Molecular Methods in the Diagnosis and Prognostication of Melanoma: Pros & Cons
|
|
- Ariel Fowler
- 5 years ago
- Views:
Transcription
1 Molecular Methods in the Diagnosis and Prognostication of Melanoma: Pros & Cons Ben J. Friedman, MD Senior Staff Physician Department of Dermatology Department of Pathology and Laboratory Medicine Henry Ford Hospital, Detroit, MI, USA
2 Disclosures I have no conflicts of interest
3 Question Can adjunctive molecular assays help us make more accurate diagnoses and prognosticate better? 3
4 Outline Diagnosis 1. Array Comparative Genomic Hybridization (acgh) 2. Fluorescence In-Situ Hybridization (FISH) Multiprobe Assay 3. MyPath [Gene Expression Profiling (qrt-pcr)] Prognosis 4. Decision Dx-Melanoma TM [Gene Expression Profiling (qrt-pcr)] 4
5 Problem Histopathologically ambiguous lesions common Misdiagnosis has consequences Thickness/ sentinel node limited predictive ability N Engl J Med Sep 28;355(13):
6 How often do you request ancillary molecular testing for ambiguous melanocytic lesions? Never < 5 times per 5 -> 20 times > 20 times year per year per year EXPERT PANEL 23% 51% 22% 4% AUDIENCE 0% 14% 57% 29% **Poll from 2018 American Society of Dermatopathology Annual Meeting, Chicago, IL** 6
7 Gold Standard Limitation for Diagnostic Assays Need substantially more data on long term clinical outcome in cases with ambiguous morphology! J Am Acad Derm Oct;75(4):
8 Array Comparative Genomic Hybridization (aka Chromosomal Microarray Analysis, SNP array) 8
9 Array CGH Detects and maps DNA copy # alterations (CNA) Multiple CNA common in melanoma (>95%) Nevi have no CNA or rarely n= 1 or n=2 Cancer Res May 15;58(10): Am J Pathol Nov;163(5): Dermatol Ther Jan-Feb;19(1):
10 JAAD Jun;72(6):943-58
11 11
12 Array CGH: Pros Surveys the whole genome Sensitivity and specificity for CNA > than FISH Degree of agreement with expert morphologists acgh > FISH > GEP Hum Pathol Dec 18. pii: S (18)30488 Mod Pathol Nov;31(11): Mod Pathol Aug;29(8):832-43
13 Array CGH: Cons Not for point mutations/ balanced translocations High tissue requirement (>0.4mm BD) Limited CNA: likelihood of progression? Cost: ~1800$ Turnaround time: ~3-4 weeks J Mol Diagn Sep;15(5):
14 FISH Multiprobe Assay 14
15 FISH Multiprobe Assay Fluorescent probes-> bind specific DNA segments Detects deleterious gains and losses (acgh data) 6p25, 8q24, 9p21, and 11q13 94% sensitive, 98% specific (n=102) Am J Surg Pathol. 2009;33(8): Am J Surg Pathol. 2012;36(6):
16 8q24 (MYC) Pathology Dec;49(7):
17 FISH Pros Less technical requirements than acgh Detection of malignant subpopulations Insurance more likely to cover Turnaround time ~5 days Am J Surg Pathol May;37(5):
18 FISH Cons Heterogeneity of melanoma Tetraploidy pitfall Poor performance in ambiguous lesions? Cost: ~$ Am J Surg Pathol May;37(5): Am J Surg Pathol Dec;37(12): Ann Diagn Pathol Jun;28:
19 mypath [GEP (qrt-pcr)] 19
20 20
21 GEP (mypath ) Validation study n=1400 specimens Triple DP consensus, lack of indeterminate score, and samples >10% tumor volume n=736 specimens Sensitivity: 91.5%, Specificity 92.5% Cancer Feb 15;123(4):
22 GEP [mypath ]: Pros Tumor-immune microenvironment Cell differentiation, cell signaling, immune response Lower tissue requirement than acgh Turnaround time ~7 days J Cutan Pathol Apr;42(4):
23 GEP [mypath ]: Cons Indeterminate scores: up to 16% Insufficient RNA: up to 8% Not for: recurrent lesions, re-excisions, immunosuppressed Reliability in ambiguous lesions unknown Cost: 1950$ Cancer Feb 15;123(4):
24 Molecular Prognostication of Melanoma 24
25 TNM staging AJCC 7th Edition Cancer Staging- Cutaneous Melanoma 25
26 Decision DxMelanomaTM [GEP (qrt-pcr)] 26
27 Prognostic 31-gene signature Clin Cancer Res Jan 1;21(1):
28 GEP (Decision Dx) Low risk (class 1) & high risk (class 2) enhanced surveillance of high risk adjuvant/ earlier therapy for high risk reduce anxiety for low risk Clin Cancer Res Jan 1;21(1):
29 29
30 n=523; stage 1, 2, and 3 J Am Acad Derm Jan;80(1):
31 GEP (Decision DxTM): Pros Strong independent prognostic indicator NPV of Class 1A: >/= ~85% GEP+SNL status: better risk stratification J Am Acad Dermatol May;72(5):780-5.e3 BMC Cancer Feb 5;18(1):130 31
32 GEP (Decision DxTM): Cons PPV of Class 2 in AJCC Stage 1= ~10% or less Weak evidence for radiologic screening Cost effective? => $8,000 Dermatol Surg Dec;44(12): BMC Cancer Feb 5;18(1):130 J Am Acad Derm Jan;80(1):
33 Conclusion acgh, FISH, GEP (mypath ) are promising adjuncts to histopathology LTO data in ambiguous tumors limited GEP (mypath ): need independent nonmanufacturer conducted studies 33
34 Conclusion GEP (Decision Dx TM) = independent prognostic parameter Need prospective studies -> clinical utility Low PPV in stage 1, may limit use to thicker tumors in conjunction with SNL status 34
35 References 1. Cancer Res May 15;58(10): Am J Pathol Nov;163(5): Dermatol Ther Jan-Feb;19(1): Hum Pathol Dec 18. pii: S (18) Mod Pathol Nov;31(11): Mod Pathol Aug;29(8): J Mol Diagn Sep;15(5): Am J Surg Pathol. 2009;33(8): Am J Surg Pathol. 2012;36(6): Am J Surg Pathol Dec;37(12): Ann Diagn Pathol Jun;28: J Cutan Pathol Apr;42(4):
36 References 13. Cancer Feb 15;123(4): Cancer Epidemiol Biomarkers Prev Jul;26(7): Hum Pathol Dec 16. pii: S (18) doi 16. J Invest Dermatol Apr;135(4): N Engl J Med Sep 28;355(13): Dermatol Surg Dec;44(12): Clin Cancer Res Jan 1;21(1): J Am Acad Dermatol May;72(5):780-5.e3 21. J Am Acad Derm Jan;80(1): Am J Surg Pathol May;37(5): Pathology Dec;49(7):
Page 1 of 3. We suggest the following changes:
Page 1 of 3 Loren E. Clarke, M.D. Myriad Genetic Laboratories, Inc. 320 Wakara Way, Salt Lake City, UT 84108 Phone: 801.883.3470 Email: lclarke@myriad.com Date of Request: June 2017 NCCN Guidelines Panel:
More informationGenetic Testing: When should it be ordered? Julie Schloemer, MD Dermatology
Genetic Testing: When should it be ordered? Julie Schloemer, MD Dermatology Outline Germline testing CDKN2A BRCA2 BAP1 Somatic testing Gene expression profiling (GEP) BRAF Germline vs Somatic testing
More informationI have no relevant conflicts of interest to disclose. John T. Seykora MD PhD Departments of Dermatology & Pathology and Laboratory Medicine
Molecular Characterization of Stage 1-3 Melanoma: Are we close to accurate prognostication and prediction? I have no relevant conflicts of interest to disclose. John T. Seykora MD PhD Departments of Dermatology
More informationWhich melanoma patients benefit from genetic testing?
Which melanoma patients benefit from genetic testing? Michael A. Marchetti, MD Assistant Attending, Dermatology Service Memorial Sloan Kettering Cancer Center American Academy of Dermatology Annual Meeting
More informationMAPK Pathway. CGH Next Generation Sequencing. Molecular Tools in Care of Patients with Pigmented Lesions 7/20/2017
Molecular Tools in Care of Patients with Pigmented Lesions Tammie Ferringer, MD Geisinger Medical Center, Danville, PA tferringer@geisinger.edu DISCLOSURE OF RELATIONSHIPS WITH INDUSTRY Tammie Ferringer,
More informationUpdate on Genetic Testing for Melanoma
Update on Genetic Testing for Melanoma Emily Y. Chu, M.D., Ph.D. Assistant Professor of Dermatology & Pathology and Laboratory Medicine Hospital of the University of Pennsylvania February 18, 2018 AAD
More information> 6000 Mutations in Melanoma. Tests That Cay Be Employed. FISH for Additions/Deletions. Comparative Genomic Hybridization
Winter Clinical 2017: The Assessment and Diagnosis of Melanoma Whitney A. High, MD, JD, MEng Associate Professor, Dermatology & Pathology Director of Dermatopathology (Dermatology) University of Colorado
More informationThere is NO single Melanoma Stain. > 6000 Mutations in Melanoma. What else can be done to discriminate atypical nevi from melanoma?
Las Vegas Fall Clinical 2016: The Assessment and Diagnosis of Melanoma Whitney A. High, MD, JD, MEng Associate Professor, Dermatology & Pathology Director of Dermatopathology (Dermatology) University of
More informationGene Expression Profiling for Melanoma
Medical Policy Manual Genetic Testing, Policy No. 29 Gene Expression Profiling for Melanoma Next Review: April 2019 Last Review: April 2018 Effective: June 1, 2018 IMPORTANT REMINDER Medical Policies are
More informationMichael T. Tetzlaff MD, PhD
Molecular alterations informing the diagnosis of melanocytic tumors Michael T. Tetzlaff MD, PhD Associate Professor Department of Pathology, Section of Dermatopathology Department of Translational and
More informationGene Expression Profiling for Cutaneous Melanoma
Gene Expression Profiling for Cutaneous Melanoma Policy Number: 2.04.146 Last Review: 8/1/2018 Origination: 08/2018 Next Review: 8/1/2019 Policy Blue Cross and Blue Shield of Kansas City (Blue KC) will
More informationDECISIONDx BIOMARKER TESTS
DECISIONDx BIOMARKER TESTS Non-Discrimination Statement and Multi-Language Interpreter Services information are located at the end of this document. Coverage for services, procedures, medical devices and
More informationFEP Medical Policy Manual
FEP Medical Policy Manual Last Review: December 2016 Effective Date: January 15, 2017 Related Policies None Gene Expression Profiling for Uveal Melanoma Summary Uveal melanoma is associated with a high
More information6/22/2015. Original Paradigm. Correlating Histology and Molecular Findings in Melanocytic Neoplasms
6 Correlating Histology and Molecular Findings in Melanocytic Neoplasms Pedram Gerami MD, Associate Professor of Dermatology and Pediatrics at Northwestern University Disclosures: I have been a consultant
More informationMedical Policy An independent licensee of the Blue Cross Blue Shield Association
Gene Expression Profiling for Cutaneous Melanoma Page 1 of 28 Medical Policy An independent licensee of the Blue Cross Blue Shield Association Title: Gene Expression Profiling for Cutaneous Melanoma Professional
More informationVernon K. Sondak. Department of Cutaneous Oncology Moffitt Cancer Center Tampa, Florida
Vernon K. Sondak Department of Cutaneous Oncology Moffitt Cancer Center Tampa, Florida Australasian Melanoma Conference 2016 Sydney, NSW, Australia October 29, 2016 Disclosures Dr. Sondak is a compensated
More informationTalk to Your Doctor. Fact Sheet
Talk to Your Doctor Hearing the words you have skin cancer is overwhelming and would leave anyone with a lot of questions. If you have been diagnosed with Stage I or II cutaneous melanoma with no apparent
More informationMelanoma and the genes: Molecular alterations informing the diagnosis of melanocytic tumors
Melanoma and the genes: Molecular alterations informing the diagnosis of melanocytic tumors Michael T. Tetzlaff MD, PhD Associate Professor Department of Pathology, Section of Dermatopathology Department
More informationCorporate Medical Policy
Corporate Medical Policy Gene Expression Profiling for Cutaneous Melanoma File Name: Origination: Last CAP Review: Next CAP Review: Last Review: gene_expression_profiling_for_cutaneous_melanoma 5/2018
More informationFlu Watch. MMWR Week 3: January 14 to January 20, and Deaths. Virologic Surveillance. Influenza-Like Illness Surveillance
Flu Watch MMWR Week 3: January 14 to January 2, 218 All data are provisional and subject to change as more reports are received. Geographic Spread South Carolina reported widespread activity this week.
More informationMolecular Aspects of Melanocytic Neoplasia. Iwei Yeh MD, PhD University of California, San Francisco
Molecular Aspects of Melanocytic Neoplasia Iwei Yeh MD, PhD University of California, San Francisco Thanks to: Boris Bastian Timothy McCalmont Philip LeBoit Beth Ruben Jeff North Laura Pincus Thaddeus
More informationMEDICAL POLICY. Proprietary Information of YourCare Health Plan
MEDICAL POLICY SUBJECT: HER-2 TESTING IN INVASIVE BREAST OR PAGE: 1 OF: 7 If the member's subscriber contract excludes coverage for a specific service it is not covered under that contract. In such cases,
More informationBreast cancer: Molecular STAGING classification and testing. Korourian A : AP,CP ; MD,PHD(Molecular medicine)
Breast cancer: Molecular STAGING classification and testing Korourian A : AP,CP ; MD,PHD(Molecular medicine) Breast Cancer Theory: Halsted Operative breast cancer is a local-regional disease The positive
More informationFlu Watch. MMWR Week 4: January 21 to January 27, and Deaths. Virologic Surveillance. Influenza-Like Illness Surveillance
Flu Watch MMWR Week 4: January 21 to January 27, 218 All data are provisional and subject to change as more reports are received. Geographic Spread South Carolina reported widespread activity this week.
More informationGene Expression Profiling for Cutaneous Melanoma
Applies to all products administered or underwritten by Blue Cross and Blue Shield of Louisiana and its subsidiary, HMO Louisiana, Inc.(collectively referred to as the Company ), unless otherwise provided
More informationThe Pathology of Neoplasia Part II
The Pathology of Neoplasia Part II February 2018 PAUL BOGNER, MD A S S O C I A T E P R O F E S S O R O F O N C O L O G Y P A T H O L O G Y A N D D E R M A T O L O G Y Clinical goals of cancer pathology
More informationManagement of Atypical Pigmented Lesions
Management of Atypical Pigmented Lesions Jennifer A. Stein MD, PhD Associate Director, Pigmented Lesion Section Ronald O. Perelman Department of Dermatology NYU Langone Medical Center July 29, 2017 1-4
More informationSharan Goobie, MD, MSc, FRCPC
Sharan Goobie, MD, MSc, FRCPC Chromosome testing in 2014 Presenter Disclosure: Sharan Goobie has no potential for conflict of interest with this presentation Objectives Review of standard genetic investigations
More informationMelanocytic Lesions: Use of Immunohistochemistry and Special Studies Napa Valley 2018
Melanocytic Lesions: Use of Immunohistochemistry and Special Studies Napa Valley 2018 Victor G. Prieto, MD, PhD Professor Depts. of Pathology and Dermatology University of Texas - MD Anderson Cancer Center
More informationAdvances in Surgical Management of Primary Melanoma: Identifying Patients Who Need More than Conventional Wide Local Excision
Advances in Surgical Management of Primary Melanoma: Identifying Patients Who Need More than Conventional Wide Local Excision Christopher J. Miller, MD Director of Penn Dermatology Oncology Center Associate
More informationMelanocytic proliferations in sundamaged
Atypical Spitzoid Tumor: What Does It Mean And How Should It Be Managed? Melanocytic proliferations in sundamaged skin Jane L. Messina, Jane L. Messina MD International Melanoma Pathology Working Group
More informationApplication of Urovision FISH testing for diagnosis of bladder cancer
Application of Urovision FISH testing for diagnosis of bladder cancer Eva M. Wojcik, MD Chair and Professor of Pathology and Urology Loyola University, Chicago, USA Bladder cancer - current status ~ 76,900
More informationSupplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the
Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the deep dermis. (b) The melanocytes demonstrate abundant
More informationMaking the Most of Your Cancer Registry
www.champsods.com Making the Most of Your Cancer Registry Presenter: Toni Hare, Vice President CHAMPS Oncology Data Services Picture of girl here December 11, 2009 Learning Objectives Upon completion of
More informationTranslating Evidence into Practice: Primary Cutaneous Melanoma Guidelines. Sentinel Lymph Node Biopsy
American Academy of Dermatology 2018 Annual Meeting San Diego, CA, February 17, 2018 Translating Evidence into Practice: Primary Cutaneous Melanoma Guidelines. Sentinel Lymph Node Biopsy Christopher Bichakjian,
More informationThe Enigmatic Spitz Lesion
The Enigmatic Spitz Lesion The Dawn of Spitz S Spitz Sophie Spitz Melanomas of Childhood ; Am J Pathol 1948 1910-1956 13 children (18 mo - 12 yrs) 12/13 had a benign clinical course Sophie Spitz Born 1910
More informationDeep Dermatophytosis
Deep Dermatophytosis 2016-11-06 MMTN/Bangkok Department of Dermatology Chang Gung Memorial Hospital, Linkou Branch Taoyuan, Taiwan Superficial dermatophytosis Wikimedia Stratum corneum Tinea faciei Tinea
More informationFISH mcgh Karyotyping ISH RT-PCR. Expression arrays RNA. Tissue microarrays Protein arrays MS. Protein IHC
Classification of Breast Cancer in the Molecular Era Susan J. Done University Health Network, Toronto Why classify? Prognosis Prediction of response to therapy Pathogenesis Invasive breast cancer can have
More informationMelanoma Update: 8th Edition of AJCC Staging System
Melanoma Update: 8th Edition of AJCC Staging System Rosalie Elenitsas, M.D. Professor of Dermatology Director, Dermatopathology University of Pennsylvania DISCLOSURE OF RELATIONSHIPS WITH INDUSTRY None
More informationTelehealth Data for Syndromic Surveillance
Telehealth Data for Syndromic Surveillance Karen Hay March 30, 2009 Ontario Ministry of Health and Long-Term Care Public Health Division, Infectious Diseases Branch Syndromic Surveillance Ontario (SSO)
More informationMEDICAL POLICY. Proprietary Information of Excellus Health Plan, Inc. A nonprofit independent licensee of the BlueCross BlueShield Association
MEDICAL POLICY SUBJECT: HER-2 TESTING IN INVASIVE BREAST OR PAGE: 1 OF: 7 If a product excludes coverage for a service, it is not covered, and medical policy criteria do not apply. If a commercial product,
More informationMultigene Testing in NCCN Breast Cancer Treatment Guidelines, v1.2011
Multigene Testing in NCCN Breast Cancer Treatment Guidelines, v1.2011 Robert W. Carlson, M.D. Professor of Medicine Stanford University Chair, NCCN Breast Cancer Treatment Guidelines Panel Selection of
More informationDurham Region Influenza Bulletin: 2017/18 Influenza Season
Durham Region Influenza Bulletin: 2017/18 Influenza Season Surveillance Week 21 (May 20, 2018 to May 26, 2018) Table 1: Assessment of influenza activity in Durham Region Measure Laboratory confirmed cases
More informationMelanoma Surgery Update James R. Ouellette, DO FACS Premier Health Cancer Institute Wright State University Chief, Surgical Oncology Division
Melanoma Surgery Update 2018 James R. Ouellette, DO FACS Premier Health Cancer Institute Wright State University Chief, Surgical Oncology Division Surgery for Melanoma Mainstay of treatment for potentially
More informationExploitation of Epigenetic Changes to Distinguish Benign from Malignant Prostate Biopsies
Exploitation of Epigenetic Changes to Distinguish Benign from Malignant Prostate Biopsies Disclosures MDxHealth Scientific Advisor 2 Case Study 54-year-old man referred for a PSA of 7 - Healthy, minimal
More informationCase presentation 04/13/2017. Genomic/morphological classification of endometrial carcinoma
Genomic/morphological classification of endometrial carcinoma Robert A. Soslow, MD soslowr@mskcc.org architecture.about.com Case presentation 49 year old woman with vaginal bleeding Underwent endometrial
More informationUpdate on Lymph Node Management in Melanoma
Update on Lymph Node Management in Melanoma John T. Vetto MD, FACS Professor of Surgery Division of Surgical Oncology Oregon Health & Science University Portland, Oregon Lymph Nodes in Melanoma Outline
More informationWhat s the Human Genome Project Got to Do with Developmental Disabilities?
What s the Human Genome Project Got to Do with Developmental Disabilities? Disclosures Neither speaker has anything to disclose. Phase Two: Interpretation Officially started in October 1990 Goals of the
More informationProviding Treatment Information for Prostate Cancer Patients
Providing Treatment Information for Prostate Cancer Patients For all patients with localized disease on biopsy For all patients with adverse pathology after prostatectomy See what better looks like Contact
More informationCytogenetics 101: Clinical Research and Molecular Genetic Technologies
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these
More informationSNP Arrays in Cancer Diagnostics
1 1. Introduction SNP Arrays in Cancer Diagnostics Federico A. Monzon, M.D. The Methodist Hospital Research Institute, Houston TX Detection of acquired chromosomal gains/losses in human tumors is clinically
More informationImpact of Prognostic Factors
Melanoma Prognostic Factors: where we started, where are we going? Impact of Prognostic Factors Staging Management Surgical intervention Adjuvant treatment Suraj Venna, MD Assistant Clinical Professor,
More informationMEDICAL POLICY SUBJECT: URINARY TUMOR MARKERS FOR BLADDER CANCER. POLICY NUMBER: CATEGORY: Technology Assessment
MEDICAL POLICY SUBJECT: URINARY TUMOR MARKERS FOR PAGE: 1 OF: 5 If a product excludes coverage for a service, it is not covered, and medical policy criteria do not apply. If a commercial product, including
More informationUpdated Molecular Testing Guideline for the Selection of Lung Cancer Patients for Treatment with Targeted Tyrosine Kinase Inhibitors
Q: How is the strength of recommendation determined in the new molecular testing guideline? A: The strength of recommendation is determined by the strength of the available data (evidence). Strong Recommendation:
More informationThe lymphoma-associated NPM-ALK oncogene elicits a p16ink4a/prb-dependent tumor-suppressive pathway. Blood Jun 16;117(24):
DNA Sequencing Publications Standard Sequencing 1 Carro MS et al. DEK Expression is controlled by E2F and deregulated in diverse tumor types. Cell Cycle. 2006 Jun;5(11) 2 Lassandro L et al. The DNA sequence
More informationPrenatal Diagnosis: Are There Microarrays in Your Future?
Financial Disclosure UCSF Antepartum Intrapartum Management Course June 8 I have no financial relationship with any aspect of private industry Prenatal Diagnosis: Are There Microarrays in Your Future?
More information18 Week 92% Open Pathway Recovery Plan and Backlog Clearance
18 Week 92% Open Pathway Recovery Plan and Backlog Clearance Page 1 of 6 17.05.2012 1.0 Background 18-Week 92% Open Pathway RECOVERY PLAN The Trust has achieved compliance against the admitted and non-admitted
More informationCurrent Status of Biomarkers (including DNA Tumor Markers and Immunohistochemistry in the Laboratory Diagnosis of Tumors)
Current Status of Biomarkers (including DNA Tumor Markers and Immunohistochemistry in the Laboratory Diagnosis of Tumors) Kael Mikesell, DO McKay-Dee Hospital May 14, 2015 Outline Update to DNA Testing
More informationFAQs about Provider Profiles on Breast Cancer Screenings (Mammography) Q: Who receives a profile on breast cancer screenings (mammograms)?
FAQs about Provider Profiles on Breast Cancer Screenings (Mammography) Q: Who receives a profile on breast cancer screenings (mammograms)? A: We send letters and/or profiles to PCPs with female members
More informationCHROMOSOMAL MICROARRAY (CGH+SNP)
Chromosome imbalances are a significant cause of developmental delay, mental retardation, autism spectrum disorders, dysmorphic features and/or birth defects. The imbalance of genetic material may be due
More informationDo acgh analysis have a place in routine cytogenetic workup in leukemia/cancer? - A single institution experience. Cambridge, April 9 th 2013
Do acgh analysis have a place in routine cytogenetic workup in leukemia/cancer? - A single institution experience. Cambridge, April 9 th 2013 Aarhus University Hospital Eigil Kjeldsen, Cancercytogenetic
More informationAssociate Clinical Professor of Dermatology MUSC
Re-excision of Moderately Dysplastic Nevi: Should we or shouldn t we? John C. Maize, Jr, M.D. Dermatologist and Dermatopathologist Trident Dermatology, Charleston SC Associate Clinical Professor of Dermatology
More informationMALBAC Technology and Its Application in Non-invasive Chromosome Screening (NICS)
MALBAC Technology and Its Application in Non-invasive Chromosome Screening (NICS) The Power of One Adapted from Internet Single Cell Genomic Studies Ultra Low Sample Input Advances and applications of
More informationDr. dr. Primariadewi R, SpPA(K)
Curriculum Vitae Dr. dr. Primariadewi R, SpPA(K) Education : Medical Doctor from UKRIDA Doctoral Degree from Faculty of Medicine University of Indonesia Pathologist Specialist and Consultant from Faculty
More information10/2/17. MELTUMP, SAMPUS, AST.An Algorithmic Approach to Challenging (Often Borderline) Melanocytic Tumors. An Introduction to SNP Arrays
MELTUMP, SAMPUS, AST.An Algorithmic Approach to Challenging (Often ) Melanocytic Tumors An Introduction to SNP Arrays Rajiv M. Patel, M.D. RCPA NZ ASM 2017 (11:45-12:30pm, Saturday, 23-09-17) Why do we
More informationUpdate on Spitzoid and Blue nevus-like melanocytic lesions Emphasis on molecular studies informing diagnosis, prognosis and therapy
Update on Spitzoid and Blue nevus-like melanocytic lesions Emphasis on molecular studies informing diagnosis, prognosis and therapy Michael T. Tetzlaff MD, PhD Associate Professor Department of Pathology,
More informationDr Catherine Woolnough, Hospital Scientist, Chemical Pathology, Royal Prince Alfred Hospital. NSW Health Pathology University of Sydney
Dr Catherine Woolnough, Hospital Scientist, Chemical Pathology, Royal Prince Alfred Hospital NSW Health Pathology University of Sydney Thyroid Cancer TC incidence rates in NSW Several subtypes - Papillary
More informationLocally Advanced and Metastatic Melanoma. Relevant disclosures 6/23/2018. What is the median survival of metastatic melanoma? Abel D.
Locally Advanced and Metastatic Melanoma Abel D. Jarell, MD, FAAD Adjunct Dartmouth School of Medicine, Hanover, NH Northeast Dermatology Associates, Portsmouth, NH Relevant disclosures What is the median
More informationQuit Rates of New York State Smokers
Quit Rates of New York State Smokers Sara M. Abrams, MPH Data Manager NYS Smokers Quitline Sara.Abrams@roswellpark.org September 6, 20 Presentation Outline Basic Quitline Service How Quit Rates are defined
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationFEP Medical Policy Manual
FEP Medical Policy Manual Effective Date: July 15, 2018 Related Policies: 8.01.10 Charged-Particle (Proton or Helium Ion) Radiotherapy for Neoplastic Conditions Gene Expression Profiling for Uveal Melanoma
More informationMorphologic characteristics of nevi associated with melanoma: a clinical, dermatoscopic and histopathologic analysis
DERMATOLOGY PRACTICAL & CONCEPTUAL www.derm101.com Morphologic characteristics of nevi associated with melanoma: a clinical, dermatoscopic and histopathologic analysis Temeida Alendar 1, Harald Kittler
More informationColorectal cancer: pathology
UK NEQAS for Molecular Pathology Colorectal cancer: pathology Nick West Pathology & Tumour Biology May 2013 Colorectal cancer (CRC) 40,695 new cases in 2010 15,708 deaths Management of CRC Surgery Main
More informationToby Maurer, MD University of California, San Francisco. Lifetime risk of an American developing melanoma
Distinguishing Pigmented Skin Lesions and Melanoma Toby Maurer, MD University of California, San Francisco Epidemiology of Melanoma Lifetime risk of an American developing melanoma 1935: 1 in 1500 1980:
More informationDr Rosalie Stephens. Mr Richard Martin. Medical Oncologist Auckland City Hospital Auckland
Dr Rosalie Stephens Medical Oncologist Auckland City Hospital Auckland Mr Richard Martin General Surgeon Melanoma Unit Team Waitemata District Health Board Auckland 8:30-9:25 WS #99: Interactive Case Studies
More informationGenomic complexity and arrays in CLL. Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy
Genomic complexity and arrays in CLL Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy Clinical relevance of genomic complexity (GC) in CLL GC has been identified as a critical negative
More informationSurgical Pathology Issues of Practical Importance
Surgical Pathology Issues of Practical Importance Anne Moore, MD Medical Oncology Syed Hoda, MD Surgical Pathology The pathologist is central to the team approach needed to manage the patient with breast
More informationToby Maurer, MD University of California, San Francisco. Lifetime risk of an American developing melanoma
Distinguishing Pigmented Skin Lesions and Melanoma Toby Maurer, MD University of California, San Francisco Epidemiology of Melanoma Lifetime risk of an American developing melanoma 1935: 1 in 1500 1980:
More informationA PRACTICAL APPROACH TO ATYPICAL MELANOCYTIC LESIONS BIJAN HAGHIGHI M.D, DIRECTOR OF DERMATOPATHOLOGY, ST. JOSEPH HOSPITAL
A PRACTICAL APPROACH TO ATYPICAL MELANOCYTIC LESIONS BIJAN HAGHIGHI M.D, DIRECTOR OF DERMATOPATHOLOGY, ST. JOSEPH HOSPITAL OBJECTIVES Discuss current trends and changing concepts in our understanding of
More informationMichael T. Tetzlaff MD, PhD
American Joint Cancer Committee (AJCC) staging system for primary cutaneous melanoma (8 th Edition) and principles of sentinel lymph node evaluation Emphasis on concise and accurate reporting of primary
More informationHand, Foot, and Mouth Disease Situation Update. Hand, Foot, and Mouth Disease surveillance summary
Hand, Foot, and Mouth Disease Situation Update 24 February 215 Hand, Foot, and Mouth Disease surveillance summary This surveillance summary includes information from countries where transmission of Hand,
More informationChallenges in Melanoma Diagnosis and Management
Challenges in Melanoma Diagnosis and Management Winter Clinical Dermatology Conference - Hawaii Darrell S. Rigel, MD MS Clinical Professor of Dermatology New York University Medical Center DISCLOSURE OF
More informationSleep Market Panel. Results for June 2015
Sleep Market Panel Results for June 2015 Notes: o This is a monthly trending report of panel member data along with additional analysis by: Sleep labs affiliated with Hospitals vs. Independent Labs o Hospital
More informationMolecular Enhancement of Sentinel Node Evaluation
Cochran Illustrations 060104 Molecular Enhancement of Sentinel Node Evaluation Alistair Cochran, MD and Rong Huang MD Departments of Pathology and Laboratory Medicine and Surgery, David Geffen School of
More informationLimitations of nonsurgical treatment modalities. Nonsurgical Treatments (Table V) 1/31/2018
DISCLOSURE OF RELEVANT RELATIONSHIPS WITH INDUSTRY James M. Grichnik M.D. Ph.D. Alternative Therapies James M Grichnik MD PhD Director, Scully-Welsh Cancer Center Indian River Medical Center grichnik@irmc.cc
More informationBorderline tumors. Borderline tumors. Serous borderline tumor are NOT benign. Low grade serous carcinoma: pathogenesis. Serous carcinoma: pathogenesis
Serous borderline tumor are NOT benign Robert A. Soslow, MD Memorial Sloan-Kettering Cancer Center soslowr@mskcc.org Borderline tumors Serous BTs and seromucinous BTs are both histopathologically borderline
More informationProblems in staging breast carcinoma
Problems in staging breast carcinoma Primary systemic therapy (PST) of breast carcinoma pathologists tasks Dr. Janina Kulka, 2nd Department of Pathology, Semmelweis University Budapest Austro-Hungarian
More informationDiploma Examination. Dermatopathology: First paper. Tuesday 20 March Candidates must answer FOUR questions. Time allowed: 3 hours
Dermatopathology: First paper Tuesday 20 March 2018 Candidates must answer FOUR questions Time allowed: 3 hours 1. Give an account of the genetic aberrations encountered in Spitzoid neoplasms and how these
More informationThe role of cytogenomics in the diagnostic work-up of Chronic Lymphocytic Leukaemia
The role of cytogenomics in the diagnostic work-up of Chronic Lymphocytic Leukaemia Adrian Zordan, Meaghan Wall, Ruth MacKinnon, Pina D Achille & Lynda Campbell Victorian Cancer Cytogenetics Service (VCCS)
More information3/23/2017. Disclosure of Relevant Financial Relationships. Pathologic Staging Updates in Lung Cancer T STAGE OUTLINE SURVIVAL ACCORDING TO SIZE ONLY
Pathologic Staging Updates in Lung Cancer Disclosure of Relevant Financial Relationships USCAP requires that all planners (Education Committee) in a position to influence or control the content of CME
More informationMelanoma-Back to Basics I Thought I Knew Ya! Paul K. Shitabata, M.D. Dermatopathologist APMG
Melanoma-Back to Basics I Thought I Knew Ya! Paul K. Shitabata, M.D. Dermatopathologist APMG At tumor board, a surgeon insists that all level II melanomas are invasive since they have broken through the
More informationThe Promise of Epilepsy Genetics A Personal & Scientific Perspective December 3, 2012
The Promise of Epilepsy Genetics A Personal & Scientific Perspective December 3, 2012 Tracy Dixon-Salazar, Ph.D. University of California, San Diego American Epilepsy Society Annual Meeting 1 Disclosure
More informationCitation for published version (APA): Francken, A. B. (2007). Primary and metastatic melanoma: aspects of follow-up and staging s.n.
University of Groningen Primary and metastatic melanoma Francken, Anne Brecht IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check
More informationFAQs for UK Pathology Departments
FAQs for UK Pathology Departments This is an educational piece written for Healthcare Professionals FAQs for UK Pathology Departments If you would like to discuss any of the listed FAQs further, or have
More informationCitation for published version (APA): Niebling, M. G-J. (2014). Improving Staging Accuracy in Melanoma Groningen: s.n.
University of Groningen Improving Staging Accuracy in Melanoma Niebling, Maarten Gert-Jan IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it.
More informationMelanoma and Dermoscopy. Disclosure Statement: ABCDE's of melanoma. Co-President, Usatine Media
Melanoma and Dermoscopy Richard P. Usatine, MD, FAAFP Professor, Family and Community Medicine Professor, Dermatology and Cutaneous Surgery Medical Director, University Skin Clinic University of Texas
More informationMICHIGAN PATHOLOGY QUALITY SYSTEM (MPQS)
MICHIGAN PATHOLOGY QUALITY SYSTEM (MPQS) Divisions of Anatomic Pathology & Clinical Informatics, Department of Pathology Administrative Forum December 15, 2008 Anatomic Pathology An Introduction 81 staff
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationCancer Genomics Testing: diagnostic yield and reimbursement
Cancer Genomics Testing: diagnostic yield and reimbursement Anthony N. Sireci, MD, MS Assistant Professor of Pathology and Cell Biology Columbia University Medical Center Assistant Director and Physician
More informationPATHOLOGIC FACTORS PROGNOSTIC OF SURVIVAL IN PATIENTS WITH GI TRACT AND PANCREATIC CARCINOMA TREATED WITH NEOADJUVANT THERAPY
PATHOLOGIC FACTORS PROGNOSTIC OF SURVIVAL IN PATIENTS WITH GI TRACT AND PANCREATIC CARCINOMA TREATED WITH NEOADJUVANT THERAPY Jeannelyn S. Estrella, MD Department of Pathology The UT MD Anderson Cancer
More information