Molecular Methods in the Diagnosis and Prognostication of Melanoma: Pros & Cons

Size: px
Start display at page:

Download "Molecular Methods in the Diagnosis and Prognostication of Melanoma: Pros & Cons"

Transcription

1 Molecular Methods in the Diagnosis and Prognostication of Melanoma: Pros & Cons Ben J. Friedman, MD Senior Staff Physician Department of Dermatology Department of Pathology and Laboratory Medicine Henry Ford Hospital, Detroit, MI, USA

2 Disclosures I have no conflicts of interest

3 Question Can adjunctive molecular assays help us make more accurate diagnoses and prognosticate better? 3

4 Outline Diagnosis 1. Array Comparative Genomic Hybridization (acgh) 2. Fluorescence In-Situ Hybridization (FISH) Multiprobe Assay 3. MyPath [Gene Expression Profiling (qrt-pcr)] Prognosis 4. Decision Dx-Melanoma TM [Gene Expression Profiling (qrt-pcr)] 4

5 Problem Histopathologically ambiguous lesions common Misdiagnosis has consequences Thickness/ sentinel node limited predictive ability N Engl J Med Sep 28;355(13):

6 How often do you request ancillary molecular testing for ambiguous melanocytic lesions? Never < 5 times per 5 -> 20 times > 20 times year per year per year EXPERT PANEL 23% 51% 22% 4% AUDIENCE 0% 14% 57% 29% **Poll from 2018 American Society of Dermatopathology Annual Meeting, Chicago, IL** 6

7 Gold Standard Limitation for Diagnostic Assays Need substantially more data on long term clinical outcome in cases with ambiguous morphology! J Am Acad Derm Oct;75(4):

8 Array Comparative Genomic Hybridization (aka Chromosomal Microarray Analysis, SNP array) 8

9 Array CGH Detects and maps DNA copy # alterations (CNA) Multiple CNA common in melanoma (>95%) Nevi have no CNA or rarely n= 1 or n=2 Cancer Res May 15;58(10): Am J Pathol Nov;163(5): Dermatol Ther Jan-Feb;19(1):

10 JAAD Jun;72(6):943-58

11 11

12 Array CGH: Pros Surveys the whole genome Sensitivity and specificity for CNA > than FISH Degree of agreement with expert morphologists acgh > FISH > GEP Hum Pathol Dec 18. pii: S (18)30488 Mod Pathol Nov;31(11): Mod Pathol Aug;29(8):832-43

13 Array CGH: Cons Not for point mutations/ balanced translocations High tissue requirement (>0.4mm BD) Limited CNA: likelihood of progression? Cost: ~1800$ Turnaround time: ~3-4 weeks J Mol Diagn Sep;15(5):

14 FISH Multiprobe Assay 14

15 FISH Multiprobe Assay Fluorescent probes-> bind specific DNA segments Detects deleterious gains and losses (acgh data) 6p25, 8q24, 9p21, and 11q13 94% sensitive, 98% specific (n=102) Am J Surg Pathol. 2009;33(8): Am J Surg Pathol. 2012;36(6):

16 8q24 (MYC) Pathology Dec;49(7):

17 FISH Pros Less technical requirements than acgh Detection of malignant subpopulations Insurance more likely to cover Turnaround time ~5 days Am J Surg Pathol May;37(5):

18 FISH Cons Heterogeneity of melanoma Tetraploidy pitfall Poor performance in ambiguous lesions? Cost: ~$ Am J Surg Pathol May;37(5): Am J Surg Pathol Dec;37(12): Ann Diagn Pathol Jun;28:

19 mypath [GEP (qrt-pcr)] 19

20 20

21 GEP (mypath ) Validation study n=1400 specimens Triple DP consensus, lack of indeterminate score, and samples >10% tumor volume n=736 specimens Sensitivity: 91.5%, Specificity 92.5% Cancer Feb 15;123(4):

22 GEP [mypath ]: Pros Tumor-immune microenvironment Cell differentiation, cell signaling, immune response Lower tissue requirement than acgh Turnaround time ~7 days J Cutan Pathol Apr;42(4):

23 GEP [mypath ]: Cons Indeterminate scores: up to 16% Insufficient RNA: up to 8% Not for: recurrent lesions, re-excisions, immunosuppressed Reliability in ambiguous lesions unknown Cost: 1950$ Cancer Feb 15;123(4):

24 Molecular Prognostication of Melanoma 24

25 TNM staging AJCC 7th Edition Cancer Staging- Cutaneous Melanoma 25

26 Decision DxMelanomaTM [GEP (qrt-pcr)] 26

27 Prognostic 31-gene signature Clin Cancer Res Jan 1;21(1):

28 GEP (Decision Dx) Low risk (class 1) & high risk (class 2) enhanced surveillance of high risk adjuvant/ earlier therapy for high risk reduce anxiety for low risk Clin Cancer Res Jan 1;21(1):

29 29

30 n=523; stage 1, 2, and 3 J Am Acad Derm Jan;80(1):

31 GEP (Decision DxTM): Pros Strong independent prognostic indicator NPV of Class 1A: >/= ~85% GEP+SNL status: better risk stratification J Am Acad Dermatol May;72(5):780-5.e3 BMC Cancer Feb 5;18(1):130 31

32 GEP (Decision DxTM): Cons PPV of Class 2 in AJCC Stage 1= ~10% or less Weak evidence for radiologic screening Cost effective? => $8,000 Dermatol Surg Dec;44(12): BMC Cancer Feb 5;18(1):130 J Am Acad Derm Jan;80(1):

33 Conclusion acgh, FISH, GEP (mypath ) are promising adjuncts to histopathology LTO data in ambiguous tumors limited GEP (mypath ): need independent nonmanufacturer conducted studies 33

34 Conclusion GEP (Decision Dx TM) = independent prognostic parameter Need prospective studies -> clinical utility Low PPV in stage 1, may limit use to thicker tumors in conjunction with SNL status 34

35 References 1. Cancer Res May 15;58(10): Am J Pathol Nov;163(5): Dermatol Ther Jan-Feb;19(1): Hum Pathol Dec 18. pii: S (18) Mod Pathol Nov;31(11): Mod Pathol Aug;29(8): J Mol Diagn Sep;15(5): Am J Surg Pathol. 2009;33(8): Am J Surg Pathol. 2012;36(6): Am J Surg Pathol Dec;37(12): Ann Diagn Pathol Jun;28: J Cutan Pathol Apr;42(4):

36 References 13. Cancer Feb 15;123(4): Cancer Epidemiol Biomarkers Prev Jul;26(7): Hum Pathol Dec 16. pii: S (18) doi 16. J Invest Dermatol Apr;135(4): N Engl J Med Sep 28;355(13): Dermatol Surg Dec;44(12): Clin Cancer Res Jan 1;21(1): J Am Acad Dermatol May;72(5):780-5.e3 21. J Am Acad Derm Jan;80(1): Am J Surg Pathol May;37(5): Pathology Dec;49(7):

Page 1 of 3. We suggest the following changes:

Page 1 of 3. We suggest the following changes: Page 1 of 3 Loren E. Clarke, M.D. Myriad Genetic Laboratories, Inc. 320 Wakara Way, Salt Lake City, UT 84108 Phone: 801.883.3470 Email: lclarke@myriad.com Date of Request: June 2017 NCCN Guidelines Panel:

More information

Genetic Testing: When should it be ordered? Julie Schloemer, MD Dermatology

Genetic Testing: When should it be ordered? Julie Schloemer, MD Dermatology Genetic Testing: When should it be ordered? Julie Schloemer, MD Dermatology Outline Germline testing CDKN2A BRCA2 BAP1 Somatic testing Gene expression profiling (GEP) BRAF Germline vs Somatic testing

More information

I have no relevant conflicts of interest to disclose. John T. Seykora MD PhD Departments of Dermatology & Pathology and Laboratory Medicine

I have no relevant conflicts of interest to disclose. John T. Seykora MD PhD Departments of Dermatology & Pathology and Laboratory Medicine Molecular Characterization of Stage 1-3 Melanoma: Are we close to accurate prognostication and prediction? I have no relevant conflicts of interest to disclose. John T. Seykora MD PhD Departments of Dermatology

More information

Which melanoma patients benefit from genetic testing?

Which melanoma patients benefit from genetic testing? Which melanoma patients benefit from genetic testing? Michael A. Marchetti, MD Assistant Attending, Dermatology Service Memorial Sloan Kettering Cancer Center American Academy of Dermatology Annual Meeting

More information

MAPK Pathway. CGH Next Generation Sequencing. Molecular Tools in Care of Patients with Pigmented Lesions 7/20/2017

MAPK Pathway. CGH Next Generation Sequencing. Molecular Tools in Care of Patients with Pigmented Lesions 7/20/2017 Molecular Tools in Care of Patients with Pigmented Lesions Tammie Ferringer, MD Geisinger Medical Center, Danville, PA tferringer@geisinger.edu DISCLOSURE OF RELATIONSHIPS WITH INDUSTRY Tammie Ferringer,

More information

Update on Genetic Testing for Melanoma

Update on Genetic Testing for Melanoma Update on Genetic Testing for Melanoma Emily Y. Chu, M.D., Ph.D. Assistant Professor of Dermatology & Pathology and Laboratory Medicine Hospital of the University of Pennsylvania February 18, 2018 AAD

More information

> 6000 Mutations in Melanoma. Tests That Cay Be Employed. FISH for Additions/Deletions. Comparative Genomic Hybridization

> 6000 Mutations in Melanoma. Tests That Cay Be Employed. FISH for Additions/Deletions. Comparative Genomic Hybridization Winter Clinical 2017: The Assessment and Diagnosis of Melanoma Whitney A. High, MD, JD, MEng Associate Professor, Dermatology & Pathology Director of Dermatopathology (Dermatology) University of Colorado

More information

There is NO single Melanoma Stain. > 6000 Mutations in Melanoma. What else can be done to discriminate atypical nevi from melanoma?

There is NO single Melanoma Stain. > 6000 Mutations in Melanoma. What else can be done to discriminate atypical nevi from melanoma? Las Vegas Fall Clinical 2016: The Assessment and Diagnosis of Melanoma Whitney A. High, MD, JD, MEng Associate Professor, Dermatology & Pathology Director of Dermatopathology (Dermatology) University of

More information

Gene Expression Profiling for Melanoma

Gene Expression Profiling for Melanoma Medical Policy Manual Genetic Testing, Policy No. 29 Gene Expression Profiling for Melanoma Next Review: April 2019 Last Review: April 2018 Effective: June 1, 2018 IMPORTANT REMINDER Medical Policies are

More information

Michael T. Tetzlaff MD, PhD

Michael T. Tetzlaff MD, PhD Molecular alterations informing the diagnosis of melanocytic tumors Michael T. Tetzlaff MD, PhD Associate Professor Department of Pathology, Section of Dermatopathology Department of Translational and

More information

Gene Expression Profiling for Cutaneous Melanoma

Gene Expression Profiling for Cutaneous Melanoma Gene Expression Profiling for Cutaneous Melanoma Policy Number: 2.04.146 Last Review: 8/1/2018 Origination: 08/2018 Next Review: 8/1/2019 Policy Blue Cross and Blue Shield of Kansas City (Blue KC) will

More information

DECISIONDx BIOMARKER TESTS

DECISIONDx BIOMARKER TESTS DECISIONDx BIOMARKER TESTS Non-Discrimination Statement and Multi-Language Interpreter Services information are located at the end of this document. Coverage for services, procedures, medical devices and

More information

FEP Medical Policy Manual

FEP Medical Policy Manual FEP Medical Policy Manual Last Review: December 2016 Effective Date: January 15, 2017 Related Policies None Gene Expression Profiling for Uveal Melanoma Summary Uveal melanoma is associated with a high

More information

6/22/2015. Original Paradigm. Correlating Histology and Molecular Findings in Melanocytic Neoplasms

6/22/2015. Original Paradigm. Correlating Histology and Molecular Findings in Melanocytic Neoplasms 6 Correlating Histology and Molecular Findings in Melanocytic Neoplasms Pedram Gerami MD, Associate Professor of Dermatology and Pediatrics at Northwestern University Disclosures: I have been a consultant

More information

Medical Policy An independent licensee of the Blue Cross Blue Shield Association

Medical Policy An independent licensee of the Blue Cross Blue Shield Association Gene Expression Profiling for Cutaneous Melanoma Page 1 of 28 Medical Policy An independent licensee of the Blue Cross Blue Shield Association Title: Gene Expression Profiling for Cutaneous Melanoma Professional

More information

Vernon K. Sondak. Department of Cutaneous Oncology Moffitt Cancer Center Tampa, Florida

Vernon K. Sondak. Department of Cutaneous Oncology Moffitt Cancer Center Tampa, Florida Vernon K. Sondak Department of Cutaneous Oncology Moffitt Cancer Center Tampa, Florida Australasian Melanoma Conference 2016 Sydney, NSW, Australia October 29, 2016 Disclosures Dr. Sondak is a compensated

More information

Talk to Your Doctor. Fact Sheet

Talk to Your Doctor. Fact Sheet Talk to Your Doctor Hearing the words you have skin cancer is overwhelming and would leave anyone with a lot of questions. If you have been diagnosed with Stage I or II cutaneous melanoma with no apparent

More information

Melanoma and the genes: Molecular alterations informing the diagnosis of melanocytic tumors

Melanoma and the genes: Molecular alterations informing the diagnosis of melanocytic tumors Melanoma and the genes: Molecular alterations informing the diagnosis of melanocytic tumors Michael T. Tetzlaff MD, PhD Associate Professor Department of Pathology, Section of Dermatopathology Department

More information

Corporate Medical Policy

Corporate Medical Policy Corporate Medical Policy Gene Expression Profiling for Cutaneous Melanoma File Name: Origination: Last CAP Review: Next CAP Review: Last Review: gene_expression_profiling_for_cutaneous_melanoma 5/2018

More information

Flu Watch. MMWR Week 3: January 14 to January 20, and Deaths. Virologic Surveillance. Influenza-Like Illness Surveillance

Flu Watch. MMWR Week 3: January 14 to January 20, and Deaths. Virologic Surveillance. Influenza-Like Illness Surveillance Flu Watch MMWR Week 3: January 14 to January 2, 218 All data are provisional and subject to change as more reports are received. Geographic Spread South Carolina reported widespread activity this week.

More information

Molecular Aspects of Melanocytic Neoplasia. Iwei Yeh MD, PhD University of California, San Francisco

Molecular Aspects of Melanocytic Neoplasia. Iwei Yeh MD, PhD University of California, San Francisco Molecular Aspects of Melanocytic Neoplasia Iwei Yeh MD, PhD University of California, San Francisco Thanks to: Boris Bastian Timothy McCalmont Philip LeBoit Beth Ruben Jeff North Laura Pincus Thaddeus

More information

MEDICAL POLICY. Proprietary Information of YourCare Health Plan

MEDICAL POLICY. Proprietary Information of YourCare Health Plan MEDICAL POLICY SUBJECT: HER-2 TESTING IN INVASIVE BREAST OR PAGE: 1 OF: 7 If the member's subscriber contract excludes coverage for a specific service it is not covered under that contract. In such cases,

More information

Breast cancer: Molecular STAGING classification and testing. Korourian A : AP,CP ; MD,PHD(Molecular medicine)

Breast cancer: Molecular STAGING classification and testing. Korourian A : AP,CP ; MD,PHD(Molecular medicine) Breast cancer: Molecular STAGING classification and testing Korourian A : AP,CP ; MD,PHD(Molecular medicine) Breast Cancer Theory: Halsted Operative breast cancer is a local-regional disease The positive

More information

Flu Watch. MMWR Week 4: January 21 to January 27, and Deaths. Virologic Surveillance. Influenza-Like Illness Surveillance

Flu Watch. MMWR Week 4: January 21 to January 27, and Deaths. Virologic Surveillance. Influenza-Like Illness Surveillance Flu Watch MMWR Week 4: January 21 to January 27, 218 All data are provisional and subject to change as more reports are received. Geographic Spread South Carolina reported widespread activity this week.

More information

Gene Expression Profiling for Cutaneous Melanoma

Gene Expression Profiling for Cutaneous Melanoma Applies to all products administered or underwritten by Blue Cross and Blue Shield of Louisiana and its subsidiary, HMO Louisiana, Inc.(collectively referred to as the Company ), unless otherwise provided

More information

The Pathology of Neoplasia Part II

The Pathology of Neoplasia Part II The Pathology of Neoplasia Part II February 2018 PAUL BOGNER, MD A S S O C I A T E P R O F E S S O R O F O N C O L O G Y P A T H O L O G Y A N D D E R M A T O L O G Y Clinical goals of cancer pathology

More information

Management of Atypical Pigmented Lesions

Management of Atypical Pigmented Lesions Management of Atypical Pigmented Lesions Jennifer A. Stein MD, PhD Associate Director, Pigmented Lesion Section Ronald O. Perelman Department of Dermatology NYU Langone Medical Center July 29, 2017 1-4

More information

Sharan Goobie, MD, MSc, FRCPC

Sharan Goobie, MD, MSc, FRCPC Sharan Goobie, MD, MSc, FRCPC Chromosome testing in 2014 Presenter Disclosure: Sharan Goobie has no potential for conflict of interest with this presentation Objectives Review of standard genetic investigations

More information

Melanocytic Lesions: Use of Immunohistochemistry and Special Studies Napa Valley 2018

Melanocytic Lesions: Use of Immunohistochemistry and Special Studies Napa Valley 2018 Melanocytic Lesions: Use of Immunohistochemistry and Special Studies Napa Valley 2018 Victor G. Prieto, MD, PhD Professor Depts. of Pathology and Dermatology University of Texas - MD Anderson Cancer Center

More information

Advances in Surgical Management of Primary Melanoma: Identifying Patients Who Need More than Conventional Wide Local Excision

Advances in Surgical Management of Primary Melanoma: Identifying Patients Who Need More than Conventional Wide Local Excision Advances in Surgical Management of Primary Melanoma: Identifying Patients Who Need More than Conventional Wide Local Excision Christopher J. Miller, MD Director of Penn Dermatology Oncology Center Associate

More information

Melanocytic proliferations in sundamaged

Melanocytic proliferations in sundamaged Atypical Spitzoid Tumor: What Does It Mean And How Should It Be Managed? Melanocytic proliferations in sundamaged skin Jane L. Messina, Jane L. Messina MD International Melanoma Pathology Working Group

More information

Application of Urovision FISH testing for diagnosis of bladder cancer

Application of Urovision FISH testing for diagnosis of bladder cancer Application of Urovision FISH testing for diagnosis of bladder cancer Eva M. Wojcik, MD Chair and Professor of Pathology and Urology Loyola University, Chicago, USA Bladder cancer - current status ~ 76,900

More information

Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the

Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the deep dermis. (b) The melanocytes demonstrate abundant

More information

Making the Most of Your Cancer Registry

Making the Most of Your Cancer Registry www.champsods.com Making the Most of Your Cancer Registry Presenter: Toni Hare, Vice President CHAMPS Oncology Data Services Picture of girl here December 11, 2009 Learning Objectives Upon completion of

More information

Translating Evidence into Practice: Primary Cutaneous Melanoma Guidelines. Sentinel Lymph Node Biopsy

Translating Evidence into Practice: Primary Cutaneous Melanoma Guidelines. Sentinel Lymph Node Biopsy American Academy of Dermatology 2018 Annual Meeting San Diego, CA, February 17, 2018 Translating Evidence into Practice: Primary Cutaneous Melanoma Guidelines. Sentinel Lymph Node Biopsy Christopher Bichakjian,

More information

The Enigmatic Spitz Lesion

The Enigmatic Spitz Lesion The Enigmatic Spitz Lesion The Dawn of Spitz S Spitz Sophie Spitz Melanomas of Childhood ; Am J Pathol 1948 1910-1956 13 children (18 mo - 12 yrs) 12/13 had a benign clinical course Sophie Spitz Born 1910

More information

Deep Dermatophytosis

Deep Dermatophytosis Deep Dermatophytosis 2016-11-06 MMTN/Bangkok Department of Dermatology Chang Gung Memorial Hospital, Linkou Branch Taoyuan, Taiwan Superficial dermatophytosis Wikimedia Stratum corneum Tinea faciei Tinea

More information

FISH mcgh Karyotyping ISH RT-PCR. Expression arrays RNA. Tissue microarrays Protein arrays MS. Protein IHC

FISH mcgh Karyotyping ISH RT-PCR. Expression arrays RNA. Tissue microarrays Protein arrays MS. Protein IHC Classification of Breast Cancer in the Molecular Era Susan J. Done University Health Network, Toronto Why classify? Prognosis Prediction of response to therapy Pathogenesis Invasive breast cancer can have

More information

Melanoma Update: 8th Edition of AJCC Staging System

Melanoma Update: 8th Edition of AJCC Staging System Melanoma Update: 8th Edition of AJCC Staging System Rosalie Elenitsas, M.D. Professor of Dermatology Director, Dermatopathology University of Pennsylvania DISCLOSURE OF RELATIONSHIPS WITH INDUSTRY None

More information

Telehealth Data for Syndromic Surveillance

Telehealth Data for Syndromic Surveillance Telehealth Data for Syndromic Surveillance Karen Hay March 30, 2009 Ontario Ministry of Health and Long-Term Care Public Health Division, Infectious Diseases Branch Syndromic Surveillance Ontario (SSO)

More information

MEDICAL POLICY. Proprietary Information of Excellus Health Plan, Inc. A nonprofit independent licensee of the BlueCross BlueShield Association

MEDICAL POLICY. Proprietary Information of Excellus Health Plan, Inc. A nonprofit independent licensee of the BlueCross BlueShield Association MEDICAL POLICY SUBJECT: HER-2 TESTING IN INVASIVE BREAST OR PAGE: 1 OF: 7 If a product excludes coverage for a service, it is not covered, and medical policy criteria do not apply. If a commercial product,

More information

Multigene Testing in NCCN Breast Cancer Treatment Guidelines, v1.2011

Multigene Testing in NCCN Breast Cancer Treatment Guidelines, v1.2011 Multigene Testing in NCCN Breast Cancer Treatment Guidelines, v1.2011 Robert W. Carlson, M.D. Professor of Medicine Stanford University Chair, NCCN Breast Cancer Treatment Guidelines Panel Selection of

More information

Durham Region Influenza Bulletin: 2017/18 Influenza Season

Durham Region Influenza Bulletin: 2017/18 Influenza Season Durham Region Influenza Bulletin: 2017/18 Influenza Season Surveillance Week 21 (May 20, 2018 to May 26, 2018) Table 1: Assessment of influenza activity in Durham Region Measure Laboratory confirmed cases

More information

Melanoma Surgery Update James R. Ouellette, DO FACS Premier Health Cancer Institute Wright State University Chief, Surgical Oncology Division

Melanoma Surgery Update James R. Ouellette, DO FACS Premier Health Cancer Institute Wright State University Chief, Surgical Oncology Division Melanoma Surgery Update 2018 James R. Ouellette, DO FACS Premier Health Cancer Institute Wright State University Chief, Surgical Oncology Division Surgery for Melanoma Mainstay of treatment for potentially

More information

Exploitation of Epigenetic Changes to Distinguish Benign from Malignant Prostate Biopsies

Exploitation of Epigenetic Changes to Distinguish Benign from Malignant Prostate Biopsies Exploitation of Epigenetic Changes to Distinguish Benign from Malignant Prostate Biopsies Disclosures MDxHealth Scientific Advisor 2 Case Study 54-year-old man referred for a PSA of 7 - Healthy, minimal

More information

Case presentation 04/13/2017. Genomic/morphological classification of endometrial carcinoma

Case presentation 04/13/2017. Genomic/morphological classification of endometrial carcinoma Genomic/morphological classification of endometrial carcinoma Robert A. Soslow, MD soslowr@mskcc.org architecture.about.com Case presentation 49 year old woman with vaginal bleeding Underwent endometrial

More information

Update on Lymph Node Management in Melanoma

Update on Lymph Node Management in Melanoma Update on Lymph Node Management in Melanoma John T. Vetto MD, FACS Professor of Surgery Division of Surgical Oncology Oregon Health & Science University Portland, Oregon Lymph Nodes in Melanoma Outline

More information

What s the Human Genome Project Got to Do with Developmental Disabilities?

What s the Human Genome Project Got to Do with Developmental Disabilities? What s the Human Genome Project Got to Do with Developmental Disabilities? Disclosures Neither speaker has anything to disclose. Phase Two: Interpretation Officially started in October 1990 Goals of the

More information

Providing Treatment Information for Prostate Cancer Patients

Providing Treatment Information for Prostate Cancer Patients Providing Treatment Information for Prostate Cancer Patients For all patients with localized disease on biopsy For all patients with adverse pathology after prostatectomy See what better looks like Contact

More information

Cytogenetics 101: Clinical Research and Molecular Genetic Technologies

Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these

More information

SNP Arrays in Cancer Diagnostics

SNP Arrays in Cancer Diagnostics 1 1. Introduction SNP Arrays in Cancer Diagnostics Federico A. Monzon, M.D. The Methodist Hospital Research Institute, Houston TX Detection of acquired chromosomal gains/losses in human tumors is clinically

More information

Impact of Prognostic Factors

Impact of Prognostic Factors Melanoma Prognostic Factors: where we started, where are we going? Impact of Prognostic Factors Staging Management Surgical intervention Adjuvant treatment Suraj Venna, MD Assistant Clinical Professor,

More information

MEDICAL POLICY SUBJECT: URINARY TUMOR MARKERS FOR BLADDER CANCER. POLICY NUMBER: CATEGORY: Technology Assessment

MEDICAL POLICY SUBJECT: URINARY TUMOR MARKERS FOR BLADDER CANCER. POLICY NUMBER: CATEGORY: Technology Assessment MEDICAL POLICY SUBJECT: URINARY TUMOR MARKERS FOR PAGE: 1 OF: 5 If a product excludes coverage for a service, it is not covered, and medical policy criteria do not apply. If a commercial product, including

More information

Updated Molecular Testing Guideline for the Selection of Lung Cancer Patients for Treatment with Targeted Tyrosine Kinase Inhibitors

Updated Molecular Testing Guideline for the Selection of Lung Cancer Patients for Treatment with Targeted Tyrosine Kinase Inhibitors Q: How is the strength of recommendation determined in the new molecular testing guideline? A: The strength of recommendation is determined by the strength of the available data (evidence). Strong Recommendation:

More information

The lymphoma-associated NPM-ALK oncogene elicits a p16ink4a/prb-dependent tumor-suppressive pathway. Blood Jun 16;117(24):

The lymphoma-associated NPM-ALK oncogene elicits a p16ink4a/prb-dependent tumor-suppressive pathway. Blood Jun 16;117(24): DNA Sequencing Publications Standard Sequencing 1 Carro MS et al. DEK Expression is controlled by E2F and deregulated in diverse tumor types. Cell Cycle. 2006 Jun;5(11) 2 Lassandro L et al. The DNA sequence

More information

Prenatal Diagnosis: Are There Microarrays in Your Future?

Prenatal Diagnosis: Are There Microarrays in Your Future? Financial Disclosure UCSF Antepartum Intrapartum Management Course June 8 I have no financial relationship with any aspect of private industry Prenatal Diagnosis: Are There Microarrays in Your Future?

More information

18 Week 92% Open Pathway Recovery Plan and Backlog Clearance

18 Week 92% Open Pathway Recovery Plan and Backlog Clearance 18 Week 92% Open Pathway Recovery Plan and Backlog Clearance Page 1 of 6 17.05.2012 1.0 Background 18-Week 92% Open Pathway RECOVERY PLAN The Trust has achieved compliance against the admitted and non-admitted

More information

Current Status of Biomarkers (including DNA Tumor Markers and Immunohistochemistry in the Laboratory Diagnosis of Tumors)

Current Status of Biomarkers (including DNA Tumor Markers and Immunohistochemistry in the Laboratory Diagnosis of Tumors) Current Status of Biomarkers (including DNA Tumor Markers and Immunohistochemistry in the Laboratory Diagnosis of Tumors) Kael Mikesell, DO McKay-Dee Hospital May 14, 2015 Outline Update to DNA Testing

More information

FAQs about Provider Profiles on Breast Cancer Screenings (Mammography) Q: Who receives a profile on breast cancer screenings (mammograms)?

FAQs about Provider Profiles on Breast Cancer Screenings (Mammography) Q: Who receives a profile on breast cancer screenings (mammograms)? FAQs about Provider Profiles on Breast Cancer Screenings (Mammography) Q: Who receives a profile on breast cancer screenings (mammograms)? A: We send letters and/or profiles to PCPs with female members

More information

CHROMOSOMAL MICROARRAY (CGH+SNP)

CHROMOSOMAL MICROARRAY (CGH+SNP) Chromosome imbalances are a significant cause of developmental delay, mental retardation, autism spectrum disorders, dysmorphic features and/or birth defects. The imbalance of genetic material may be due

More information

Do acgh analysis have a place in routine cytogenetic workup in leukemia/cancer? - A single institution experience. Cambridge, April 9 th 2013

Do acgh analysis have a place in routine cytogenetic workup in leukemia/cancer? - A single institution experience. Cambridge, April 9 th 2013 Do acgh analysis have a place in routine cytogenetic workup in leukemia/cancer? - A single institution experience. Cambridge, April 9 th 2013 Aarhus University Hospital Eigil Kjeldsen, Cancercytogenetic

More information

Associate Clinical Professor of Dermatology MUSC

Associate Clinical Professor of Dermatology MUSC Re-excision of Moderately Dysplastic Nevi: Should we or shouldn t we? John C. Maize, Jr, M.D. Dermatologist and Dermatopathologist Trident Dermatology, Charleston SC Associate Clinical Professor of Dermatology

More information

MALBAC Technology and Its Application in Non-invasive Chromosome Screening (NICS)

MALBAC Technology and Its Application in Non-invasive Chromosome Screening (NICS) MALBAC Technology and Its Application in Non-invasive Chromosome Screening (NICS) The Power of One Adapted from Internet Single Cell Genomic Studies Ultra Low Sample Input Advances and applications of

More information

Dr. dr. Primariadewi R, SpPA(K)

Dr. dr. Primariadewi R, SpPA(K) Curriculum Vitae Dr. dr. Primariadewi R, SpPA(K) Education : Medical Doctor from UKRIDA Doctoral Degree from Faculty of Medicine University of Indonesia Pathologist Specialist and Consultant from Faculty

More information

10/2/17. MELTUMP, SAMPUS, AST.An Algorithmic Approach to Challenging (Often Borderline) Melanocytic Tumors. An Introduction to SNP Arrays

10/2/17. MELTUMP, SAMPUS, AST.An Algorithmic Approach to Challenging (Often Borderline) Melanocytic Tumors. An Introduction to SNP Arrays MELTUMP, SAMPUS, AST.An Algorithmic Approach to Challenging (Often ) Melanocytic Tumors An Introduction to SNP Arrays Rajiv M. Patel, M.D. RCPA NZ ASM 2017 (11:45-12:30pm, Saturday, 23-09-17) Why do we

More information

Update on Spitzoid and Blue nevus-like melanocytic lesions Emphasis on molecular studies informing diagnosis, prognosis and therapy

Update on Spitzoid and Blue nevus-like melanocytic lesions Emphasis on molecular studies informing diagnosis, prognosis and therapy Update on Spitzoid and Blue nevus-like melanocytic lesions Emphasis on molecular studies informing diagnosis, prognosis and therapy Michael T. Tetzlaff MD, PhD Associate Professor Department of Pathology,

More information

Dr Catherine Woolnough, Hospital Scientist, Chemical Pathology, Royal Prince Alfred Hospital. NSW Health Pathology University of Sydney

Dr Catherine Woolnough, Hospital Scientist, Chemical Pathology, Royal Prince Alfred Hospital. NSW Health Pathology University of Sydney Dr Catherine Woolnough, Hospital Scientist, Chemical Pathology, Royal Prince Alfred Hospital NSW Health Pathology University of Sydney Thyroid Cancer TC incidence rates in NSW Several subtypes - Papillary

More information

Locally Advanced and Metastatic Melanoma. Relevant disclosures 6/23/2018. What is the median survival of metastatic melanoma? Abel D.

Locally Advanced and Metastatic Melanoma. Relevant disclosures 6/23/2018. What is the median survival of metastatic melanoma? Abel D. Locally Advanced and Metastatic Melanoma Abel D. Jarell, MD, FAAD Adjunct Dartmouth School of Medicine, Hanover, NH Northeast Dermatology Associates, Portsmouth, NH Relevant disclosures What is the median

More information

Quit Rates of New York State Smokers

Quit Rates of New York State Smokers Quit Rates of New York State Smokers Sara M. Abrams, MPH Data Manager NYS Smokers Quitline Sara.Abrams@roswellpark.org September 6, 20 Presentation Outline Basic Quitline Service How Quit Rates are defined

More information

Structural Variation and Medical Genomics

Structural Variation and Medical Genomics Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,

More information

FEP Medical Policy Manual

FEP Medical Policy Manual FEP Medical Policy Manual Effective Date: July 15, 2018 Related Policies: 8.01.10 Charged-Particle (Proton or Helium Ion) Radiotherapy for Neoplastic Conditions Gene Expression Profiling for Uveal Melanoma

More information

Morphologic characteristics of nevi associated with melanoma: a clinical, dermatoscopic and histopathologic analysis

Morphologic characteristics of nevi associated with melanoma: a clinical, dermatoscopic and histopathologic analysis DERMATOLOGY PRACTICAL & CONCEPTUAL www.derm101.com Morphologic characteristics of nevi associated with melanoma: a clinical, dermatoscopic and histopathologic analysis Temeida Alendar 1, Harald Kittler

More information

Colorectal cancer: pathology

Colorectal cancer: pathology UK NEQAS for Molecular Pathology Colorectal cancer: pathology Nick West Pathology & Tumour Biology May 2013 Colorectal cancer (CRC) 40,695 new cases in 2010 15,708 deaths Management of CRC Surgery Main

More information

Toby Maurer, MD University of California, San Francisco. Lifetime risk of an American developing melanoma

Toby Maurer, MD University of California, San Francisco. Lifetime risk of an American developing melanoma Distinguishing Pigmented Skin Lesions and Melanoma Toby Maurer, MD University of California, San Francisco Epidemiology of Melanoma Lifetime risk of an American developing melanoma 1935: 1 in 1500 1980:

More information

Dr Rosalie Stephens. Mr Richard Martin. Medical Oncologist Auckland City Hospital Auckland

Dr Rosalie Stephens. Mr Richard Martin. Medical Oncologist Auckland City Hospital Auckland Dr Rosalie Stephens Medical Oncologist Auckland City Hospital Auckland Mr Richard Martin General Surgeon Melanoma Unit Team Waitemata District Health Board Auckland 8:30-9:25 WS #99: Interactive Case Studies

More information

Genomic complexity and arrays in CLL. Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy

Genomic complexity and arrays in CLL. Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy Genomic complexity and arrays in CLL Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy Clinical relevance of genomic complexity (GC) in CLL GC has been identified as a critical negative

More information

Surgical Pathology Issues of Practical Importance

Surgical Pathology Issues of Practical Importance Surgical Pathology Issues of Practical Importance Anne Moore, MD Medical Oncology Syed Hoda, MD Surgical Pathology The pathologist is central to the team approach needed to manage the patient with breast

More information

Toby Maurer, MD University of California, San Francisco. Lifetime risk of an American developing melanoma

Toby Maurer, MD University of California, San Francisco. Lifetime risk of an American developing melanoma Distinguishing Pigmented Skin Lesions and Melanoma Toby Maurer, MD University of California, San Francisco Epidemiology of Melanoma Lifetime risk of an American developing melanoma 1935: 1 in 1500 1980:

More information

A PRACTICAL APPROACH TO ATYPICAL MELANOCYTIC LESIONS BIJAN HAGHIGHI M.D, DIRECTOR OF DERMATOPATHOLOGY, ST. JOSEPH HOSPITAL

A PRACTICAL APPROACH TO ATYPICAL MELANOCYTIC LESIONS BIJAN HAGHIGHI M.D, DIRECTOR OF DERMATOPATHOLOGY, ST. JOSEPH HOSPITAL A PRACTICAL APPROACH TO ATYPICAL MELANOCYTIC LESIONS BIJAN HAGHIGHI M.D, DIRECTOR OF DERMATOPATHOLOGY, ST. JOSEPH HOSPITAL OBJECTIVES Discuss current trends and changing concepts in our understanding of

More information

Michael T. Tetzlaff MD, PhD

Michael T. Tetzlaff MD, PhD American Joint Cancer Committee (AJCC) staging system for primary cutaneous melanoma (8 th Edition) and principles of sentinel lymph node evaluation Emphasis on concise and accurate reporting of primary

More information

Hand, Foot, and Mouth Disease Situation Update. Hand, Foot, and Mouth Disease surveillance summary

Hand, Foot, and Mouth Disease Situation Update. Hand, Foot, and Mouth Disease surveillance summary Hand, Foot, and Mouth Disease Situation Update 24 February 215 Hand, Foot, and Mouth Disease surveillance summary This surveillance summary includes information from countries where transmission of Hand,

More information

Challenges in Melanoma Diagnosis and Management

Challenges in Melanoma Diagnosis and Management Challenges in Melanoma Diagnosis and Management Winter Clinical Dermatology Conference - Hawaii Darrell S. Rigel, MD MS Clinical Professor of Dermatology New York University Medical Center DISCLOSURE OF

More information

Sleep Market Panel. Results for June 2015

Sleep Market Panel. Results for June 2015 Sleep Market Panel Results for June 2015 Notes: o This is a monthly trending report of panel member data along with additional analysis by: Sleep labs affiliated with Hospitals vs. Independent Labs o Hospital

More information

Molecular Enhancement of Sentinel Node Evaluation

Molecular Enhancement of Sentinel Node Evaluation Cochran Illustrations 060104 Molecular Enhancement of Sentinel Node Evaluation Alistair Cochran, MD and Rong Huang MD Departments of Pathology and Laboratory Medicine and Surgery, David Geffen School of

More information

Limitations of nonsurgical treatment modalities. Nonsurgical Treatments (Table V) 1/31/2018

Limitations of nonsurgical treatment modalities. Nonsurgical Treatments (Table V) 1/31/2018 DISCLOSURE OF RELEVANT RELATIONSHIPS WITH INDUSTRY James M. Grichnik M.D. Ph.D. Alternative Therapies James M Grichnik MD PhD Director, Scully-Welsh Cancer Center Indian River Medical Center grichnik@irmc.cc

More information

Borderline tumors. Borderline tumors. Serous borderline tumor are NOT benign. Low grade serous carcinoma: pathogenesis. Serous carcinoma: pathogenesis

Borderline tumors. Borderline tumors. Serous borderline tumor are NOT benign. Low grade serous carcinoma: pathogenesis. Serous carcinoma: pathogenesis Serous borderline tumor are NOT benign Robert A. Soslow, MD Memorial Sloan-Kettering Cancer Center soslowr@mskcc.org Borderline tumors Serous BTs and seromucinous BTs are both histopathologically borderline

More information

Problems in staging breast carcinoma

Problems in staging breast carcinoma Problems in staging breast carcinoma Primary systemic therapy (PST) of breast carcinoma pathologists tasks Dr. Janina Kulka, 2nd Department of Pathology, Semmelweis University Budapest Austro-Hungarian

More information

Diploma Examination. Dermatopathology: First paper. Tuesday 20 March Candidates must answer FOUR questions. Time allowed: 3 hours

Diploma Examination. Dermatopathology: First paper. Tuesday 20 March Candidates must answer FOUR questions. Time allowed: 3 hours Dermatopathology: First paper Tuesday 20 March 2018 Candidates must answer FOUR questions Time allowed: 3 hours 1. Give an account of the genetic aberrations encountered in Spitzoid neoplasms and how these

More information

The role of cytogenomics in the diagnostic work-up of Chronic Lymphocytic Leukaemia

The role of cytogenomics in the diagnostic work-up of Chronic Lymphocytic Leukaemia The role of cytogenomics in the diagnostic work-up of Chronic Lymphocytic Leukaemia Adrian Zordan, Meaghan Wall, Ruth MacKinnon, Pina D Achille & Lynda Campbell Victorian Cancer Cytogenetics Service (VCCS)

More information

3/23/2017. Disclosure of Relevant Financial Relationships. Pathologic Staging Updates in Lung Cancer T STAGE OUTLINE SURVIVAL ACCORDING TO SIZE ONLY

3/23/2017. Disclosure of Relevant Financial Relationships. Pathologic Staging Updates in Lung Cancer T STAGE OUTLINE SURVIVAL ACCORDING TO SIZE ONLY Pathologic Staging Updates in Lung Cancer Disclosure of Relevant Financial Relationships USCAP requires that all planners (Education Committee) in a position to influence or control the content of CME

More information

Melanoma-Back to Basics I Thought I Knew Ya! Paul K. Shitabata, M.D. Dermatopathologist APMG

Melanoma-Back to Basics I Thought I Knew Ya! Paul K. Shitabata, M.D. Dermatopathologist APMG Melanoma-Back to Basics I Thought I Knew Ya! Paul K. Shitabata, M.D. Dermatopathologist APMG At tumor board, a surgeon insists that all level II melanomas are invasive since they have broken through the

More information

The Promise of Epilepsy Genetics A Personal & Scientific Perspective December 3, 2012

The Promise of Epilepsy Genetics A Personal & Scientific Perspective December 3, 2012 The Promise of Epilepsy Genetics A Personal & Scientific Perspective December 3, 2012 Tracy Dixon-Salazar, Ph.D. University of California, San Diego American Epilepsy Society Annual Meeting 1 Disclosure

More information

Citation for published version (APA): Francken, A. B. (2007). Primary and metastatic melanoma: aspects of follow-up and staging s.n.

Citation for published version (APA): Francken, A. B. (2007). Primary and metastatic melanoma: aspects of follow-up and staging s.n. University of Groningen Primary and metastatic melanoma Francken, Anne Brecht IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check

More information

FAQs for UK Pathology Departments

FAQs for UK Pathology Departments FAQs for UK Pathology Departments This is an educational piece written for Healthcare Professionals FAQs for UK Pathology Departments If you would like to discuss any of the listed FAQs further, or have

More information

Citation for published version (APA): Niebling, M. G-J. (2014). Improving Staging Accuracy in Melanoma Groningen: s.n.

Citation for published version (APA): Niebling, M. G-J. (2014). Improving Staging Accuracy in Melanoma Groningen: s.n. University of Groningen Improving Staging Accuracy in Melanoma Niebling, Maarten Gert-Jan IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it.

More information

Melanoma and Dermoscopy. Disclosure Statement: ABCDE's of melanoma. Co-President, Usatine Media

Melanoma and Dermoscopy. Disclosure Statement: ABCDE's of melanoma. Co-President, Usatine Media Melanoma and Dermoscopy Richard P. Usatine, MD, FAAFP Professor, Family and Community Medicine Professor, Dermatology and Cutaneous Surgery Medical Director, University Skin Clinic University of Texas

More information

MICHIGAN PATHOLOGY QUALITY SYSTEM (MPQS)

MICHIGAN PATHOLOGY QUALITY SYSTEM (MPQS) MICHIGAN PATHOLOGY QUALITY SYSTEM (MPQS) Divisions of Anatomic Pathology & Clinical Informatics, Department of Pathology Administrative Forum December 15, 2008 Anatomic Pathology An Introduction 81 staff

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

Cancer Genomics Testing: diagnostic yield and reimbursement

Cancer Genomics Testing: diagnostic yield and reimbursement Cancer Genomics Testing: diagnostic yield and reimbursement Anthony N. Sireci, MD, MS Assistant Professor of Pathology and Cell Biology Columbia University Medical Center Assistant Director and Physician

More information

PATHOLOGIC FACTORS PROGNOSTIC OF SURVIVAL IN PATIENTS WITH GI TRACT AND PANCREATIC CARCINOMA TREATED WITH NEOADJUVANT THERAPY

PATHOLOGIC FACTORS PROGNOSTIC OF SURVIVAL IN PATIENTS WITH GI TRACT AND PANCREATIC CARCINOMA TREATED WITH NEOADJUVANT THERAPY PATHOLOGIC FACTORS PROGNOSTIC OF SURVIVAL IN PATIENTS WITH GI TRACT AND PANCREATIC CARCINOMA TREATED WITH NEOADJUVANT THERAPY Jeannelyn S. Estrella, MD Department of Pathology The UT MD Anderson Cancer

More information