Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)

Transcription

1 Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d b-actin ** ** siegfp si - si 5 b Predictive binding region in : 1,228 1,232aa (-KAVSF-) HA-ERa + + FLAG- WT D - - FLAG FLAG- IgG HEK293T cells KPL-3C cells FLAG- FLAG- - siegfp si si c HEK293T cells ** DNA (mg) FLAG- mock D - FLAG () FLAG () e treatment time (h) KPL-3C cells ** ** ** treatment time (h) : 24 h - f Western blotting ChIP assay MCF-7 KPL-3C tamoxifen ERAP b-actin 5-726/-74 - Input ERa IgG 5 -ERE gttcaaggccacctggccaacat tamoxifen ERAP MCF KPL-3C empty 5 -ERE PPP1CA -

2 activity (pmole/min) Binding Binding PKA activity (RLU) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 g h Position Sequence QLLYLECILSVLSSSSSSMHL VARTIYYIAAELVRLVGSVDS ELSQGKGLSEGQVQLLLLRLE GNERSLDISISVTTDTGQTTL SGSSAAKVVLTLSTQADRLFE VSQKAVSFIHDILTEVLTDWN GLIEVWIILLEQLTAAVSNCP PSSM Score b-actin 5 i ** 1 mm H nm IPs NS H IPs j 3,, 2,5, 2,, 1,5, 1,, 5, 1 mm H nm IPs ** IPs k Target site Score T S35.79 S S9.83 S S (Analysis by NetPhos 3.1) l m FLAG- FLAG--transfected HEK293T * NS * - siegfp sipka 1 nm (min) ps35-.7 ps n S35-Peptide (DHGRGSGCSCTAPALSGPVAR) + recombinant PKA for 3 min at 3 C Score Sequence GSGCSCTAPALSGPVAR GSGCSCTAPALSGPVAR Modification - 2S: Phospho 4C: Carboxymethyl 6C: Propionamide S128-Peptide (RCWSLVAPH) + recombinant PKA for 3 min at 3 C Score Sequence CWSLVAPH CWSLVAPH Modification - 1C: Propionamide 3S: Phospho Supplementary Figure 1 regulated activity through its phosphorylation by PKA. (a) Expression patterns of and in breast cancer cell lines. b-actin served as a quantitative internal control. (b) Identification of the predictive binding region in. The indicated FLAG-tagged constructs (WT; full-length, D; deleting -binding region, 1,228-KAVSF-1,232) and HA-tagged ERa construct transfected-hek293t cells were immunoprecipitated using an anti-flag antibody. (c) The inhibitory effects of overexpression on phosphatase activity of -immunoprecipitates in FLAG-tagged or D construct-transfected HEK293T cells using pnpp as a substrate. These data represent the means ± s.e.m. of three independent experiments. (d) Effects of si and si on phosphatase activity of immunoprecipitates using pnpp as a substrate in MCF-7 and KPL3C cells. These data represent the means ± s.e.m. of three independent experiments. (e) Phosphatase activity of after stimulation in MCF-7 (left) and KPL-3C (right) cells. These data represent the means ± s.e.m. of three independent experiments. (f) Positive

3 feedback regulation of PPP1CA transactivation. Left, Effects of tamoxifen on PPP1CA expression. For immunoblot analysis (upper), b-actin served as a loading control. For real-time PCR analysis (lower), the data are expressed as the fold-increase over untreated cells (set at 1.). These data represent the mean ± s.e.m. of three independent experiments. Right, ChIP assays of the transactivation of PPP1CA through an ERE motif in 5 upstream (upper), and luciferase assays of the transactivation of PPP1CA using a luciferase reporter containing an ERE motif conserved within 5 upstream of the PPP1CA gene (lower). The data represent the mean ± s.e.m. of three independent experiments. (g) The predicted PKA binding regions in, as determined using Hou et al. 24 and the PSIVER software. The bold letters indicate the potential PKA binding regions in. (h) Expression patterns of PKA protein in breast cancer cell lines. (i) Statistical analysis of PKA and binding to (right) and PKA (left) immunoprecipitates, respectively. These data are expressed as the fold-increase over untreated cells (set at 1.), and represent the mean ± s.e.m. of three independent experiments. (j) Statistical analysis of in vitro PKA activity of and PKA immunoprecipitates. These data represent the mean ± s.e.m. of three independent experiments. (k) The predicted phosphorylation sites of by PKA, as determined using NetPhos 3.1 software. (l) Phosphatase activity of in a pseudo-phosphorylation mutant of (S35E and S128E) and alanine mutant of (S35A and S128A). (m) The inhibitory effects of sipka on phosphorylation. Representative results are shown from one of two experiments. (n) 2DICAL analysis of engineered peptides representing S35 and S128 on with recombinant PKA (recpka). **P<.1, P<.1 (two-sided Student s t-test)

4 a c 1 nm 1 mm ERAP pser- ERa Nucleus of ERa for 24 hr + ERAP l-ppase + + ERAP b 1 h 3 h 6 h 12 h 18 h 24 h ERAP pser- ps39- ps39- ps39-5 mm d HEK293T cells Myc- FLAG-ERa HA- WT S39A Cyto Nuc Cyto Nuc mm ERAP FLAG IgG 5 FLAG-ERa HA- FLAG-ERa HA- FLAG-ERa ps39- HA- tubulin lamin Supplementary Figure 2 is phosphorylated at S39 via PKCa. (a) Serine phosphorylation of in ERa immunoprecipitates of the nuclear fraction of after ± ERAP treatment for 24 h. (b) Time course of serine phosphorylation of in after ± ERAP treatment for the indicated time. (c) Representative immunofluorescence images of phosphorylation at S39; (green), phosphorylated S39 (red). (d) The subcellular localization of phosphorylation at S39 in the presence of in the cytoplasmic (Cyto) and nuclear (Nuc) fractions of the indicated (WT, S39A) and ERa construct-transfected HEK293T cells. a/b-tubulin (tublin) and laminin B (lamin) were used as loading controls for the cytoplasmic and nuclear fractions, respectively.

5 Free phosphate released from phospho- (A 62 ) Free phosphate released from phospho- (A 62 ) a siegfp sipka si -immunoprecipitates : 24 h - siegfp sipka si b ps35- ps128- HA-ERa + + FLAG- WT D - - HEK293T cells FLAG- ps39- FLAG- c / inhibitor (-) 5 (mm) 1 nm -immunoprecipitates (-) 1 nm / inhibitor 5 (mm) ps ps128- d (-) 1 nm H-89 okadaic ps35- ps128- ps39- e Phospho- Phospho- peptide + Phospho- YGVRESVFTVE Supplementary Figure 3 Phosphatase activity of - regulates phosphorylation. (a) Phosphatase activity (left) and Western blot analyses (right) of immunoprecipitates of - and PKA-depleted against phospho-s39 peptide. Phosphatase activity was measured using malachite green. These data represent the means ± s.e.m. of three independent experiments. (b) The inhibitory effect of on S39 phosphorylation. The indicated

6 FLAG-tagged (WT, D) and HA-tagged ERa-transfected HEK293T cells, followed by immunoprecipitation with an anti- antibody. (c) The inhibitory effect of - binding inhibitor on phosphatase activity. were treated with - binding inhibitor for 24 h in the presence of and were immunoprecipitated using antibody. (d) The effects of PKA inhibitor H-89 and inhibitor okadaic acid on phosphorylation (S35 and S128) and phosphorylation (S39). were treated with H-89 or okadaic acid for 24 h in the presence of and were immunoprecipitated using or antibody. (e) Q-TOF spectra indicating dephosphorylation of phospho--peptide by in positive ion mode. The dephosphorylation of peptide is exemplarily shown for m/z Upper, the left spectrum is an untreated control, and the right spectrum was acquired after dephosphorylation with. Lower, product ion spectrum of the peptide YGVRESVFTVE, with a precursor mass of m/z P<.1 (two-sided Student s t-test).

7 % Phosphorylation of Relative expression a b c MCF-7 KPL-3C ZR--1 PKCa PKCe CAMK2 1 nm 1 mm ERAP ps39- siegfp sipka peptide + PKCa Phospho- d e recombinant PKCa (ng) mg nm mm ERAP ps39- ps39- PKCa ps39- PKCa YGVREpSVFTVE ps39- IPs recombinant (ng) (pmole) P f % De-phosphorylation IB : PKA depletion PKCa depeltion P PKA S39 PKCa P PKA P S39 P PKCa Supplementary Figure 4 PKCa is confirmed to be responsible kinase for S39 phosphorylation. (a) Expression patterns of PKCa, PKCe, and CAMK2 in ERa-positive breast cancer cell lines (MCF-7, KPL-3C and ZR--1) using real-time PCR. (b) The inhibitory effects of sipka on phosphorylation at S39 in after ± ERAP treatment for 24 h. (c) Q-TOF spectra of direct peptide phosphorylation by PKCa in positive ion mode. The phosphorylation of peptide is exemplarily shown for m/z Upper, the left spectrum is an untreated control, and the right spectrum was acquired after phosphorylation with PKCa. Lower, product ion spectrum of the phosphor-s39 peptide YGVRE(pS)VFTVE, with a precursor mass of m/z (d) Statistical analysis of the ratio of phosphorylation at S39 in full-length by PKCa. These data are expressed as the percentage of phosphorylated band in total band and represent the mean ± s.e.m. of four independent experiments. (e) Dephosphorylation of phosphorylation at S39 immunoprecipitated by phospho-specific (S39) antibody from treated with /ERAP for 24 h. (f) Schematic illustration of -PKA- tricomplex under the depletion of PKA (left) and PKCa (right).

8 Cumulative survival Cumulative survival Intensity Cumulative survival a P <.1 n = 73 mrna 2 15 Low (47) 5 Normal Tumour Log Rank =.1 High (26) Disease-free survival (year) b protein Score (1) Score 1+ (24) c Cytoplasmic phospho- Presence (48) Score 2+ (32) Absence (34) Log Rank : P <.1 Score 3+ (16) Log Rank =.9 Disease-free survival (year) Disease-free survival (year) Supplementary Figure 5 overexpression was predictive of worse outcomes in ERa-positive breast cancer. (a) mrna expression of in patients with ERa-positive breast cancer (left) and Kaplan-Meier curves of overall survival as a function of expression (right) based on the TCGA data set. (b, c) Kaplan-Meier analysis of survival associated with protein (b) and cytoplasmic phosphorylation at S39 (c) in representative ERa-positive breast cancer specimens.

9 Uncropped images of Figure 1a Uncropped images of Figure 1b 15 IP IgG KPL-3C cells IP IgG KPL-3C cells : IP sirna Control sirna Control Uncropped images of Figure 1c 15 IP PKA catalytic IgG KPL-3C cells IP PKA catalytic IgG PKA catalytic PKA catalytic Uncropped images of Figure 1d 15 5 siegfp sipka siegfp sipka siegfp - - pser sipka siegfp sipka - - pthr siegfp sipka - - KPL-3C cells siegfp sipka - - pser- pthr- Uncropped images of Figure 1f FLAG WT - FLAG T162A S39A S689A S9A S128A S1763A WT T162A S39A S689A S9A S128A S1763A Continued on the following page

10 Uncropped images of Figure 1g IP: Time (h) nm IP: Time (h) nm IP: IP: IgG ps35- ps128- Uncropped images of Figure 2b Uncropped images of Figure 2c 15 siegfp si Cyto Nunc Cyto Nunc HA-Ab HA- - WT S39A - WT S39A lamin tubulin Phospho- (Ser39) HA-Ab 5 ps39- Uncropped images of Figure 2d IP: IGF-1Rb FLAG Myc-ERa HA- WT S39A WT S39A 1 nm mm ERAP HEK293T cells WT S39A IGF-1Rb FLAG- Myc-ERa HA- P-IGF-1Rb (Y1135/Y1136) ps IGF-1Rb FLAG- Myc-ERa HA- Continued on the following page

11 Uncropped images of Figure 2e FLAG- 15 HEK293T cells FLAG Mock WT S35A S128A FLAG- FLAG- 15 HEK293T cells FLAG Mock WT S35A S128A FLAG ps35-15 ps128- Uncropped images of Figure 2f 15 siegfp sipka si siegfp sipka si siegfp sipka si siegfp sipka si ps35- ps ps39- siegfp sipka si siegfp sipka si Uncropped images of Figure 3a 1 nm 1 mm ERAP siegfp sipkca siegfp sipkca Cytoplasm Nucleus siegfp sipkca siegfp sipkca PKCa ERAP Cytoplasm 5 ps39- PKCa 5 lamin tubulin Nucleus 5 Continued on the following page

12 Uncropped images of Figure 3c : PKCa.1 mg recombinant PKCa (ng) P IB : IB : ps39- Uncropped images of Figure 3d Phospho recombinant (ng) P IB : IB : ps39- Uncropped images of Figure 3e 6 h IP: siegfp sipka sipkca siegfp sipka sipkca 1 nm h IP: siegfp sipka sipkca siegfp sipka sipkca 1 nm ERa ERa 5 5 PKCa PKCa 5 5 ps39- ps39- Continued on the following page

13 MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 Uncropped images of Figure 3e 24 h IP: siegfp sipka sipkca siegfp sipka sipkca 1 nm h IP: siegfp sipka sipkca siegfp sipka sipkca PKCa 5 5 ps39- ERa 5 Uncropped images of Supplementary Figure 1a Uncropped images of Supplementary Figure 1b 15 FLAG IgG HA-ERa FLAG- WT D WT D WT D FLAG b-actin 5 Uncropped images of Supplementary Figure 1c HEK293T cells FLAG- mock D - mock D - DNA (mg) FLAG- 5 Uncropped images of Supplementary Figure 1d 15 - si si - si si KPL-3C cells siegfp si si siegfp si si Continued on the following page

14 MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 Uncropped images of Supplementary Figure 1f MCF-7 tamoxifen ERAP KPL-3C MCF KPL-3C b-actin Short exposure Long exposure Uncropped images of Supplementary Figure 1h 5 5 b-actin Uncropped images of Supplementary Figure 1m siegfp sipka siegfp sipka 1 nm (min) 15 siegfp sipka siegfp sipka 1 nm (min) 15 ps35- ps128-5 Uncropped images of Supplementary Figure 2a Uncropped images of Supplementary Figure 2b 1 nm 1 mm ERAP 5 Nucleus of ERa ERa 1 h 3 h 6 h 12 h 18 h 24 h 1 nm mm ERAP b-actin pser- 5 pser- 5 b-actin Continued on the following page

15 Uncropped images of Supplementary Figure 2c 5 HEK293T cells IP: FLAG Myc- + + Myc- + + FLAG-ERa + + FLAG-ERa + + HA- WT S39A HA- WT S39A Cyto Nuc Cyto Nuc Cyto Nuc Cyto Nuc 1 nm mm ERAP ERAP FLAG-ERa 5 FLAG-ERa HA- HA- IP: IgG FLAG-ERa 5 5 ps39- HA- 5 lamin tubulin Uncropped images of Supplementary Figure 3a 15 5 siegfp sipka si siegfp sipka si siegfp sipka si siegfp sipka si siegfp sipka si siegfp sipka si ps35- ps128- Uncropped images of Supplementary Figure 3b Uncropped images of Supplementary Figure 3c FLAG WT D - - HEK293T cells wt D - - FLAG- WT D - - / (-) 1nM (-) 1nM (-) 1nM -Peptide (mm) ps (-) 1nM 5 ps35- (-) 1nM 5 5 ps39- Continued on the following page

16 Uncropped images of Supplementary Figure 3d nm - 1 nm H-89 okadaic H-89 okadaic ps35- ps nm - 1 nm H-89 okadaic H-89 okadaic ps39- Uncropped images of Supplementary Figure 4b 1 nm 1 mm ERAP 5 siegfp sipka ps39-5 Uncropped images of Supplementary Figure 4d ps39-1nm mm ERAP PKCa ps39- IPs recombinant (ng) IB : P ps39- Supplementary Figure 6 Full-length images of immunoblots. Uncropped images of scanned immunoblots in Figures and Supplementary figures with size marker indications (kda)

17 Supplementary Table 1. Mascot Search Results MS/MS Fragmentation of GSGCSCTAPALSGPVAR (upper) and CWSLVAPH (lower) found in _HUMAN in Sprot

18 Supplementary Table 2. Clinical characteristic and results of immunohistochemistry of ERa-positive breast cancer specimens. Case intensity (-3) intensity (-3) Nucleus Cytoplasm DFI (year) Recurrence Age Menopause Tumour size Lymph node metastasis Pre < 2 cm n I Post cm n I Pre < 2 cm n IIA Post cm n1 IIB Post cm n1 II Post cm n IIA Pre cm n I Post < 2 cm n IIA Post < 2 cm n IIA Pre cm n IIA Post < 2 cm n1 IIB Post < 2 cm n II Post cm n IIA Post < 2 cm n I Pre cm n I Pre cm n I Post < 2 cm n I Post cm n I Pre cm n1 I Pre cm n I Pre cm n I Post cm n IIA Pre < 2 cm n I Post < 2 cm n I Pre < 2 cm n I Post cm n I Post cm n1 IIA Pre < 2 cm n I Post < 2 cm n IIA Pre < 2 cm n1 I Post cm n I Post < 2 cm n I Post < 2 cm n1 I Post < 2 cm n I Post < 2 cm n I Post < 2 cm n I Post cm n II Pre cm n II Pre cm n1 II Pre < 2 cm n I Pre < 2 cm n I Pre cm n II Pre cm n II Pre < 2 cm n I Post < 2 cm n I Post cm n II Pre cm n II Pre < 2 cm n I Pre < 2 cm n I Post < 2 cm n I Pre < 2 cm n I Post < 2 cm n1 II Post < 2 cm n II Post cm n I Pre cm n I Post < 2 cm n II Post cm n II Post < 2 cm n I Post < 2 cm n I Pre < 2 cm n IIA Post < 2 cm n I Post < 2 cm n I Continued on the following page Post cm n II Stage

19 Pre < 2 cm n IIA Post < 2 cm n I Post < 2 cm n I Post cm n II Pre < 2 cm n I Pre cm n II Pre cm n I Pre < 2 cm n I Post cm n II Post cm n1 II Pre cm n II Post cm n II Post cm n II Post < 2 cm n I Post < 2 cm n I Post < 2 cm n I Post cm n II Pre cm n II Post < 2 cm n I Post < 2 cm n I Pre < 2 cm n I Pre cm n II Pre < 2 cm n1 I

20 Supplementary Table 3. The sequences of each primer set. Genes Sequence 5 -CGGAATTCATGGAAGAAATCCTGAGGA AGC-3 (forward) 5 -ATAGTTTAGCGGCCGCACAATGATGTCATAGACACGG-3 (reverse) Purpose mutant (T162A) mutant (S35A) mutant (S35E) mutant (S689A) mutant (S9A) mutant (S128A) mutant (S128E) mutant (S1763A) (S39A) PKCa PKCe CAMK2 5 -GTGCGGGCAGCCCTCAGTCAA-3 (forward) 5 -TTGACTGAGGGCTGCCCGCAC-3 (reverse) 5 -TCAGGCTGCGCCTGCACTGCG-3 (forward) 5 -CGCAGTGCAGGCGCAGCCTGA-3 (reverse) 5 -GGCCGAGGAGAAGGCTGCTCC-3 (forward) 5 -GGAGCAGCCTTCTCCTCGGCC-3 (reverse) 5 -CGGCTCCTGGCCCTCTCCAAT-3 (forward) 5 -ATTGGAGAGGGCCAGGAGCCG-3 (reverse) 5 -GCACGGCTGGCCTGCGCTCTA-3 (forward) 5 -TAGAGCGCAGGCCAGCCGTGC-3 (reverse) 5 -CGCTGCTGGGCCCTTGTGGCC-3 (forward) 5 -GGCCACAAGGGCCCAGCAGCG-3 (reverse) 5 -CGCTGCTGGGAACTTGTGGCC-3 (forward) 5 -GGCCACAAGTTCCCAGCAGCG-3 (reverse) 5 -AGATACATCGCCATGCAGAAC-3 (forward) 5 -GTTCTGCATGGCGATGTATCT-3 (reverse) 5 -CGGAATTCCAGACCGTGCATCATGGCCCAGAACTTGAAGGA-3 (forward) 5 -CCGCTCGAGTTTCTTACCCTTGATGAGGCTGT-3 (reverse) 5 -GTGCGCGAAGCCGTGTTCACC-3 (forward) 5 -GGTGAACACGGCTTCGCGCAC-3 (reverse) 5 -CCCAAGAATGAAAGCAAGCA-3 (forward) 5 -CCGAAACTCCAAAGGAAAGG-3 (reverse) 5 -TCAAGCAGCACCCATTCTTC-3 (forward) 5 -TCAGGGCATCAGGTCTTCAC-3 (reverse) 5 -TCAGGGCATCAGGTCTTCAC-3 (forward) 5 -GGGGAGAGAGGCAATGAAGA-3 (reverse) Real-time PCR Real-time PCR Real-time PCR b2-microglobulin 5 -AACTTAGAGGTGGGGAGCAG-3 (forward) 5 -CACAACCATGCCTTACTTTATC-3 (reverse) Real-time PCR The underlines indicate the recognition sites of restriction enzymes. Double-underlines indicate the mutation sites.