figure S5: Schematic of the injection protocol used to test the effect of conditioned medium on the growth and metastasis of breast cancer cells in mice. MFP, mammary fat pads; IP, intraperitoneal; CM, conditioned medium;, control shrna-transfected cell cultures; sh, - targeted shrna-transfected cell cultures.
7 A actin B sh cells cells Figure S6. Identification of substrates by differential phosphoproteomics. (A) Representative Western blotting analysis for and Actin in MDA-MB-231 cells stably expressing a shrna (sh) or non-targeting shrna (). (B) Workflow for SILAC-MS phosphoproteomics to identify proteins that are differentially tyrosine phosphorylated when is reduced.
8 INPPL1 IRS1 actin RIN1 EEF1A1 actin TYK2 actin Figure S7: Total protein abundance of candidate substrates is unaffected by knockdown. Representative Western blotting analysis of 231- and 231-sh cell lysates for a selection of candidate substrates identified in the SILAC-MS screen.
9 A RIN1 actin GFP IRS1 B RIN1 PRKCD C D RIN1 RIN1 Figure S8: Western blot analyses to ascertain overexpression or knockdown efficiencies. (A) Western blotting in lysates from MDA-MB-468 cells transfected with the indicated plasmids. Unlabeled lane is an irrelevant sample. (B) Western blot analysis of lysates from primary human lymphatic endothelial cells transfected with the indicated sirnas. (C and D) Western blotting analysis of lysates from transfected BT549 cells. Blots are representative of 3 experiments.
10 Experiment 1 sh(h):(l) Technical Replicates A/B Experiment 2 sh(l):(h) (Inverse) Technical Replicates A/B A A B A B B SILAC Ratio (B) SILAC Ratio (B) PY100 IP SILAC Ratio SILAC Ratio (A) C A B A B D SILAC Ratio (B) SILAC Ratio (B) PY20 IP SILAC Ratio SILAC Ratio (A) E SILAC Ratios (Exp 2) SILAC Ratios (Exp
11 Figure S9. Correlation between technical replicate SILAC-MS experiments. Venn diagrams indicating degree of overlap for high confidence phospho-peptides from technical replicates from Experiments 1 and 2 for py100 (A) and py20 IPs (C). Correlation coefficients (R2) for phosphotyrosine peptide SILAC ratios from technical replicates from Experiments 1 and 2 for py100 (B) and py20 IPs (D). (E) Correlation between biological replicate SILAC-MS experiments for peptides displaying at least +/-1.2- fold change in both experiments. The correlation coefficient (R2) and p values were obtained by linear regression analysis (GraphPad Prism).
12 Candidate UniProt Modified Fold change Name Substrate ID site Exp 1 Exp 2 Role of phosphorylation at identified tyrosine residue >1.2-fold (Exp 1&2) MK01 P28482 Mitogen-activated protein kinase 1 (ERK2) Tyr Activation of kinase activity 53 DYRK1A Q13627 Dual specificity tyrosine-phosphorylation-regulated kinase 1A Tyr Non-nuclear localisation 54 RIN1 Q13671 Ras and Rab interactor 1 Tyr Abl kinase activation / EGFR stabilisation 55 MK03 P27361 Mitogen-activated protein kinase 3 (ERK1) Tyr Activation of kinase activity 53 EF1A1 P68104 Elongation factor 1-alpha 1 Tyr Unknown P85B O00459 Phosphatidylinositol 3-kinase regulatory subunit beta Tyr Unknown PRP4B Q13523 Serine/threonine-protein kinase PRP4 homolog Tyr Unknown >1.2-fold (Exp 1) KPCD Q05655 Protein kinase C delta type Tyr <1.2 Unknown ACK1 Q07912 Activated CDC42 kinase 1 Tyr <1.2 Associated with clathrin-coated pit formation 56 CALM P62158 Calmodulin Tyr <1.2 Enhanced interaction with binding partners 57 SHB Q15464 SH2 domain-containing adapter protein B Tyr <1.2 Unknown SHB Q15464 SH2 domain-containing adapter protein B Tyr <1.2 Unknown TYK2 P29597 Non-receptor tyrosine-protein kinase TYK2 Tyr <1.2 Unknown DYRK1A Q13627 Dual specificity tyrosine-phosphorylation-regulated kinase 1A Tyr <1.2 Activation of kinase activity 58
13 GSK3A P49840 Glycogen synthase kinase-3 alpha Tyr <1.2 Activation of kinase activity 59 >1.2-fold (Exp 2) SHIP2 O15357 Phosphatidylinositol-3,4,5-trisphosphate 5-phosphatase 2 Tyr 986 < Activation of phosphatase activity / ubiquitination 60,61 IRS1 P35568 Insulin receptor substrate 1 Tyr 662 < Interaction with p85 subunit of PI3K 62 Table S1: List of candidate (Pez) substrates from the SILAC-MS screen. List of proteins and tyrosine residues for which an increase in tyrosine phosphorylation was detected in cells hypomorphic for Pez in one or both replicate experiments, implicating them as candidate Pez substrates. Reported roles for tyrosine phosphorylation at these specific residues are also indicated.
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
More informationRAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
More informationNature Structural & Molecular Biology: doi: /nsmb.3218
Supplementary Figure 1 Endogenous EGFR trafficking and responses depend on biased ligands. (a) Lysates from HeLa cells stimulated for 2 min. with increasing concentration of ligands were immunoblotted
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/318/ra29/dc1 Supplementary Materials for Antagonism of EGFR and HER3 Enhances the Response to Inhibitors of the PI3K-Akt Pathway in Triple-Negative Breast Cancer
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationSupplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/271/ra25/dc1 Supplementary Materials for Phosphoproteomic Analysis Implicates the mtorc2-foxo1 Axis in VEGF Signaling and Feedback Activation of Receptor Tyrosine
More informationsupplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
More informationSupplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.
Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationSUPPLEMENTARY FIG. S5. ROS regulated the signaling responses of A. gambiae 4a3B cells to human insulin. (A) 4a3B cells were stimulated with 6000
Supplementary Data SUPPLEMENTARY FIG. S1. Exogenous H 2 O 2 induced rapid activation of ERK in Anopheles stephensi cells. ASE cells were treated with PBS or with 500 mmh 2 O 2 for 5, 30, 60, and 180 min.
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationSupplementary Materials
Supplementary Materials Supplementary Figure S1 Regulation of Ubl4A stability by its assembly partner A, The translation rate of Ubl4A is not affected in the absence of Bag6. Control, Bag6 and Ubl4A CRISPR
More informationCell Signaling part 2
15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/305/ra106/dc1 Supplementary Materials for Controlling Long-Term Signaling: Receptor Dynamics Determine Attenuation and Refractory Behavior of the TGF-β Pathway
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer
More informationPart-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death
Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated
More informationm 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
More informationSupplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase
Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez
More informationLoss of RhoA promotes skin tumor formation. Supplementary Figure 1. Loss of RhoA does not impair F-actin organization.
Supplementary Figure Legends Supplementary Figure 1. Loss of RhoA does not impair F-actin organization. a. Representative IF images of F-actin staining of big and small control (left) and RhoA ko tumors
More informationIntracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationSupplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
More informationA Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationS1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±
More informationSUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationIntegrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao
More informationANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/322/ra38/dc1 Supplementary Materials for Dynamic Reprogramming of Signaling Upon Met Inhibition Reveals a Mechanism of Drug Resistance in Gastric Cancer Andrea
More informationSupplemental Table I
Supplemental Table I Cortex Hippocampus Age (weeks) Genotype STE 61 pste 61 STE 61 pste 61 8 100.0 ± 4.4 96.2 ± 6.0 99.8 ± 8.7 167.5 ± 7.8* 100.0 ± 7.0 90.5 ± 13.8 100.0 ± 12.8 260.4 ± 33.9** 12 100.0
More informationSupplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-
Supplementary Table S1. Tumor samples used for analysis Sample# Age Tumor size (cm) pn- Stage Stage BNG (grade) ERα PR HER2 (FISH) Triple negative T1 46 3 N1a III 2 Pos Neg N T2 58 1 N(i-) I 3 Pos Neg
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/4/199/ra75/dc1 Supplementary Materials for Signaling by the Matrix Proteoglycan Decorin Controls Inflammation and Cancer Through PDCD4 and MicroRNA-21 Rosetta
More informationPKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65
SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer
More informationW/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +
F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
More informationCells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
More informationReceptor mediated Signal Transduction
Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
More informationG-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D
G-Protein Signaling Introduction to intracellular signaling Dr. SARRAY Sameh, Ph.D Cell signaling Cells communicate via extracellular signaling molecules (Hormones, growth factors and neurotransmitters
More informationSupplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationsupplementary information
DOI: 10.1038/ncb2133 Figure S1 Actomyosin organisation in human squamous cell carcinoma. (a) Three examples of actomyosin organisation around the edges of squamous cell carcinoma biopsies are shown. Myosin
More informationSupplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationSupplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time
More informationType of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
More information4.2 RESULTS AND DISCUSSION
phosphorylated proteins on treatment with Erlotinib.This chapter describes the finding of the SILAC experiment. 4.2 RESULTS AND DISCUSSION This is the first global report of its kind using dual strategies
More informationSupplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid
More informationSupplemental information
Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental
More informationSupplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
More informationSupplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration
Supplementary Materials for c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration Saurav Brahmachari, Preston Ge, Su Hyun Lee, Donghoon Kim, Senthilkumar S. Karuppagounder, Manoj
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11700 Figure 1: RIP3 as a potential Sirt2 interacting protein. Transfected Flag-tagged Sirt2 was immunoprecipitated from cells and eluted from the Sepharose beads using Flag peptide.
More informationInhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of
SUPPLEMENTAL DATA Inhibition of TGFβ enhances chemotherapy action against triple negative breast cancer by abrogation of cancer stem cells and interleukin-8 Neil E. Bhola 1, Justin M. Balko 1, Teresa C.
More informationSupplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists
Supplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists of: (i) the YPet domain (an enhanced YFP); (ii) the
More informationSoft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
More informationSupplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors
Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA
More informationSupplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
More informationSupplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
More informationDepartment of Chemistry, Université de Montréal, C.P. 6128, Succursale centre-ville, Montréal, Québec, H3C 3J7, Canada.
Phosphoproteome dynamics of Saccharomyces cerevisiae under heat shock and cold stress Evgeny Kanshin 1,5, Peter Kubiniok 1,2,5, Yogitha Thattikota 1,3, Damien D Amours 1,3 and Pierre Thibault 1,2,4 * 1
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
More informationSupplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/398/rs12/dc1 Supplementary Materials for Quantitative phosphoproteomics reveals new roles for the protein phosphatase PP6 in mitotic cells Scott F. Rusin, Kate
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/385/ra70/dc1 Supplementary Materials for The interaction of heparan sulfate proteoglycans with endothelial transglutaminase-2 limits VEGF 165 -induced angiogenesis
More informationEGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/381/ra59/dc1 Supplementary Materials for Analysis of single-cell cytokine secretion reveals a role for paracrine signaling in coordinating macrophage responses
More informationFGL2 A new biomarker for cancer in a simple blood test
FGL2 A new biomarker for cancer in a simple blood test WHO IS FGL2 Human gene (chromosome 7) is 7 kb long, 2 exons, monomer protein 70 KD, tetramer in solution. Fibrinogen-like protein 2 (Fgl2), a member
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationNegative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α
Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Mahnaz Janghorban, PhD Dr. Rosalie Sears lab 2/8/2015 Zanjan University Content 1. Background (keywords: c-myc, PP2A,
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
More informationT H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Díaz et al., http://www.jcb.org/cgi/content/full/jcb.201209151/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Hypoxia induces invadopodia formation in different epithelial
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/278/rs11/dc1 Supplementary Materials for In Vivo Phosphoproteomics Analysis Reveals the Cardiac Targets of β-adrenergic Receptor Signaling Alicia Lundby,* Martin
More informationp = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationSupplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-08-1-0367 TITLE: Regulatory role of the NF-kB pathway in lymphangiogenesis and breast cancer mestatasis PRINCIPAL INVESTIGATOR: Michael Flister CONTRACTING ORGANIZATION: Southern
More informationSupporting Information
Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification
More informationNature Immunology: doi: /ni Supplementary Figure 1. IC261 inhibits a virus-induced type I interferon response.
Supplementary Figure 1 IC261 inhibits a virus-induced type I interferon response. (a) HEK293T cells were cultured in 384 wells and transiently transfected with 50 ng of the IFN-β promoter-luc construct
More informationTrim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).
Supplementary Figure 1 Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). (b) Immunoblot analysis of TRIM29 in lung primary
More informationSupplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
More informationhexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
More informationSupplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
More informationSupplementary Information
Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1
More information