SUPPLEMENTARY FIGURE LEGENDS
|
|
- Theodore French
- 5 years ago
- Views:
Transcription
1 SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1 Negative correlation between mir-375 and its predicted target genes, as demonstrated by gene set enrichment analysis (GSEA). 1 The correlation between expression levels of mir-375 and 19,389 genes was calculated using matched mirna and mrna data from 98 prostate tumors in the Taylor cohort. 2 Genes were subsequently ranked according to Pearson correlation coefficient (r) value (shown by a heat map), and GSEA (Preranked analysis) was implemented using the Broad Institute s public GenePattern server, using default parameters. Lists of predicted mir-375 target genes were downloaded from TargetRank 3 and TargetScan 4 websites. Running enrichment scores are plotted (top graph) and normalized enrichment scores (NES) and P values are indicated. Supplementary Figure 2 Correlation between mir-375 and genes altered in prostate cancer, as demonstrated by GSEA. See Supplementary Figure Legend 1 for more detail on the methodology. The gene sets 5-7 were obtained from MSigDB. Plots on the left are gene sets down-regulated in prostate cancer, which are negatively with mir-375. Plots on the right are gene sets upregulated in prostate cancer, which are positively with mir-375. Supplementary Figure 3 Negative correlation between mir-375 and EMT gene sets, as demonstrated by GSEA. See Supplementary Figure Legend 1 for more detail on the methodology. The gene sets 8-1 were obtained from MSigDB. Supplementary Figure 4 (A) MiR-375 inhibits migration of DU145 and C4-2B cells. (B) MiR-375 inhibits growth of DU145 and C4-2B cells. Live and dead cells were counted using Trypan blue assays. P values were determined using unpaired t tests (NS, not significant; **, P <.1). Supplementary Figure 5 (A) Knockdown of YAP1 inhibits migration of DU145 and C4-2B cells. (B) Knockdown of YAP1 inhibits growth of DU145 and C4-2B cells. Live and dead cells were counted using Trypan blue assays. P values were determined using unpaired t tests (**, P <.1; ***, P <.1; ****, ). Supplementary Figure 6 Dose-dependent over-expression of FLAG-tagged YAP1 (FLAG-YAP1) in C4-2B cells. Cells were transfected with the indicated amount of expression vector and two days later total protein was assessed by Western blotting using an antibody (sc-1547; Santa Cruz) that detects both the FLAG-tagged form and the endogenous YAP1. Supplementary Figure 7 Deletion of E-box-like motifs 3 (Δ3), 4 (Δ4) or both (Δ3,4) does not affect ZEB1 regulation of the mir-375 promoter. DU145 cells were transfected with either control (sictrl) or ZEB1 sirna (sizeb1) and the indicated pgl4 constructs and luciferase activity measured. Bars represent the average of 6 wells per treatment, and error bars are ± SEM. P values were determined using unpaired t tests (*, P <.5; **, P <.1).
2 Supplementary Figure 8 ZEB1 and YAP1 are negatively with mir-375 and positively with each other. Graphs show correlations in 177 tumors from the TCGA dataset; data was obtained from The Cancer Genome Atlas (TCGA) data portal. P and r values were calculated using Pearson s tests. Supplementary Figure 9 mir-375 is positively with an androgen signaling signature 11 in the Taylor (left) and TCGA (right) cohorts. See Supplementary Figure Legend 1 for more detail on the methodology.
3 Input gene lists: mir-375 predicted targets TargetRank TargetScan NES = NES = Positively Negatively Supplementary Figure 1
4 Input gene lists: Genes down-regulated in prostate cancer Input gene lists: Genes up-regulated in prostate cancer NES = NES = 3.64 NES = NES = 1.98 NES = NES = 2.32 Positively Negatively Supplementary Figure 2
5 Input gene lists: Genes upregulated during EMT NES = NES = NES = -3.4 NES = Positively Negatively Supplementary Figure 3
6 A Relative wound density (%) DU NC 2 mir Time (hours) C4-2B NC 2 mir Time (hours) B Cell count x DU145 ** ** Cell count x C4-2B NC mir-375 NC mir-375 ** Supplementary Figure 4
7 A Relative wound density (%) DU145 4 sictrl 2 siyap Time (hours) C4-2B sictrl 2 siyap Time (hours) B Cell count x DU145 *** **** Cell count x C4-2B sictrl siyap1 sictrl siyap1 ** Supplementary Figure 5
8 Mock 5 YAP1 expression vector (ng) FLAG-YAP1 YAP1 Ponceau (total protein) Supplementary Figure 6
9 4 sictrl * Luciferase activity sizeb1 ** ** Empty 3 4 3,4 pgl4 reporter constructs Supplementary Figure 7
10 Normalized YAP1 expression p <.1 r = Normalized mir-375 expression 2 Normalized ZEB1 expression p <.1 7 r = Normalized mir-375 expression 2 Normalized YAP1 expression p <.1 9 r = Normalized ZEB1 expression Supplementary Figure 8
11 Input gene lists: Genes upregulated by androgen treatment in prostate cancer cells Taylor cohort TCGA cohort NES = 1.91 P =.34 NES = 1.69 P =.6 Positively Negatively Supplementary Figure 9
12 Supplementary Table 1. Circulating tumor cell (CTC) counts in a cohort of men with metastatic castration-resistant prostate cancer. Sample identification CTC count 1_ _2 46 1_4 84 2_1 1 2_2 2 3_1 3_1 3_2 3_3 3_4 1 3_5 3_6 3_8 3_9 1 4_1 4_1 4_2 4_3 4_4 1 4_5 4_6 4_7 4_8 4_9 5_1 9 5_1 2 5_11 9 5_2 4 5_3 5_4 5_6 5_7 5_8 6_1 1 6_1 6_11 3 6_2 6_3 6_5 6_6 14 6_7 5 6_9 3 7_1 7_1 7_2 7_3 7_4 7_5 7_6 7_7 7_8 7_9
13 REFERENCES FOR SUPPLEMENTARY DATA 1 Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA et al. Gene set enrichment analysis: a knowledge-based approach for interpreting genomewide expression profiles. Proc Natl Acad Sci U S A 25; 12: Taylor BS, Schultz N, Hieronymus H, Gopalan A, Xiao Y, Carver BS et al. Integrative genomic profiling of human prostate cancer. Cancer Cell 21; 18: Nielsen CB, Shomron N, Sandberg R, Hornstein E, Kitzman J, Burge CB. Determinants of targeting by endogenous and exogenous micrornas and sirnas. RNA 27; 13: Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microrna targets. Cell 25; 12: Liu P, Ramachandran S, Ali Seyed M, Scharer CD, Laycock N, Dalton WB et al. Sex-determining region Y box 4 is a transforming oncogene in human prostate cancer cells. Cancer Res 26; 66: Tomlins SA, Mehra R, Rhodes DR, Cao X, Wang L, Dhanasekaran SM et al. Integrative molecular concept modeling of prostate cancer progression. Nature genetics 27; 39: Wallace TA, Prueitt RL, Yi M, Howe TM, Gillespie JW, Yfantis HG et al. Tumor immunobiological differences in prostate cancer between African-American and European-American men. Cancer Res 28; 68: Taube JH, Herschkowitz JI, Komurov K, Zhou AY, Gupta S, Yang J et al. Core epithelial-to-mesenchymal transition interactome gene-expression signature is associated with claudin-low and metaplastic breast cancer subtypes. Proc Natl Acad Sci U S A 21; 17: Gotzmann J, Fischer AN, Zojer M, Mikula M, Proell V, Huber H et al. A crucial function of PDGF in TGF-beta-mediated cancer progression of hepatocytes. Oncogene 26; 25: Jechlinger M, Grunert S, Tamir IH, Janda E, Ludemann S, Waerner T et al. Expression profiling of epithelial plasticity in tumor progression. Oncogene 23; 22: Wang G, Jones SJ, Marra MA, Sadar MD. Identification of genes targeted by the androgen and PKA signaling pathways in prostate cancer cells. Oncogene 26; 25:
injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP SQ) and body
SUPPLEMENTAL FIGURE LEGENDS Figure S1: Generation of ENZR Xenografts and Cell Lines: (A) 1x10 6 LNCaP cells in matrigel were injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP
More informationa) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
More informationmir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,
More informationmicrorna-200b and microrna-200c promote colorectal cancer cell proliferation via
Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationSSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer.
Supplementary Figure 1 SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Scatter plots comparing expression profiles of matched pretreatment
More informationSupplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded
Supplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded from TCGA and differentially expressed metabolic genes
More informationSupplementary Figure 1. HeliScope CAGE revealed androgen-regulated signaling and differentially regulated promoters in hormone-refractory prostate
Supplementary Figure 1. HeliScope CAGE revealed androgen-regulated signaling and differentially regulated promoters in hormone-refractory prostate cancer cells. (a) Cell proliferation of BicR cells in
More informationSupplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.
Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the mutated sequence. 1 Supplementary Figure 2. Expression of mir-182 and SMAD7 in various cell lines. (A) Basal levels of mir-182 expression
More informationPackage inote. June 8, 2017
Type Package Package inote June 8, 2017 Title Integrative Network Omnibus Total Effect Test Version 1.0 Date 2017-06-05 Author Su H. Chu Yen-Tsung Huang
More informationHigh AU content: a signature of upregulated mirna in cardiac diseases
https://helda.helsinki.fi High AU content: a signature of upregulated mirna in cardiac diseases Gupta, Richa 2010-09-20 Gupta, R, Soni, N, Patnaik, P, Sood, I, Singh, R, Rawal, K & Rani, V 2010, ' High
More informationm 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
More informationBroad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes
Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes Kaifu Chen 1,2,3,4,5,10, Zhong Chen 6,10, Dayong Wu 6, Lili Zhang 7, Xueqiu Lin 1,2,8,
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, MD
AD Award Number: W81XWH-11-1-0126 TITLE: Chemical strategy to translate genetic/epigenetic mechanisms to breast cancer therapeutics PRINCIPAL INVESTIGATOR: Xiang-Dong Fu, PhD CONTRACTING ORGANIZATION:
More informationComparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
More informationInferring condition-specific mirna activity from matched mirna and mrna expression data
Inferring condition-specific mirna activity from matched mirna and mrna expression data Junpeng Zhang 1, Thuc Duy Le 2, Lin Liu 2, Bing Liu 3, Jianfeng He 4, Gregory J Goodall 5 and Jiuyong Li 2,* 1 Faculty
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.
Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown
More informationSupplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
More informationSupplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
More informationTable S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
More informationSupplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-
Supplementary Table S1. Tumor samples used for analysis Sample# Age Tumor size (cm) pn- Stage Stage BNG (grade) ERα PR HER2 (FISH) Triple negative T1 46 3 N1a III 2 Pos Neg N T2 58 1 N(i-) I 3 Pos Neg
More informationHALLA KABAT * Outreach Program, mircore, 2929 Plymouth Rd. Ann Arbor, MI 48105, USA LEO TUNKLE *
CERNA SEARCH METHOD IDENTIFIED A MET-ACTIVATED SUBGROUP AMONG EGFR DNA AMPLIFIED LUNG ADENOCARCINOMA PATIENTS HALLA KABAT * Outreach Program, mircore, 2929 Plymouth Rd. Ann Arbor, MI 48105, USA Email:
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationNature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.
Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated
More informationSupplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
More informationSupplementary information for: Human micrornas co-silence in well-separated groups and have different essentialities
Supplementary information for: Human micrornas co-silence in well-separated groups and have different essentialities Gábor Boross,2, Katalin Orosz,2 and Illés J. Farkas 2, Department of Biological Physics,
More informationType of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
More informationHow To Use MiRSEA. Junwei Han. July 1, Overview 1. 2 Get the pathway-mirna correlation profile(pmset) and a weighting matrix 2
How To Use MiRSEA Junwei Han July 1, 2015 Contents 1 Overview 1 2 Get the pathway-mirna correlation profile(pmset) and a weighting matrix 2 3 Discovering the dysregulated pathways(or prior gene sets) based
More informationA Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
More informationSUPPLEMENTARY INFORMATION
doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured
More informationSupplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
More informationBhatnagar et al, 2010 Cell Death and Disease Manuscript # CDDIS T
Bhatnagar et al, Cell Death and Disease Manuscript # CDDIS--98-T Supplemental Materials. Supplemental Figure Legends Supplemental Figure (A) WPE-NA and WPE-NB6 cells were treated with 4 nm of Docetaxel
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
More informationEphrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry
SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41564-017-0080-8 In the format provided by the authors and unedited. Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus
More informationPredictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)
Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d
More informationSupplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical
Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical representation using all SNPs (n= 13,515,798) including the region on chromosome 1 including SORT1 which was previously
More informationSupplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
More informationChapter 2. Investigation into mir-346 Regulation of the nachr α5 Subunit
15 Chapter 2 Investigation into mir-346 Regulation of the nachr α5 Subunit MicroRNA s (mirnas) are small (< 25 base pairs), single stranded, non-coding RNAs that regulate gene expression at the post transcriptional
More informationSupplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian
More information<10. IL-1β IL-6 TNF + _ TGF-β + IL-23
3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSoft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
More informationBmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas
Wang et al. Journal of Hematology & Oncology (2016) 9:90 DOI 10.1186/s13045-016-0323-9 RESEARCH Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Open Access Xiaofeng
More informationEPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
More informationSupplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationCircular RNAs (circrnas) act a stable mirna sponges
Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding
More informationTEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge
a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More informationPackage AbsFilterGSEA
Type Package Package AbsFilterGSEA September 21, 2017 Title Improved False Positive Control of Gene-Permuting GSEA with Absolute Filtering Version 1.5.1 Author Sora Yoon Maintainer
More informationPackage GANPAdata. February 19, 2015
Type Package Title The GANPA Datasets Package Version 1.0 Date 2011-05-26 Package GANPAdata February 19, 2015 Author Zhaoyuan Fang, Weidong Tian and Hongbin Ji Maintainer Zhaoyuan Fang
More informationMicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL
MicroRNA expression profiling and functional analysis in prostate cancer Marco Folini s.c. Ricerca Traslazionale DOSL What are micrornas? For almost three decades, the alteration of protein-coding genes
More informationTITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer
AWARD NUMBER: W81XWH-14-1-0387 TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer PRINCIPAL INVESTIGATOR: Dr. Goberdhan Dimri, PhD CONTRACTING ORGANIZATION: George Washington University,
More informationSupplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
More informationTITLE: Small Molecule Inhibitors of ERG and ETV1 in Prostate Cancer
AD Award Number: W81XWH-12-1-0399 TITLE: Small Molecule Inhibitors of ERG and ETV1 in Prostate Cancer PRINCIPAL INVESTIGATOR: Colm Morrissey CONTRACTING ORGANIZATION: University of Washington Seattle WA
More informationPBX3/MEK/ERK1/2/LIN28/let-7b positive feedback loop enhances mesenchymal phenotype to promote glioblastoma migration and invasion
Xu et al. Journal of Experimental & Clinical Cancer Research (2018) 37:158 https://doi.org/10.1186/s13046-018-0841-0 RESEARCH PBX3/MEK/ERK1/2/LIN28/let-7b positive feedback loop enhances mesenchymal phenotype
More informationSupplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
More informationNature Genetics: doi: /ng Supplementary Figure 1. SEER data for male and female cancer incidence from
Supplementary Figure 1 SEER data for male and female cancer incidence from 1975 2013. (a,b) Incidence rates of oral cavity and pharynx cancer (a) and leukemia (b) are plotted, grouped by males (blue),
More informationOn the Reproducibility of TCGA Ovarian Cancer MicroRNA Profiles
On the Reproducibility of TCGA Ovarian Cancer MicroRNA Profiles Ying-Wooi Wan 1,2,4, Claire M. Mach 2,3, Genevera I. Allen 1,7,8, Matthew L. Anderson 2,4,5 *, Zhandong Liu 1,5,6,7 * 1 Departments of Pediatrics
More informationInfect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SAM library or vector. Introduce AKT reporter
Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SM library or vector Introduce reporter Grow cells in presence of puromycin for 5 days Vector control SM library fewer surviving cells More surviving
More informationGene-microRNA network module analysis for ovarian cancer
Gene-microRNA network module analysis for ovarian cancer Shuqin Zhang School of Mathematical Sciences Fudan University Oct. 4, 2016 Outline Introduction Materials and Methods Results Conclusions Introduction
More informationGenetic alterations of histone lysine methyltransferases and their significance in breast cancer
Genetic alterations of histone lysine methyltransferases and their significance in breast cancer Supplementary Materials and Methods Phylogenetic tree of the HMT superfamily The phylogeny outlined in the
More information(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
More informationNature Genetics: doi: /ng.3731
Supplementary Figure 1 Circadian profiles of Adarb1 transcript and ADARB1 protein in mouse tissues. (a) Overlap of rhythmic transcripts identified in the previous transcriptome analyses. The mouse liver
More informationAn epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
More informationSUPPLEMENTAL FILE. mir-22 and mir-29a are members of the androgen receptor cistrome modulating. LAMC1 and Mcl-1 in prostate cancer
1 SUPPLEMENTAL FILE 2 3 mir-22 and mir-29a are members of the androgen receptor cistrome modulating LAMC1 and Mcl-1 in prostate cancer 4 5 6 Lorenza Pasqualini 1, Huajie Bu 1,2, Martin Puhr 1, Narisu Narisu
More informationSupplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. Effect of mir mimics and anti-mirs on DTPs a, Representative fluorescence microscopy images of GFP vector control or mir mimicexpressing parental and DTP
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationP. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop,
Supplemental Data A Genetic Screen Implicates mirna-372 and mirna-373 As Oncogenes in Testicular Germ Cell Tumors P. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop, Remco
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationTable S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples.
Supplementary files Table S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples. Table S3. Specificity of AGO1- and AGO4-preferred 24-nt
More informationSupplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10866 a b 1 2 3 4 5 6 7 Match No Match 1 2 3 4 5 6 7 Turcan et al. Supplementary Fig.1 Concepts mapping H3K27 targets in EF CBX8 targets in EF H3K27 targets in ES SUZ12 targets in ES
More informationSupplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5
Supplementary Information Induction of p53-independent apoptosis by ectopic expression of in human liposarcomas Dhong Hyun Lee 1, *, Charles Forscher 1, Dolores Di Vizio 2, 3, and H. Phillip Koeffler 1,
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Illustration of the working of network-based SVM to confidently predict a new (and now confirmed) ASD gene. Gene CTNND2 s brain network neighborhood that enabled its prediction by
More informationSupplementary Figure 1: Comparison of acgh-based and expression-based CNA analysis of tumors from breast cancer GEMMs.
Supplementary Figure 1: Comparison of acgh-based and expression-based CNA analysis of tumors from breast cancer GEMMs. (a) CNA analysis of expression microarray data obtained from 15 tumors in the SV40Tag
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationDeciphering the Role of micrornas in BRD4-NUT Fusion Gene Induced NUT Midline Carcinoma
www.bioinformation.net Volume 13(6) Hypothesis Deciphering the Role of micrornas in BRD4-NUT Fusion Gene Induced NUT Midline Carcinoma Ekta Pathak 1, Bhavya 1, Divya Mishra 1, Neelam Atri 1, 2, Rajeev
More informationA Long Noncoding RNA Activated by TGF-b Promotes the Invasion-Metastasis Cascade in Hepatocellular Carcinoma
Article A Long Noncoding RNA Activated by TGF-b Promotes the Invasion-Metastasis Cascade in Hepatocellular Carcinoma Ji-hang Yuan, 1 Fu Yang, 1 Fang Wang, 1 Jin-zhao Ma, 1 Ying-jun Guo, 1 Qi-fei Tao, 2
More information7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
More informationp.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11
ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationTMA-VARESE COHORT-1 TMA-BERN COHORT-2
Supplementary Figure 1 TMA-VARESE COHORT-1 TOTAL SAMPLES #5 GLEASON SCORE Number Percentage 6 16 32% = 7 17 34% >7 17 34% TUMOR STAGE T2C 28 56% T3A- 21 42% T3C-T4 1 2% NODE STATUS N 42 84% N1 8 16% PSA
More informationFile Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'
More informationComputational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project
Computational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project Introduction RNA splicing is a critical step in eukaryotic gene
More informationTRPM8 in the negative regulation of TNFα expression during cold stress
in the negative regulation of TNFα expression during cold stress Xin-Pei Wang 1, Xuan Yu 1, Xiao-Jin Yan 1, Fan Lei 2, Yu-Shuang Chai 1, Jing-Fei Jiang 1, Zhi- Yi Yuan 1, Dong-Ming Xing 1, Li-Jun Du 1*
More informationResearch Article Base Composition Characteristics of Mammalian mirnas
Journal of Nucleic Acids Volume 2013, Article ID 951570, 6 pages http://dx.doi.org/10.1155/2013/951570 Research Article Base Composition Characteristics of Mammalian mirnas Bin Wang Department of Chemistry,
More informationSUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies
More informationSupplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
More informationPID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB
SUPPLEMENTARY FIGURES: PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB Jingying Xu, Xiuhai Ren, Anup Singh Pathania, G. Esteban Fernandez,
More informationOncogenic mir-210-3p promotes prostate cancer cell EMT and bone metastasis via NF-κB signaling pathway
Ren et al. Molecular Cancer (2017) 16:117 DOI 10.1186/s12943-017-0688-6 RESEARCH Open Access Oncogenic mir-210-3p promotes prostate cancer cell EMT and bone metastasis via NF-κB signaling pathway Dong
More informationMiR-181a promotes epithelial to mesenchymal transition of prostate cancer cells by targeting TGIF2
European Review for Medical and Pharmacological Sciences 2017; 21: 4835-4843 MiR-181a promotes epithelial to mesenchymal transition of prostate cancer cells by targeting TGIF2 C. ZHIPING 1,2, T. SHIJUN
More informationAward Number: W81XWH TITLE: Characterizing an EMT Signature in Breast Cancer. PRINCIPAL INVESTIGATOR: Melanie C.
AD Award Number: W81XWH-08-1-0306 TITLE: Characterizing an EMT Signature in Breast Cancer PRINCIPAL INVESTIGATOR: Melanie C. Bocanegra CONTRACTING ORGANIZATION: Leland Stanford Junior University Stanford,
More informationPackage TargetScoreData
Title TargetScoreData Version 1.14.0 Author Yue Li Package TargetScoreData Maintainer Yue Li April 12, 2018 Precompiled and processed mirna-overexpression fold-changes from 84 Gene
More informationCONTRACTING ORGANIZATION: Baylor College of Medicine Houston, TX 77030
AD Award Number: W81XWH-05-1-0428 TITLE: MicroRNA and Breast Cancer Progression PRINCIPAL INVESTIGATOR: Konstantin Galaktionov, Ph.D. CONTRACTING ORGANIZATION: Baylor College of Medicine Houston, TX 77030
More information