*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU
|
|
- Hope Pierce
- 5 years ago
- Views:
Transcription
1 RLU Events Luciferin (μm) T-cells T-ALL 1 1 Time (min) T-cells T-ALL DCF-DA Reltive ATP content T-cells T-ALL RLU 1 1 T-cells T-ALL Luciferin (μm) 1 1 Time (min) c d Control e DCFH-DA (MFI) T-cells T-ALL Lctic Acid (mm) Oli FCCP N S CEM N S MT- Reltive ATP content Normlized ATP levels Control Oil -DG T-cells T-ALL CEM MT- Supplementry Figure 1. Incresed mitochondril metolism in T-ALL cells. (, ), mitochondril () nd cytosolic () ATP were mesured in norml T-cells nd primry T- ALL cells trnsfected with mitochondril luciferse (PcDNA-COX-luc) or cytosolic (PcDNAlucLL/V) luciferse. Representtive luciferse luminescence curves s function of time nd quntifiction of the luminescence s mesure of ATP content in norml T-cells (n=) nd primry T-ALL cells (n=) re shown. (c) A representtive histogrm of FACS-nlysis showing norml T-cells nd primry T-ALL cells stined with ROS-sensitive dye (DCFH-DA) nd n unstined control. An overview of the DCFH-DA fluorescence intensity (MFI) in norml T-cells (n=) nd primry T-ALL cells (n=) re shown. (d) Lctic cid levels in CEM nd MT- cells fter tretment with the oxidtive phosphoryltion inhiitor oligomycin (Oli, μm) or FCCP ( μm ) for h. (e) ATP levels were mesured in CEM nd MT- cells fter tretment with oligomycin (Oli, μm) or the glycolysis inhiitor -DG, ( μm) for h. The dt represent men ± S.D. vlue from n experiment performed in triplicte. p <.1, p <.1,, not significnt, Student s t test.
2 1KD 1KD KD KD c T-ALL 1 T-ALL T-ALL d Jurkt CEM Molt- MT- 1KD 1KD KD KD e f g OCR(µs/h) h Normlized ATP levels T-ALL 1 T-ALL T-ALL * * CEM MT- N S sh N S CEM MT- CEM MT Lctic Acid (mm) i OCR(µs/h) Normlized ATP levels sh CEM sh sh+ MT- Jurkt CEM Molt- MT- Normlized ATP levels Supplementry Figure. Western lot nlysis of expression nd the role of in mitochondril metolism of T-ALL cells. (, ) Western lot nlysis of knockdown efficiency in primry T-ALL cells () nd T-ALL cell lines (). (c, d) Western lot nlysis of overexpression in primry T-ALL cells (c) nd T-ALL cell lines (d). (e) Bseline OCR nd lctic cid levels in CEM nd MT- cells with knockdown. (f) ATP levels in CEM nd MT- cells with knockdown. (g) Bseline OCR nd lctic cid levels in CEM nd MT- cells with overexpression. (h) ATP levels in CEM nd MT- cells with overexpression. (i) Bseline OCR (left) nd ATP levels (right) in or sh lentivirus-infected Jurkt T-cells nd shinfected cells re-trnsfected with. The dt represent men ± S.D. from n experiment performed in triplicte. *p <., p <.1, p <.1,, not significnt, Student s t test. OCR(µs/h) * N S N S CEM MT- CEM MT Lctic Acid (mm)
3 T-cells T-ALL 1 1 PTEN KD Notch-1 KD 1KD KD T-cells T-ALL PTEN KD Notch-1 KD 1KD KD PTEN KD KD Supplementry Figure. Western lot nlysis of PTEN nd Notch-1 sttus in norml T-cells nd primry T-ALL cells (), nd of PTEN sttus in the T-ALL cell lines used ().
4 PLC β Hoechst Merge sh T P C N T P C N KD 1KD P-cd 1KD HA 1KD c P-cd Reltive levels e f Control P C P C P C P C Control DSP sh sh + p- DSP Control Unstimulted 1KD 1KD KD d Merge I pm I nu Ipm Responding cells (%) 1 p- stimultion I nu Merge Responding cells (%) Intensity rtio I pm / I nu sh sh+. Intensity rtio I pm / I nu.... sh sh KD
5 Supplementry Figure. knockdown prevents trnsloction to the plsm memrne nd ctivtion. () Immunofluorescence stining with nti- showing nucler locliztion of the protein. Hoechst stining indictes the nucleus. Scle rs, 1 μm. () Control nd knockdown Jurkt T-cells were treted for min in the presence or sence of 1 μg/ml nti-cd. The totl (T), plsm memrne (P), cytosolic (C) nd nucler (N) frctions were nlyzed y western lot. Pn-cdherin, histone HA nd ctin were used s loding controls for the plsm memrne, nucler nd cytosolic frctions, respectively. (c) Jurkt T-cells were treted for min in the presence or sence of 1 μg/ml nti-cd, nd then cells were cross-linked y 1mM DSP for min efore lysis. The plsm memrne (P) nd cytosolic (C) frctions were nlyzed y western lot. (d) trnsloction in control nd knockdown Jurkt T-cells upon 1 μg/ml nti- CD stimultion for min (upper, left). The percentge of cells responding to nti- CD is represented s histogrm (upper, right) (1 cells from three experiments with 1 rndom fields/experiment). A line intensity profile cross the cell ws otined in given imge (upper, left). Representtive intensity profiles re shown (lower, left). The reltive fluorescence intensity rtio of plsm-memrne-djcent re (I pm ) versus nucler re (I nu ) re shown (lower, right; cells from three experiments with 1 rndom fields/experiment). (e) trnsloction in or sh lentivirus-infected Jurkt T-cells nd sh -infected cells re-trnsfected with. Cells were stimulted for min in the presence or sence of 1 μg/ml nti-cd. The percentge of cells responding to nti-cd (1 cells from three experiments with 1 rndom fields/experiment) nd the reltive fluorescence intensity rtio of plsm-memrne-djcent re (I pm ) versus nucler re (I nu ) re shown ( cells from three experiments with 1 rndom fields/experiment). Scle rs, 1 μm. (f) Confocl microscopy nlysis of (green) nd p- (red) locliztion in Jurkt T-cells. Cells were stimulted for min in the presence or sence of 1 μg/ml nti-cd. Scle rs, 1 μm. The dt represent men ± S.D. from n experiment performed in triplicte. p <.1, p <.1, Student s t test.
6 c PLC β PLC 1 PLC β PLC 1 PLC β PLC 1 1KD 1KD KD 1KD 1KD KD 1KD 1KD KD IP IP IP shplc 1 shplc F/F F/F shplc 1 shplc shplc 1 shplc F/F 9 7 F/F.. 1 F/F F/F (1μg/ml) shplc 1 shplc 1 1 Time (min) (1μg/ml) shplc 1 7 shplc Time (min) 7 1 (1μg/ml) 1 1 Time (min) shplc 1 shplc d PLC β PLC 1 1KD 1KD KD IP 1 1 PLC 1 PLC * F/F 7 1 * F/F 7 1 (1μg/ml) 1 1 Time (min) PLC 1 PLC
7 Supplementry Figure. is essentil for C + relese in T-ALL cells. Mesurement of nti-cd induced IP production nd [C + ] i trnsients upon PLC or PLC 1 knockdown in () norml T-cells, () primry T-ALL cells, nd (c) Jurkt T-cells. (d) Mesurement of nti-cd induced IP production nd [C + ] i trnsients upon PLC or PLC 1 overexpression in Jurkt T-cells. IP concentrtion ws determined y stimultion of cells with 1 μg/ml nti-cd for min. [C + ] i were recorded s F/ rtio using Fur-AM in cells with 1 μg/ml of nti-cd stimultion. Averge [C + ] i responses nd quntifiction of [C + ] i pek mplitudes of norml T-cells or primry T- ALL cells re shown. For the Jurkt T-cells the dt represent men ± S.D. vlue from n experiment performed in triplicte, nd for primry T-cells nd T-ALL cells men ± S.D. vlue of n= primry T-ALL specimens. *p<., p <.1,, not significnt, Student s t test.
8 sh c d IP IP sh+ PIP Control. 1 1 PIP IP IP shplc Control PIP sh IP IP PLC sh Control PIP Supplementry Figure. modultes IP production. () IP production in or sh trnsduced Jurkt T-cells nd sh trnsduced cells re-trnsfected with. () IP production in Jurkt T-cells overexpressing lone or in comintion with sh. (c) IP production in or sh trnsduced Jurkt T-cells with or without overexpression. (d) IP production in wild-type Jurkt T- cells incuted with incresing concentrtions of exogenous PIP (left), nd knockdown (middle) or overexpressing (right) cells fter tretment with 1 nm PIP. Cells were incuted with PIP for 1 h efore min stimultion with 1 μg/ml nti-cd. The dt represent men ± S.D. vlue from n experiment performed in triplicte. p <.1, p <.1, Student s t test.
9 F/ c F/F e F/F g Totl c + (mm) EGTA (1μg/ml) 1 1 TG (nm) sh (1μg/ml) 1 1 Time(min) Time(min) sh sh 1 1 Time(min) sh Control C + F/ F/F F/F Totl c + (mm) sh C + relese C+ influx sh sh Control F/ d f F/F F/F EGTA.. (1μg/ml) (1μg/ml) Time(min) C TG (nm) Time(min) 1 1 Time(min) F/ F/F F/F * C + relese C+ influx
10 Supplementry Figure 7. regultes C + relese from ER in Jurkt T- cells. (, ) Jurkt T-cells sujected to knockdown () or overexpression () were stimulted with 1 μg/ml nti-cd in ECB (contining1 mm EGTA) without C +. Chnges in [C + ] i were recorded s the F/ rtio using Fur-AM. After stimultion, ECB contining mm CCl insted of EGTA were used to nlyze C + influx. Averge [C + ] i responses nd quntifiction of [C + ] i pek mplitudes re shown. (c, d) Jurkt T-cells sujected to knockdown (c) or overexpression (d) were stimulted with 1 μg/ml nti-cd in ECB. Chnges in [C + ] i were recorded s the F/F rtio using FluoN-AM. Averge [C + ] E responses nd quntifiction of [C + ] E pek mplitudes re shown. (e, f) Jurkt T-cells sujected to knockdown (e) or overexpression (f) were stimulted 1 nm TG in ECB. Chnges in [C + ] i were recorded s the F/ rtio using Fur-AM. (g) Totl mount of C + in Jurkt T-cells sujected to knockdown nd overexpression in the presence or sence of 1 μg/ml nti-cd stimultion. The dt represent men ± S.D. vlue from n experiment performed in triplicte. *p <., p <.1,, not significnt, Student s t test.
11 N sh E M E N M Incidence of the tight ssocitions (%) 1 1 sh sh ER DsRed-ER /Mito / Merge / GFP-Mito ER DsRed-ER /Mito / Merge / GFP-Mito Person's correltion CFP-Mito / DsRed-ER..... sh Supplementry Figure. knockdown filed to chnge the quntity of ER-mitochondril contcts in Jurkt T-cells. () TEM imging of ERmitochondril contct sites (red rrowheds depicting the close contcts) in control nd knockdown Jurkt T-cells, nd mesurements of the ER mitochondri interfce (N, nucleus; M, mitochondrion; E, endoplsmic reticulum), Scle rs, nm. () Confocl microscopy nlysis of the colocliztion of ER (red) nd mitochondri (green). Scle rs, 1 μm. Person s correltion of the ER nd mitochondril signls is represented ( cells were nlyzed per condition). The dt represent men ± S.D. vlue from n experiment performed in triplicte., not significnt, Student s t test.
12 sh BODIPY-Chol DsRed-Mito Merge Person's correltion BODIPY-Chol / DsRed-Mito..... sh sh BODIPY-Chol DsRed-ER Merge Person's correltion BODIPY-Chol / DsRed-ER sh Supplementry Figure 9. knockdown does not chnge the trnsport of BODIPY-cholesterol from the PM to ER or mitochondri. Control nd knockdown Jurkt T-cells were trnsfected with mitochondril (DsRed-Mito) () or ER (DsRed-ER) mrker () for h. The cells were then leled for 1 min with BODIPY-chol, chsed for min, nd confocl imges were tken fter the chse. Scle rs, 1 μm. Brs indicte Person s correltion of BODIPY-chol nd ech orgnelle DsRed mrker ( cells were nlyzed per condition). The dt represent men ± S.D. vlue from n experiment performed in triplicte., not significnt, Student s t test.
13 T-cells T-ALL 1 1 ORPM p p ORPS p c Xpress 1KD 7KD KD IP 1 1 KD d F/ 7 (1μg/ml) ORPM ORPS ( PH) ( FFAT) (PH) F/ Time(min) Supplementry Figure 1. The effects of ORPM, ORPS nd truncted or mutted constructs on C + signling. () RT-PCR nlysis of, ORPM nd ORPS expression in norml T-cells, primry T-ALL cells nd T-ALL cell lines. () Western lot verifying overexpression of the constructs used in Jurkt T-cells, s detected y Xpress epitope tg ntiody. (c, d) IP production (c) nd C + response (d) upon nti-cd stimultion in Jurkt T-cells overexpressing the indicted constructs. The dt represent men ± S.D. vlue from n experiment performed in triplicte. p <.1,, not significnt, Student s t test.
14 sh JC-1 (Red/Green Rtio) 1.. sh. sh NAD(P)H fluoresence per cell (ritry unit) 1 9 sh * Supplementry Figure 11. knockdown reduces the mitochondril memrne potentil nd NAD(P)H utofluorescence in Jurkt T-cells. () Mitochondril memrne potentil ws visulized with epifluorescence microscopy nd expressed s rtio of JC-1 ggregtes (red) nd monomer (green) (Red/Green). () NAD(P)H utofluorescence ws cptured with DAPI cue y epifluorescence microscopy nd used to clculte FCCP-sensitive mitochondril NAD(P)H level [ΔNAD(P)H] per cell. Scle rs, 1 μm. The dt represent men ± S.D. (n=). *p<., p <.1, Student s t test.
15 1KD KD IP 1 OCR (us/h) Normlized ATP levels Supplementry Figure 1. overexpression filed to ffect oxidtive phosphoryltion in norml T-cells. () Western lot verifying the overexpression of in trnsfected T-cells. () IP production (left), OCR (middle) nd ATP levels (right) in control nd overexpressing T-cells. The dt represent men ± S.D. vlue from n experiment performed in triplicte., not significnt, Student s t test.
16 Fig. 1f Fig. Fig. c 1KD CDε 1KD CDε 1KD KD Gα q/11 KD 1KD Gα q/11 1KD KD 1KD 1KD Gα q/11 KD 1KD KD CDε 1KD CDε 1KD Fig. 1g 1KD 1KD 1KD 1KD Gα q/11 KD KD Fig. d Fig. e CDε 1KD CDε 1KD 1KD 1KD Gα q/11 KD Gα q/11 KD Fig. CDε 1KD 1KD 1KD CDε Gα q/11 1KD 1KD 1KD KD p- Gα q/11 1KD 1KD KD KD Fig. c Fig. d 1KD 1KD p- 1KD p- 1KD 1KD KD 1KD KD p- 1KD 1KD 1KD KD p- 1KD 1KD 1KD KD Supplementry Figure 1. Representtive originl imges of immunolotting results for Figure 1-. The cropped res used in the figures re mrked y oxes.
17 Fig. Fig. Supplementry Figure 1. Continued p-pdh KD p-pdh KD PDH KD PDH KD KD KD Fig. c Fig. d Fig. e 1KD p-pdh KD p-pdh KD p-pdh KD PDH KD PDH KD KD KD PDH KD KD Fig. f Fig. g Fig. h p-pdh KD p-pdh KD p-pdh KD PDH KD PDH KD PDH KD KD KD KD Fig. e Fig. g 1KD p-ampk KD KD AMPK KD Fig. f LC I LC II 1KD p-ampk KD KD AMPK KD Fig. i LC I LC II 1KD p-pdh KD p-mtor KD PDH KD mtor Fig. h KD KD p-ampk AMPK KD KD LC I LC II 1KD LC I LC II 1KD KD KD
18 Supplementry Tle 1. Summry of the clinicl T-ALL cell smples nd their nlyses Anlyses performed Smples Age Sex Western Cofocl ATP OCR ECAR q-pcr IP C + lot imge Cell Engrftment deth ROS PDH/AMPK ctivity, utophgy T-ALL 1 M Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes T-ALL 1 F Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes T-ALL M Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes T-ALL M Yes Yes Yes T-ALL F Yes Yes Yes Yes T-ALL F Yes Yes Yes Yes Yes Yes T-ALL 7 1 M Yes Yes T-ALL 7 M Yes Yes Yes Yes T-ALL 9 F Yes Yes T-ALL 1 19 M Yes Yes T-ALL 11 M Yes Yes T-ALL 1 F Yes Yes T-ALL 1 M Yes Yes T-ALL 1 F Yes Yes Yes Yes Yes Yes T-ALL 1 9 F Yes Yes T-ALL 1 1 F Yes Yes Yes T-ALL 17 M Yes Yes Yes Yes Yes Yes T-ALL 1 M Yes Yes
19 Supplementry Tle. Puttive -intercting proteins Symol Entrez Gene Nme HCLS1 Hemtopoietic linege cell-specific protein DARS Asprtyl-tRNA synthetse A1S9T Uiquitin-like modifier-ctivting enzyme 1 CDE T-cell surfce glycoprotein CD epsilon chin RPL7 S riosoml protein L7 JUP Puttive unchrcterized protein EP1 CGI- PAI1 RNA-inding protein 1 phosphtidylinositol-,-isphosphte phosphodiesterse et- FUBP Fr upstrem element-inding protein EVL En/vsodiltor-stimulted phosphoprotein-like RABEP R GTPse-inding effector protein Gαq/11 Gunine nucleotide inding protein, lph q/11 NUDC Nucler distriution protein C homolog DRBF Doule-strnded RNA-inding protein 7
20 Supplementry Tle. The trgeted shrna sequences used Construct sense - Anti-sense - GCATTGGTCGTCTCT ATTA TAATAGAGACGACCAATGC sh TCAGAGTCAAGCTCAGGTGTA TACACCTGAGCTTGACTCTGA sh AGATGAGGGACAAGCATAAGAAGGA TCCTTCTTATGCTTGTCCCTCATCT shplcγ1 AAACAACCGGCTCTT CGT ACGAAGAGCCGGTTGTTT sigq/11 GGAGUACAAUCGGUCUAAUU UUAGACCAGAUUGUACUCCUU
21 Supplementry Tle. Oligonucleotide primers used for cdna constructs Construct Forwrd primer - Reverse primer - -pcdna HisMxC ATTtctgATGGGGAAAGCGGCGGT* ATTtctgGTGGCGCTCAGAAGATGTTG GGGCACATATGCCA ORPM-pcDNA HisMxC ATTgtctATGTCGTCACTGGCAGCGAAG ATTgtcgcGAAGATGTTGGGGCACATATG ORPS-pcDNA HisMxC ATTgtctATGGAAGACTCCACATCCTTCA ATTgtcgcGAAGATGTTGGGGCACATATG ( PH)-pcDNAHisMxC Forwrd 1: ATTgtctATGGGGAAAGCGGCGGCT Forwrd 1: GCTGTCCAGAGGCAGTAAGGCGTCCCCAGA GTCATCTGAA Reverse 91: ATTgtcgcGAAGATGTTGGGGCACATATGCCA Reverse 1: TTCAGATGACTCTGGGGACGCCTTACTGCCTCT GGACAGC ( FFAT)-pcDNAHisMxC Forwrd 1: ATTgtctATGGGGAAAGCGGCGGCT Forwrd : TGATGAAGGATGTGGAGTCTTCCATGGTATC TTCATCTTCCTCACTGTCC Reverse 91: ATTgtcgcGAAGATGTTGGGGCACATATGCCA Reverse : GGACAGTGAGGAAGATGAAGATACATGGAAGA CTCCACATCCTTCATCA (PH)-pcDNAHisMxC ATTgtctGTGAGGGCTGGCTTCTCAAGT ATTgtcgcCTTGGCCAGCTCCAGGGCGGTGAT -pcdnahismxc ATTgttcATGGCGGGCGCCCAGCCCGGC ATTctcggTCAGAGCTGCGTGTTCTCCT PLCγ1-pcDNAHisMxC ATTgttcATGGCGGGCGCCGCGTCCCCTT ATTtctgCTAGAGGCGGTTGTCTCCATTGACC *Restriction sites re indicted in lower cse letters.
Acute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture09663 Scrmle shnlrp3 shcsp1 IL-1β (p17) IL-1β (pg/ml) 2000 1500 1000 500 Wt Nlrp3-/- Ipf-/- 0 APDC IL-1β (p17) Supplementl Figure 1. Mitochondril ROS cn trigger NLRP3 inflmmsome ctivtion,
More informationSUPPLEMENTARY INFORMATION
X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationUlk λ PPase. 32 P-Ulk1 32 P-GST-TSC2. Ulk1 GST (TSC2) : Ha-Ulk1 : AMPK. WB: Ha (Ulk1) : Glu. h CON - Glu - A.A WB: LC3 AMPK-WT AMPK-DKO
DOI: 10.1038/ncb2152 C.C + - + - : Glu b Ulk1 - - + λ PPse c AMPK + - + + : ATP P-GST-TSC2 WB: Flg (Ulk1) WB Ulk1 WB: H (Ulk1) GST (TSC2) C.C d e WT K46R - + - + : H-Ulk1 : AMPK - + - + + + AMPK H-Ulk1
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nture09973 Plsm Memrne Phgosome TLR1/2/4 ROS Mitochondrion ROS OXPHOS Complex I ROS TRAF6 NADPH Oxidse Supplementry Figure 1 Model detiling the roles of mitochondril ROS in mcrophge cteril
More informationAMPK maintains energy homeostasis and survival in cancer cells via. regulating p38/pgc-1α-mediated mitochondrial biogenesis
SUPPLEMENTARY INFORMATION AMPK mintins energy homeostsis nd survivl in cncer cells vi regulting p38/pgc-1α-medited mitochondril iogenesis Blkrishn Chue 1, Prmnnd Mlvi 1, Shivendr Vikrm Singh 1, Noshd Mohmmd
More informationMicrotubule-driven spatial arrangement of mitochondria promotes activation of the NLRP3 inflammasome
Supplementry Informtion Microtuule-driven sptil rrngement of mitochondri promotes ctivtion of the NLRP3 inflmmsome Tkum Misw 1,2, Michihiro Tkhm 1,2, Ttsuy Kozki 1,2, Hnn Lee 1,2, Jin Zou 1,2, Ttsuy Sitoh
More informationSupplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
More informationSupplementary Figure S1
Supplementry Figure S1 d MAP2 GFAP e MAP2 GFAP GFAP c f Clindin GFAP Supplementry Figure S1. Neuronl deth nd ltered strocytes in the rin of n ffected child. Neuron specific MAP2 ntiody stining in the hippocmpus
More informationDOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationSupplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
More informationSupplementary Figure S1
Supplementry Figure S Connexin4 TroponinI Merge Plsm memrne Met Intrcellulr Met Supplementry Figure S H9c rt crdiomyolsts cell line. () Immunofluorescence of crdic mrkers: Connexin4 (green) nd TroponinI
More informationSupplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture078 RNse VifHA VifHA βctin 6 Cell lyste IP: ntiha MG VifHA VifHA β ctin 6 7 Cell lyste IP: ntiha Supplementry Figure. Effect of RNse nd MG tretment on the Vif interction., RNse tretment does
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nture1188 1mM CCl 2 (min) 3 4 6 CCl 2 (mm) for 4min.1. 1 (mm) Pro- d WT GdCl 3 R-68 -/- P2x7r -/- -/- Csp1 -/- WT -/- P2x7r -/- -/- Csp1 -/- Csp1 (p2) (p17) Pro-Csp1
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationSupplementary Figure 1
Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationSUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
More informationSupplementary Information
Supplementry Informtion Cutneous immuno-surveillnce nd regultion of inflmmtion y group 2 innte lymphoid cells Ben Roediger, Ryn Kyle, Kwok Ho Yip, Nitl Sumri, Thoms V. Guy, Brin S. Kim, Andrew J. Mitchell,
More informationSupplementary Figure 1
Supplementry Figure 1 Ncor1 Expression 2. 1.5 1..5. Muscle Liver Lmi Ppropi Kindey Pncres Lung Testis Bone Mrrow Thymus Spleen Peripherl Lymph nods Smll Intestine Ncor1 Expression 1.5 1..5. DN DP SP CD8
More informationSupplementary Information. SAMHD1 Restricts HIV-1 Infection in Resting CD4 + T Cells
Supplementry Informtion SAMHD Restricts HIV- Infection in Resting CD T Cells Hnn-Mri Blduf,2,, Xioyu Pn,, Elin Erikson,2, Srh Schmidt, Wqo Dddch 3, Mnj Burggrf, Kristin Schenkov, In Amiel,2, Guido Wnitz
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:
More informationPHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES
PHYSIOLOGICAL AND PROTEOMIC RESPONSES OF TOBACCO SEEDLINGS EXPOSED TO SILVER NANOPARTICLES Rent Bi Deprtment of Biology, Fculty of Science, University of Zgre INTRODUCTION Nnoprticles (NPs) Silver nnoprticles
More informationSUPPLEMENTARY INFORMATION
doi:.3/nture93 d 5 Rttlesnke DRG (reds) Rttlesnke TG (reds) c 3 TRPV1 other TRPs 1 1 3 Non-pit snke TG (reds) SFig. 1 5 5 3 other TRPs TRPV1 1 1 3 Non-pit snke DRG (reds) 5 Antomy of the pit orgn nd comprison
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More information% Inhibition of MERS pseudovirus infection. 0 h 0.5 h 1 h 2 h 4 h 6 h Time after virus addition
% Inhiition of MERS pseudovirus infection 1 8 h.5 h 1 h 2 h 4 h 6 h Time fter virus ddition Supplementry Figure S1. Inhiition of on MERS pseudovirus infection t the different intervls postinfection. A
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5
More informationMolecular Analysis of BRCA1 in Human Breast Cancer. Cells Under Oxidative Stress
Moleculr Anlysis of BRCA1 in Humn Brest Cncer Cells Under Oxidtive Stress Brin L. Gilmore 1, Ynping Ling 1, Crly E. Winton 1,2, Ky Ptel 1, Vsile Krgeorge 1, A. Cmeron Vrno 1,3, Willim Dernley 1, Zhi Sheng
More information11/7/2011. Disclosures. Psoriatic Arthritis (PsA) DC-STAMP I II III IV. None
unstimulte stimulte 11/7/11 Ientifiction of Unique Suset + (Denritic Cell-Specific Trnsmemrne Protein) T cells with Th17 Signture in Psoritic rthritis () Ptients Disclosures None Y.H. Chiu, E.M. Schwrz,
More informationCyanidin-3-O-glucoside ameliorates lipid and glucose accumulation in C57BL/6J mice via activation of PPAR-α and AMPK
3 rd Interntionl Conference nd Exhiition on Nutrition & Food Sciences Septemer 23-25, 214 Vlenci, Spin Cynidin-3-O-glucoside meliortes lipid nd glucose ccumultion in C57BL/6J mice vi ctivtion of PPAR-α
More informationCopy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry
More informationAlimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )
Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion
More informationSUPPLEMENTARY INFORMATION
2 weeks high holesterol diet 2 weeks high holesterol diet 2 weeks high holesterol diet 2 μm Mrophges Crystls Hoehst μm Mrophges Crystls Hoehst Hoehst Crystls Mrophges 2 μm 2 μm Supplementry Fig. 1: Erly
More information2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
More informationNappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture17 Men tumour dimeter (mm) 2 Rg2-/- 2 1 2 2 1 Control IgG!-CD8!-CD4 1 2 3 1 2 3 c Men tumour dimeter (mm) 2 2 1 d Ifnr1-/- Rg2-/- 2 2 1 Ifngr1-/- d42m1!ic 1 2 3 Dys post trnsplnt 1 2 3 Supplementry
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationSupplemental Information. Lymphocytes Negatively Regulate NK Cell Activity. via Qa-1b following Viral Infection
Cell Reports, Volume 21 Supplementl Informtion Lymphocytes Negtively Regulte NK Cell Activity vi Q-1b following Virl Infection Hifeng C. Xu, Jun Hung, Aleksndr A. Pndyr, Elisbeth Lng, Yun Zhung, Christine
More informationConnexin 30 sets synaptic strength. by controlling astroglial synapse invasion
Connexin 3 sets synptic strength y controlling stroglil synpse invsion Ulrike Pnnsch, Dominik Freche, Glenn Dllérc, Grégory Ghézli,, Crole Escrtin, Pscl Ezn, Mrtine Cohen-Slmon, Krim Benchenne, Veronic
More informationAnti-inflammatory activity of IgG1 mediated by Fc galactosylation and association of FcγRIIB and dectin-1
Anti-inflmmtory ctivity of IgG1 medited y Fc glctosyltion nd ssocition of FcγRIIB nd dectin-1 Christin M. Krsten, Mnoj K. Pndey, Juli Figge, Regin Kilchenstein, Philip R. Tylor, Mrcel Ross, Jcqueline U.
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/nc2824 Hcn4 Tx5 Mlc2 c Hcn4- ISH d Tx5- ISH e Mlc2-ISH Hcn4-ISH f e Tx5-ISH f -ISH Figure S1 Section in situ hyridistion nlysis of crescent stge mouse emryos (E7.5). () More nterior section
More informationSupplementary Figure S1
Supplementry Figure S1 - UTR m - 3HA - 2-1 hgh - 1 Uiquitin *! *! lk distl promoter m K3R/ K121R-3HA UTR hgh founder lines - HA - - founder lines TG- E1 L A2 B1 F9 G6 H4 H6 B C D2 G1 H3 J2 L - 7 IP: lk
More informationSUPPLEMENTARY INFORMATION
DOI:.38/nc393 Nnog DAPI Nnog/DAPI c-jun DAPI c-jun/dapi c e Reltive expression to Gpdh mescs ( Feeder free) mescs ( Feeder) MEFs.5 MEFs ipscs ESCs..5 p=.24 p=.483 p=.22. JunB JunD Fos Fr Fr2 ATF2 ATF3
More informationHeparanase promotes tumor infiltration and antitumor activity of CAR-redirected T- lymphocytes
Supporting Online Mteril for Heprnse promotes tumor infiltrtion nd ntitumor ctivity of -redirected T- lymphocytes IgnzioCrun, Brr Svoldo, VlentinHoyos, Gerrit Weer, Ho Liu, Eugene S. Kim, Michel M. Ittmnn,
More informationSUPPLEMENTARY INFORMATION
Icos-/ CD3 Icos Y181F OT-2 T cells doi:1.138/nture158 IgD Supplementry Figure 1. is required for folliculr locliztion of ctivted helper T cells. Icos nd Icos-/- OT-2 T cells were retrovirlly trnsduced
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1228 Totl Cell Numer (cells/μl of lood) 12 1 8 6 4 2 d Peripherl Blood 2 4 7 Time (d) fter nti-cd3 i.p. + TCRβ + IL17A + cells (%) 7 6 5 4 3 2 1 Totl Cell Numer (x1 3 ) 8 7 6 5 4 3 2 1 %
More informationMERS coronavirus induces apoptosis in kidney and lung by upregulating Smad7 and FGF2
ARTICLE NUMBER: 164 DOI: 1.138/NMICROBIOL.216.4 MERS coronvirus induces poptosis in kidney nd lung y upregulting Smd7 nd FGF2 Mn-Lung Yeung, Ynfeng Yo, Lilong Ji, Jsper F. W. Chn, Kwok-Hung Chn, Kwok-Fn
More informationSupplementary Information Titles
Supplementry Informtion Titles Journl: Nture Medicine Article Title: Corresponding Author: Modelling colorectl cncer using CRISPR-Cs9-medited engineering of humn intestinl orgnoids Toshiro Sto Supplementry
More informationTwo-step activation of FOXO3 by AMPK generates a coherent feed-forward loop determining excitotoxic cell fate
(22), 2 & 22 Mcmilln Pulishers Limited All rights reserved 35947/2 www.nture.com/cdd Twostep ctivtion of FOXO3 y AMPK genertes coherent feedforwrd loop determining excitotoxic cell fte D Dvil, NMC Connolly
More informationSupplementary information
Supplementry informtion Unsturted liphtic lcohol s nturl lignd for mouse odornt receptor Keiichi Yoshikw, Hiroki Nkgw, Noki Mori, Hidenori Wtne nd Kzushige Touhr* Deprtment of Applied Biologicl Chemistry,
More informationIGF-1 vs insulin: Respective roles in modulating sodium transport via the PI-3 kinase/sgk1 pathway in a cortical collecting duct cell line
originl rticle http://www.kidney-interntionl.org & 27 Interntionl Society of Nephrology IGF-1 vs insulin: Respective roles in modulting sodium trnsport vi the PI-3 kinse/sgk1 pthwy in corticl collecting
More informationSUPPLEMENTARY INFORMATION
doi:.38/nture73 Glucose SSP THF Methyl- THF Purines 3- PG PHGDH PSAT PSPH Glycine SHMT GSH Lctte Pyruvte ROS TCA Cycle Glucose p53 p Purines 3- PG PHGDH PSAT PSPH Glycine SHMT GSH Lctte Pyruvte ROS TCA
More informationPDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis
Supplementry Informtion PDGF-BB secreted y preosteoclsts induces ngiogenesis during coupling with osteogenesis Hui Xie, Zhung Cui, Long Wng, Zhuying Xi, Yin Hu, Lingling Xin, Chngjun Li, Ling Xie, Jnet
More informationSUPPLEMENTARY INFORMATION
TM TM tip link horizontl top connectors 1 leucine-rich (21 %) otoncorin-like 1809 ntigenic peptides B D signl peptide hydrophoic segment proline/threonine-rich (79 %) Supplementry Figure 1. () The outer
More informationSUPPLEMENTARY INFORMATION
Supplementry Tble 1. Sttistics of dt sets nd structure refinement PYL1 po PYL2/ABA PYL2 po PYL2/ABA/HAB1 PDB code 3KAY 3KAZ 3KB0 3KB3 Dt collection APS bem line 21-ID 21-ID 21-ID 21-ID Spce group P6 5
More informationSUPPLEMENTARY INFORMATION
Supplementry Figure 1. Genertion of N- nd C-tgged cyclin D1 knock-in mice., N-tgged cyclin D1 gene trgeting construct, cyclin D1 genomic locus, cyclin D1 locus following homologous recomintion (trgeted
More informationSUPPLEMENTARY INFORMATION
SUPPEMENTARY INFORMATION DOI: 1.138/ncb956 Norml CIS Invsive crcinom 4 months months b Bldder #1 Bldder # Bldder #3 6 months (Invsive crcinom) Supplementry Figure 1 Mouse model of bldder cncer. () Schemtic
More informationHormonal networks involved in phosphate deficiencyinduced cluster root formation of Lupinus albus L.
Institute of Crop Science (34h) Hormonl networks involved in phosphte deficiencyinduced cluster root formtion of Lupinus lus L. For PSP5 in Montpellier, 214 Zhengrui Wng, A.B.M. Moshiur Rhmn, Guoying Wng,
More informationSUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
More informationResponses of skeletal muscle lipid metabolism in rat gastrocnemius to hypothyroidism and iodothyronine administration: a putative role for FAT/CD36
Am J Physiol Endocrinol Met 33: E1222 E1233, 212. First pulished Septemer 11, 212; doi:1.1152/jpendo.37.212. Responses of skeletl muscle lipid metolism in rt gstrocnemius to hypothyroidism nd iodothyronine
More informationClinical Study Report Synopsis Drug Substance Naloxegol Study Code D3820C00018 Edition Number 1 Date 01 February 2013 EudraCT Number
EudrCT Number 2012-001531-31 A Phse I, Rndomised, Open-lbel, 3-wy Cross-over Study in Helthy Volunteers to Demonstrte the Bioequivlence of the Nloxegol 25 mg Commercil nd Phse III Formultions nd to Assess
More informationSupplemental Materials
Supplementl Mterils Cellulose deficiency of shv3svl1 is enhnced y hyper ccumultion of exogenous sucrose vi the plsm memrne sucrose/h symporter SUC1 Trevor H. Yets, Hgit Sorek, Dvid E. Wemmer, Chris R.
More informationSingle-Molecule Studies of Unlabelled Full-Length p53 Protein Binding to DNA
Single-Molecule Studies of Unlbelled Full-Length p53 Protein Binding to DNA Philipp Nuttll, 1 Kidn Lee, 2 Pietro Ciccrell, 3 Mrco Crminti, 3 Giorgio Ferrri, 3 Ki- Bum Kim, 2 Tim Albrecht 1* 1 Imperil College
More informationDefective Wnt-dependent cerebellar midline fusion in a mouse model of Joubert syndrome
correction notice Nt. Med. 17, 726 731 (2011) Defective Wnt-dependent cereellr midline fusion in mouse model of Jouert syndrome Mdeline A Lncster, Dipik J Gopl, Joon Kim, Shr N Sleem, Jennifer L Silhvy,
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationPrimers used for real time qpcr
Supplementry Tble 1. Primers used for rel time qpcr Gene Accession number Forwrd/reverse primers Tgfα Tgfβ1 Hgf Cyclin A2 Cyclin B1 Cyclin D1 Cyclin E1 FoxM1 p21 Lrt Cyp26A1 CrbpI Rrβ Bcmo1 Bcmo2 NM_31199
More informationTranslationally controlled tumour protein (TCTP) is a novel glucose-regulated protein that is important for survival of pancreatic beta cells
Dietologi (11) 54:368 9 DOI 1.7/s1-1-1958-7 ARTICLE Trnsltionlly controlled tumour protein () is novel glucose-regulted protein tht is importnt for survivl of pncretic et cells F. Dirison & K. Hywrd &
More informationSUPPLEMENTARY INFORMATION
Supplementry Informtion Supplementry Figure legends Supplementry tle. List of the fctors identified from the GST-RAR (LBD)-ffinity purifiction. The hrored domins, their puttive cytologicl functions, nd
More informationUnique roles of the unfolded protein response pathway in fungal. development and differentiation. Kwang Woo Jung, Yee Seul So, & Yong Sun Bahn *
Supplementry Informtion Unique roles of the unfolded protein response pthwy in fungl development nd differentition Kwng Woo Jung, Yee Seul So, & Yong Sun Bhn * Contents Supplementry Figure S1 Supplementry
More informationSUPPLEMENTARY INFORMATION
SUPPLEMEARY IFORMAIO doi:./nture correction to Supplementry Informtion Adenom-linked rrier defects nd microil products drive IL-/IL-7-medited tumour growth Sergei I. Grivennikov, Kepeng Wng, Dniel Mucid,
More informationThe effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat
The effect of dietry α-linolenic cid levels on regultion of omeg-3 lipid synthesis in rt Wei-Chun Tu School of Agriculture Food nd Wine The University of Adelide Conversion of PUFA to LCPUFA PUFA LCPUFA
More informationTLR7 induces anergy in human CD4 + T cells
TLR7 induces nergy in humn CD T cells Mrgrit Dominguez-Villr 1, Anne-Sophie Gutron 1, Mrine de Mrcken 1, Mrl J Keller & Dvid A Hfler 1 The recognition of microil ptterns y Toll-like receptors (TLRs) is
More informationsupplementary information
DOI: 10.1038/nc2089 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 5 PN N1-2 PN H3K4me1 H3K4me1 H3K4me1 2-cell stge 2-c st cell ge Figure S1 Pttern of loclistion of H3K4me1 () nd () during zygotic development
More informationAdipocyte in vascular wall can induce the rupture of abdominal aortic aneurysm
Adipocyte in vsculr wll cn induce the rupture of dominl ortic neurysm Hiron Kugo 1 *, Nouhiro Zim 1 *, Hiroki Tnk 2 *, Youhei Mouri 1, Kenichi Yngimoto 3, Kohsuke Hymizu 3,4, Keisuke Hshimoto 1, Tkeshi
More informationGene regulation mediated by calcium signals in T lymphocytes
Gene regultion medited y clcium signls in T lymphocytes Stefn Feske 1, Jen Giltnne 2, Ricrdo Dolmetsch 3, Louis M. Studt 2 nd Anjn Ro 1 Modultion of mny signling pthwys in ntigen-stimulted T nd B cells
More informationSupplementary Materials. Viral delivery of mir-196a ameliorates the SBMA phenotype via the silencing of CELF2
Supplementry Mterils Virl delivery of mir-96 meliortes the SBMA phenotype vi the silencing of CELF2 Yu Miyzki, Hiroki Adchi, Mshis Ktsuno, Mkoto Minmiym, Yue-Mei Jing, Zhe Hung, Hideki Doi, Shinjiro Mtsumoto,
More informationThe endoplasmic reticulum is the site of cholesterol-induced cytotoxicity in macrophages
The endoplsmic reticulum is the site of cholesterol-induced cytotoxicity in mcrophges Bo Feng 1, Pin Mei Yo 1, Ynkun Li 1, Cecili M. Devlin 1, Djun Zhng 1, Hether P. Hrding 2, Michele Sweeney 3, Jmes X.
More informationLHb VTA. VTA-projecting RMTg-projecting overlay. Supplemental Figure 2. Retrograde labeling of LHb neurons. a. VTA-projecting LHb
SUPPLEMENTARY INFORMATION Supplementl Figure 1 doi:10.1038/nture09742 Lterl 1.0 mm from midline mpfc BNST mpfc BNST Lterl 2.1 mm from midline LHA LHA Lterl 2.7 mm from midline SUPPLEMENTAL INFORMATION
More informationSupplementary Information. Title: RAS-MAPK dependence underlies a rational polytherapy strategy in EML4-
Supplementry Informtion Title: RAS-MAPK dependence underlies rtionl polytherpy strtegy in EML4- ALK positive lung cncer Authors: Gorjn Hrustnovic, Victor Olivs, Evngelos Pzrentzos, Asmin Tulpule, Surh
More informationDNA released from dying host cells mediates aluminum adjuvant activity
DNA relesed from dying host cells medites luminum djuvnt ctivity Thoms Mrichl 1, Keiichi Oht 2, Denis Bedoret 1, Clire Mesnil 1, Ctherine Stel 1, Kouji Koiym 2,3, Pierre Lekeux 1, Cevyir Con 2, Shizuo
More informationChow KD CR HFD. Fed Fast Refed
Supplementry Figure 1 Control d/d Chow KD CR Fed Fst Refed Supplementry Figure 1: Liver expression in diet nd disese models. () expression in the livers of ontrol nd d/d mie. () expression in the livers
More informationSupplementary Fig. 1. Aortic micrornas are differentially expressed in PFM v. GFM.
Reltive expression 5 1 15 2-5 5 (n = 3) (n = 3) GFM nd PFM PFM GFM mmu-mir-145 mmu-mir-143 mmu-mir-72 mmu-mir-22 mmu-mir-27 mmu-mir-125-5p mmu-mir-23 mmu-mir-29 mmu-mir-126-3p mmu-let-7d mmu-let-7c mmu-mir-199-3p
More informationCos7 (3TP) (K): TGFβ1(h): (K)
IP#2: IP#1: Totl Lystes luiferse tivity (K): 6-4 - (K): luiferse tivity luiferse tivity (K): 2 1 RL-: - + + + + + Sm4-3F: + - + + + + MYC-Sm3: - - - - + + TβRI-HA(T204D): - - - + - + α-ha Luiferse Ativity
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1849 neurotoxic insults cute synptic dysfunctions chronic cognitive deficits epigenetic lockde of gene trnscription e.g. Bdnf IV, synptophysin neurotoxic insults Aβ H 2 O 2 Cdk5/p25 P GR1
More informationGinsenoside from Panax ginseng Meyer Enhances the Cytotoxic and Apoptotic Effect of Cisplatin in A549 Human Lung Cancer Cells
Ginsenoside from Pnx ginseng Meyer Enhnces the ytotoxic nd Apoptotic Effect of ispltin in A549 Humn Lung ncer ells J. K. PARK, V. ASTRO-AEITUNO, S. AHN, S. Y. SIMU 1, M. H. SIDDIQI 1, D. H. KIM, Y. J.
More informationSUPPLEMENTARY INFORMATION
% ells with ili (mrke y A-Tu) Reltive Luiferse % ells with ili (mrke y Arl13) % ells with ili DOI: 1.138/n2259 A-Tuulin Hoehst % Cilite Non-ilite -Serum 9% 8% 7% 1 6% % 4% +Serum 1 3% 2% 1% % Serum: -
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient
More informationEffect of Aqueous Extract of Carica papaya Dry Root Powder on Lactation of Albino Rats
Effect of Aqueous Extrct of Cric ppy Dry Root Powder on Lcttion of Alino Rts G. Tosswnchuntr nd S. Aritjt Deprtment of Biology Fculty of Science Ching Mi University Ching Mi 50200 Thilnd Keywords: mmmry
More informationSESSIONE I: RELATORI. Ghrelin: from oroxigenic signal to metabolic master regulator?
SESSIONE I: RELATORI Ghrelin: from oroxigenic signl to metbolic mster regultor? Prof. Rocco Brzzoni Professore ssocito di Medicin Intern Università degli Studi di Trieste Ghrelin: d segnle oressizznte
More informationCalcineurin imposes T cell unresponsiveness through targeted proteolysis of signaling proteins
Clcineurin imposes T cell unresponsiveness through trgeted proteolysis of signling proteins Vigo Heissmeyer, Fernndo Mcián,5, Sin-Hyeog Im,5, Rjt Vrm 2, Stefn Feske, K Venuprsd 3, Hu Gu 4, Yun-Ci Liu 3,
More informationOptimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality
Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,
More informationControl vector. HA-Elfn2. HA-Elfn1
Control vector c HA-Elfn2 HA- Control vector HA-Elfn2 HA- nti- nti-ha Hippocmpus (CA3) PV DAPI SOM DAPI Hippocmpus (dentte gyrus) PV DAPI SOM DAPI Supplementry Figure 1. Specificity of the nti- ntiody
More informationFeeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
More informationSUPPLEMENTARY INFORMATION
DOI: 1.13/n7 Reltive Pprg mrna 3 1 1 Time (weeks) Interspulr Inguinl Epididyml Reltive undne..1.5. - 5 5-51 51-1 1-7 7 - - 1 1-1 Lipid droplet size ( m ) 1-3 3 - - - 1 1-1 1-1 1-175 175-3 3-31 31-5 >5
More informationSUPPLEMENTARY INFORMATION
doi:0.08/nture0987 SUPPLEMENTARY FIGURE Structure of rbbit Xist gene. Exons re shown in boxes with romn numbers, introns in thin lines. Arrows indicte the locliztion of primers used for mplifiction. WWW.NATURE.COM/NATURE
More information