EurocanPlatform 1 st annual meeting WP5: Targeting the DNA damage response

Transcription

1 EurocanPlatform 1 st annual meeting WP5: Targeting the DNA damage response Brussels, December 16, 2011 Alan Ashworth, ICR London Jos Jonkers, NKI Amsterdam Jiri Bartek, DCS Copenhagen

2 WP5 Objectives Validated diagnostic tests for homologous recombination defects and PTEN deficiency Novel targets for therapy in Triple Negative breast cancer

3 Triple-Negative Breast Cancer (TNBC) BRCA1-mutated BC (2-4%) TNBC (15% in Caucasian) (39% in Afr-Am) BRCA1-like BC (10-20%?) TNBCs have poor prognosis and rapid relapse TNBCs cannot be treated with endocrine agents or HER2 targeted therapy because they are negative for ER, PR and ERBB2 BRCA1-deficient BCs can be treated with DNA-damaging agents or PARPi

4 Mouse models of human cancer Genetically engineered mouse models (GEMMs) Human tumor xenograft models (xenopatients) Additional mutations Tumors 1 st Intervention Relapses 2 nd Intervention Cross-resistance? Mechanisms? Resistance

5 GEMMs for BRCA1-mutated breast cancer K14cre;p53 F/F tissue specific loss of p53 K14cre;Brca1 F/F ;p53 F/F tissue specific loss of p53 + Brca % tumor free T 50 = 290 days T 50 = 210 days Liu et al., PNAS 2007

6 GEMMs for BRCA1-mutated breast cancer K14cre;p53 F/F tissue specific loss of p53 K14cre;Brca1 F/F ;p53 F/F tissue specific loss of p53 + Brca1 p53 / (BRCA proficient) Brca1 / ;p53 / (BRCA1 null) Liu et al., PNAS 2007

7 BRCA1-deficient mouse mammary tumors resemble human BRCA1-associated breast cancer Solid carcinoma (IDC nos) High grade (III) Undifferentiated Pushing margins Triple negative (ER ;PR ;HER2 ) Genomic instability Solid carcinoma Adenomyoepithelioma 91% IDCIII Carcinosarcoma (EMT tumor) Liu et al., PNAS 2007

8 Therapy response and resistance in the BRCA1-null mammary tumor model BRCA1 null tumors relative tumor size control untreated cisplatin T1 cisplatin Time (days) T1 T2 T3 T4 T5 T6 T7 T2 T3 T4 T5 T6 T7 Rottenberg et al., PNAS 2007

9 Therapy response and resistance in the BRCA1-null mammary tumor model BRCA1 null tumors relative tumor size control untreated cisplatin T1 cisplatin T1 T2 T3 T4 T5 T6 T7 T2 T3 T4 T5 T6 T7 PARPi olaparib 700 T2 T3 600 T4 500 T5 400 T6 300 T Rottenberg et al., PNAS 2008 Time (days) T1

10 Novel BRCA1 mammary tumor models for therapy response and resistance K14cre; Brca1 F/F ; p53 F/F Genetic reversion Pgp activation Other

11 Novel BRCA1 mammary tumor models for therapy response and resistance C61G BRCA1 C61G K14cre; Brca1 F/F ; p53 F/F K14cre; Brca1 C61G/F ; p53 F/F Genetic reversion * Pgp activation Other

12 BRCA1-C61G tumors show poor response to PARPi BRCA1-C61G C61G No interaction with BARD1 BRCA proficient BRCA1 C61G BRCA1 null Drost et al., Cancer Cell 2011

13 BRCA1-C61G tumors show poor response to cisplatin BRCA1-C61G C61G No interaction with BARD1 BRCA proficient BRCA1 C61G BRCA1 null Drost et al., Cancer Cell 2011

14 Hypomorphic activity of BRCA1-C61G BRCA proficient BRCA1 C61G Rel % cells with >10 foci BRCA1 null BRCA proficient BRCA1 C61G BRCA1 null Drost et al., Cancer Cell 2011

15 Novel BRCA1 mammary tumor models for therapy response and resistance Mdr1 / BRCA1 C61G K14cre; Brca1 F/F ; p53 F/F ; Mdr1 / K14cre; Brca1 F/F ; p53 F/F K14cre; Brca1 Tr/F ; p53 F/F Genetic reversion Pgp activation X * Other

16 Acquired resistance to PARPi in the Pgp-deficient BRCA1 mammary tumor model Brca1 -/- ;p53 -/- Brca1 -/- ;p53 -/- ;Mdr1 -/- relative tumor size PARPi olaparib T1 T2 T3 T4 T5 T6 T Time (days) PARPi olaparib T1 T2 T3 T4 T5 T6 T7 T8 T9 PAR (pg/10mg protein) UD UD UD UD UD UD UD UD UD UD Sens Res Sens Res Sens Res T1 T3 T4 Control PARPi 30 min PARPi 7 days Jaspers et al., in prep.

17 Somatic 53BP1 mutations in PARPi-resistant tumors Tumor 3: 1bp insertion in exon 12 Tumor 5: duplication of 53BP1 exons sensitive resistant untreated Tumor 1 Tumor 3 Tumor 5 Jaspers et al., in prep. PARPi resistant

18 Loss of 53BP1 correlates with partial restoration of RAD51 foci formation IR BRCA proficient BRCA1 null control BRCA1 null PARPi resistant Jaspers et al., in prep.

19 Low 53BP1 expression is associated with triple-negative and BRCA1/2-mutated breast cancer Features Normal 53BP1 (%) Aberrant 53BP1(%) p * Not Triple-negative 861 (87.0) 14 (50.0) Triple-negative 129 (13.0) 14 (50.0) Non-BRCA1/ (94.0) 29 (76.3) BRCA1/2 69 (6.0) 9 (23.7) Bouwman et al., Nat Struct Mol Biol 2010

20 Screen for compounds with selective toxicity against BRCA2-deficient cells 97 of 1280 LOPAC compounds gave IC50s 5 compounds gave selective toxicity in BRCA2-deficient cells 2.5 Co-Correlation plot Increasing selective toxicity BRCA2+ vs Correlation: Chlorambucil Nimustine Melphalan Carboplatin BRCA Evers et al., Clin Cancer Res KP 3 33 KB2P 1 21 BRCA2+ vs. BRCA2-

21 In vivo validation in the BRCA1-null model BRCA proficient tumors BRCA1 null tumors Rottenberg et al., in prep.

22 Eradication of advanced BRCA1-like breast cancer by high-dose cross-linking chemotherapy >4 LN+ Standard: 5*FEC High dose: 4*FEC + 1*CTC TN tumors with sporadic like CGH profile TN tumors with BRCA1 like CGH profile high dose standard Vollebergh et al., Ann Oncol. 2010

23 Dose matters! Nimustine responses in the BRCA1 null mammary tumor model Time to relapse (%) mg/kg 22.5 mg/kg 15 mg/kg 7.5 mg/kg Latency (days) Rottenberg et al., in prep.

24 Studying epigenetic resistance mechanisms in primary breast cancer xenograft models Fresh tumor piece In vivo propagation Interventions Compare outgrowth to primary tumor: Histology, gene expression, acgh, BRCA1 status ter Brugge et al., in prep.

25 TNBC tumorgrafts with (epi)genetic BRCA1 loss T127 T162 T241 T250 BRCA1 status + Protein expression Promoter methylation yes yes no no Mutation no no no yes ter Brugge et al., in prep.

26 BRCA1-deficient TNBCs acquire resistance to PARPi ter Brugge et al., in prep.

27 Detection of RAD51 foci in FFPE sections T127 untreated T127 cis1 T127 cis2 Courtesy Nick Barker, ICR London ter Brugge et al., in prep.

28 BRCA1-2329delC TNBC xenografts acquire resistance via genetic reversion Wild type T250 T250 res1 T250 res2 * * * Wild-type T250 T250-res1 T250-res2 ACACTTTAACTGTTTCTAGTTTCTCTTCTTTTTCTTCTCTTGGAAGG ACACTTTAACT.TTTCTAGTTTCTCTTCTTTTTCTTCTCTTGGAAGG (1bp del) ACACTTTAACT.TTTCTAGTTTCTCTTCTT...GGAAGG (12bp del) ACACTTT...TTCTTCTCTTGGAAGG (24bp del)

29 TNBCs with BRCA1 methylation may acquire resistance via BRCA1 re-expression Loss of BRCA1 promoter methylation Retention of BRCA1 promoter methylation Only half of the therapy resistant tumors with BRCA1 re expression show loss of BRCA1 promoter methylation! ter Brugge et al., in prep.

30 De novo gene fusions drive BRCA1 re-expression in therapy-resistant T127 TNBC xenografts A functional role for chromotrypsis in therapy resistance? ter Brugge et al., in prep.

31 Partnerships foster translational research Clinic Lab Mouse clinic Diagnostics Treatment Diagnostics Treatment Follow up Follow up Pharma

32 Conclusions BRCA1 null mouse mammary tumors Tumors PARPi Tumors cisplatin Tumors nimustine Relapses PARPi Relapses cisplatin Cure Resistance

33 Conclusions : BRCA1/2 deficient PARPi sensitive : BRCA1/2 proficient PARPi resistant P gp activity? Type of BRCA1 mutation? 53BP1 loss? Genetic reversion? BRCA1 promoter methylation? Other factors? PARPi sensitive? PARPi resistant?

34 Acknowledgements Jos Jonkers Peter Bouwman Ute Boon Tanya Braumuller Karin de Visser Rinske Drost Janneke Jaspers Linda Henneman Sjors Kas Christiaan Klijn Sjoerd Klarenbeek Ewa Michalak Mark Pieterse Eva Schut-Kregel Petra Ter Brugge Eline Van der Burg Hanneke vd Gulden Marieke van de Ven Ellen Wientjens Sabine Linn Marieke Vollebergh Alumni Bastiaan Evers Henne Holstege Xiaoling Liu Piet Borst Sven Rottenberg Ariena Kersbergen Jelle Wesseling Petra Kristel AstraZeneca Marc O Connor Collaborators Alan Ashworth Nick Barker Jiri Bartek Jo Morris Shridar Ganesan Madalena Tarsounas