Inhibiting mirna-30a-3p has anti-tumor effects in glioma cancer via PTEN

Size: px
Start display at page:

Download "Inhibiting mirna-30a-3p has anti-tumor effects in glioma cancer via PTEN"

Transcription

1 Inhibiting mirna-30a-3p has anti-tumor effects in glioma cancer via PTEN Liexiang Zhang 1,3,*, Wei Jin 2, Jing Zheng 3, Yuxiang Dai 2,Yue Song 1, Hongbin Ni 2, 1. Department of Neurosurgery, Nanjing Drum Tower Hospital Clinical College of Nanjing Medical University, Nanjng210008, Jingsu, China 2. Department of Neurosurgery, The Affiliated Drum Tower Hospital, School of Medicine, Nanjing University, Nanjing210008, Jingsu, China 3. Department of neurosurgery, Suqian People s Hospital, Nanjing Drum Tower Hospital Group, Suqian223800, Jingsu, China *: Corresponding Author zhangliejun0921@126.com Abstract: The aim of this study is to explain the relationship and mechanism of mirna-30a-3p in glioma cancer development. Collecting the 30 glioma patients who were treated in our hospital, the adjacent and cancer tissues were took to evaluate the pathological morphology and PTEN protein expression by H&E staining and immunohistochemistry (IHC). The correlation between mirna-30a-3p and PTEN were confirmed by dual luciferase assay. The LN229 was divided into 3 groups. The LN229 cell proliferations of 3 groups were measured by MTT assay. The apoptosis rates and cell cycles of difference groups were evaluated by flow cytometry. The cell invasion of difference groups were measured by transwell and the cell migration of difference groups were evaluated by wound healing assay. The relative proteins expression (PTEN, MAPK, P53, MMP-2 and MMP-9) were measured by WB assay. Depending on H&E staining, The cancer cell s invasion and migration ability and PTEN protein expression was increased with stage enhancement. The mirna-30a-3p was certain target with PTEN by dual luciferase assay. Compared with NC group, the cell proliferation of si-mirna group was significantly down-regulation; however, the 3

2 cell apoptosis rate of si-mirna group was significantly up-regulation. By flow cytometry, The G1 phase of si-mirna was significantly higher than that of NC group. The cell invasion and migration abilities of si-mirna group were significantly decreased compared with NC group. With mirna-30a-3p inhibiting, The PTEN and P53 protein expression were significantly enhanced and MAPK, MMP-2 and MMP-9 proteins expression were down-regulation in si-mirna group compared with those in NC group. In conclusion, mirna-30a-3p suppressor had anti-tumor abilities via PTEN. Key words: mirna-30a-3p; LN-229; Glioma; PTEN; MAPK; P53; MMP-2; MMP-9 4

3 Introduction PTEN (Phosphatase and Tensin homologue deleted on chromosome ten), also called MMAcl or TEP1, was a tumor suppressor gene, Li et al (1) found in 1997, it has dual specificity phosphatase activity. PTEN can promote a group of proteins that regulate the growth of cells by regulating the phosphorylation of proteins (2, 3). microrna (mirna) is a length of about 20 to the highly conserved non encoding single stranded molecule of 22 nucleotides regulate RNA, which can play an important role by regulating target genes in cell proliferation, differentiation, growth and apoptosis. At present, there are 3 main mechanisms of mirna regulated target genes: one is the incomplete complementary binding to the target gene mrna 3'untranslated region (3'UTR) to inhibit protein translation; two is binding to the target gene mrna 3'UTR complementary target genes similar to mrna degradation mediated by sirna; three is the integration of the above two (4). In recent years, the role of mirnas in the tumor has attracted great attention. A number of studies have confirmed that mirnas are closely related to the occurrence, development, diagnosis, treatment and prognosis of cancer (5, 6). In our present study, we firstly discuss the correlation between PTEN protein expression and glioma pathological staging and studied the mirna-30a-3p inhibitor had anti-tumor effects in glioma cancer cell line LN-229. Material and Methods Clinical data The giloma patients who were treated in our hospital were took the adjacent and cancer tissues, and the tissues were stored in -80 until used. The tissues were paraffin embedded and sliced. Evaluating the pathology of tissues by H&E staining and measuring the PTEN protein expression of these tissues by IHC assay. Material 5

4 Human glioma cancer cell lines LN229 (ATCC, USA) were cultured in RPMI 1640 contained 10% FBS; lipofecter were purchased from Nanjing Kingsy Biological Technology; mirna-30a-3p was 5 -GTTCGTCCCTTTCCAGCTTTACA-3 (Shang hai Biological Engineering Technology Service Co., Ltd, Shanghai). Rabbit anti human PTEN, MAPK, P53, MMP-2 and MMP-9 anti-body were purchased from Abcam (USA). Cell culture and transfection The LN229 cells were cultured in RPMI 1640 contained 10% FBS in incubator which contained 5% CO 2 and 37. After the cells were filled with culture bottles, they were digested, centrifuged and counted. After that, the cells were inoculated in 96 holes. The LN229 cell were divided into 3 groups: NC group: The LN229 cell were treated with nothing; mirna group: The LN229 cell were transfected with mirna-30a-3p and si-mirna group: The LN229 cell were transfected with si-mirna-30a-3p. Dual luciferase reporter gene assay Luciferase reporter gene plasmid (PTEN-WT) containing wild type PTEN 3'-UTR sequence and luciferase reporter gene plasmid (PTEN-Mut) containing mutant PTEN 3'-UTR sequence were constructed. Collect the logarithmic growth phase LN229, adjusting the cell density to 2 * 105 cells/well, and inoculated in 24 Kong Banzhong, PTEN-WT PTEN-Mut and mir-30a-3p mimics plasmid, plasmid or control oligonucleotide was transfected into LN229, with 3 wells in each group, the cells were placed in a constant temperature incubator (37, 5% CO 2 ) to culture 48 h; the blank plasmid fluorescence value as reference, to detect the expression of luciferase activity. Cell proliferation by MTT assay After transfection the cells were placed in an incubator (37, 5% CO 2 ) in cultured 4 h after culture, 800 r/min centrifugation 10 min, supernatant per hole adding MTT solution (5 mg/ml) 20 L on Incubator (37, 5% CO 2 ) cultured for 4 h, after absorbing abandoned hole Culture Raising supernatant, adding DMSO (100 μl/, 6

5 10 min hole) to the crystal oscillation, fully dissolved, the automatic ELISA test OD 490nm absorption value. Cell cycle and apoptosis by flow cytometry The next step was detected after transfection of 36 h. The detection of cell cycle, with 75% frozen ethanol suspension cells, as far as possible gently dispersed into a single cell, Fixed -20 for 1h; Suspension of cells with 200~500 μl 4 pre cooled PBS buffer. Adding 400 μl Prolidium Iodide (PI), 4 light stain for 15 min, using BDLSR II flow cytometry to measure. The cell invasion ability by Transwell assay 60 μl Matrigel glue were added on the polycarbonate film on the Transwell room at 37 for 30 min. The cells were inoculated on Transwell cells by 10 4 cells / holes, and the DMEM medium containing 600 l of bovine serum was added to the lower chamber. 48 h after taking out the room, wet cotton swab wipe membrane surface through the membrane of cells, hematoxylin mounting. Count the number of cells through the membrane under inverted microscope. The cell migration ability by wound healing test The cells of difference groups were inoculated in 24 well plates as cell/hole. Scratching the cultured cells with sterile 250 μl gun head, After the scratch, the plates were carefully cleaned with the culture medium for 2 times to remove the exfoliated cells, and then the fresh medium was added to the culture medium. In the scratch 0 h, 48 h, respectively, to select a different field of view to take photographs. Each group was set up with 4 replicates, each of which was selected for 5 field views. Measuring the cell would heal rates. The relative protein expression by WB assay The cells of difference groups were washed by PBS for 3 times after treated by difference methods. Adding the RIPA RIPA lysis solution was mixed with PMSF (100: 1) for cell lysis of 15 min, and the supernatant was collected after centrifugation. The protein was quantified by BCA method. The total protein was obtained by SDS-PAGE gel electrophoresis (concentration of 80V, 120 V), and the protein was transferred to 7

6 NC membrane (V) by semi dry transfer method, and then closed at room temperature with 5% skimmed milk powder at 1 h. Adding PTEN (1:500), MAPK (1:500), P53 (1:500), MMP-2 (1:500), MMP-9(1:500) and GAPDH (1:1000) first anti-body., culturing overnight at 4, After washing by PBS for 3 times, The corresponding two resist (1: 10000) was incubated at room temperature for 1 h, and the membrane was washed for 4 times. Odyssey infrared laser imaging system was used to scan, and the ratio of /GAPDH was the relative expression of the protein. Statistical analysis The data were analysis by SPSS 19.0 software, the data was shown as mean ± standard deviation ( s), Variance analysis was used to compare between groups, Enumeration data were compared using x 2 test, P<0.05 was statistically significant. Results Clinical analysis The invasion and migration abilities of glioma cancer were increased with degree increasing by H&E staining (Figure 1A); Meanwhile, PTEN protein expression of glioma cancer tissues were decreased with degree increasing by IHC (Figure 1B). Figure 1. The glioma cancer tissues of difference degree by H&E staining and PTEN protein 8

7 expression by IHC 1A. The pathological morphology of difference glioma cancer tissues by H&E staining 1B. The PTEN protein expression of difference glioma cancer tissues by IHC Dual luciferase Report MicroRNA target gene prediction of Targetscan predicted that mir-30a-3p was associated with the presence of a 3 'UTR binding site of tumor suppressor gene PTEN. It is proved that PTEN may be the target gene of mir-30a-3p by dual luciferase target. The data was shown in Figure 2. Figure 2. Double luciferase assay **: P<0.05, Compared with Control The cell proliferation rate by MTT assay The cell apoptosis rate of si-mirna group was significantly down-regulation compared with NC group (P<0.05, Figure 3). 9

8 Figure 3. The cell proliferation of difference groups **: P<0.05, Compared with NC group The cell apoptosis of difference group by flow cytometry The cell apoptosis of si-mirna group was significantly increased compared with NC group (P<0.05, Figure 4). Figure 4. The cell apoptosis rates of difference groups 10

9 **: P<0.05, Compared with NC group The cell cycle of difference group by flow cytometry The G1 phase of si-mirna group was significantly increased compared with NC group (P<0.05, Figure 5). Figure 5. The cell cycle of difference groups **: P<0.05, Compared with NC group The cell invasion ability of difference groups by transwell The invasion cell number of si-mirna group was significantly decreased compared with NC group (P<0.05, Figure 6). 11

10 Figure 6. The cell invasion abilities of difference groups **: P<0.05, Compared with NC group The cell migration ability of difference groups by wound healing assay The LN229 cell wound healing rate of si-mirna group was significantly increased compared with NC group (P<0.05, Figure 7). 12

11 Figure 7. The cell migration abilities of difference groups by wound healing assay **: P<0.05, Compared with NC group The relative protein expression by WB assay Compared with NC group, The PTEN and p53 protein expression were significantly up-regulation and MAPK, MMP-2 and MMP-9 protein expression were significantly down-regulation (P<0.05,respectively), The data was shown in Figure 8. 13

12 Figure 8. The relative proteins expressions by WB assay **: P<0.05, Compared with NC group Discussion mirna is a highly conserved non coding small molecule single stranded RNA, and is widely found in eukaryotes. Under normal physiological conditions, the expression of strict organization and sequence specific mirna in the body; but in the tumor environment, different mirna showed different biological activity, and is similar to that of oncogenes or tumor suppressor genes (7). PTEN/MAPK signaling pathway is an important pathway for many biological processes, such as apoptosis, metabolism, cell proliferation and cell growth regulation (8). PTEN gene, as an effective tumor suppressor gene, has been found to be mutated or deleted in a variety of human cancers, including hepatocellular carcinoma. As a tumor suppressor gene PTEN and protein phosphatase with lipid phosphatase activity can influence the nucleus, and can affect the cell surface, can stabilize and enhance tumor cell adhesion, cell proliferation and inhibit migration of tumor and non anchorage dependent growth, and induce apoptosis, and inhibit the degradation of extracellular matrix and tumor angiogenesis, thus the inhibition of tumor invasion and metastasis, tumor suppressor role (9). In our study, we found that PTEN protein expression was reduced with glioma cancer degree increasing. Further, we found mirna-30a-3p was the target gene to PTEN by bioinformatics. The mirna-30a-3p suppressor (si-mirna) had effects to inhibit mirna-30a-3p expression and improve PTEN expression and to suppress the glioma cancer cell lines LN-229 cell biological activities (proliferation, invasion and migration) in vitro experiments. MAPK signaling pathway, including ERK, p38 and JNK3 pathway, plays an important role in cell proliferation, apoptosis and differentiation (10, 11). p53 is a downstream gene of MAPK. The p53 gene plays an important role in the regulation of cell cycle and growth, and its mutation or deletion is directly related to the occurrence of a variety of tumors. About 50% of lung cancer has the mutation or deletion of this 14

13 gene (12). p53 can regulate cell cycle, apoptosis and senescence by activating p21waf /cip1, regulating Bax, Fas and Smad4 (13-15). In our study, we found that mirna-30a-3p suppressor (si-mirna) had effects to inhibit cell proliferation and stimulate cell apoptosis by regulation MAPK/p53 pathway. Matrix metalloproteinases are a large family, because it requires Ca 2 +, Zn 2 + and other metal ions as cofactors. MMPs can degrade almost all kinds of protein components in extracellular matrix, destroy the histological barrier of tumor cell invasion, and play a key role in tumor invasion and metastasis (16, 17). Among the MMPs proteins, MMP-2 and MMP-9 were involved in angiogenesis and degradation of the basement membrane is directly related with tumor metastasis and prognosis (18, 19). In our present study, The LN-229 cell invasion and migration abilities were inhibited by mirna-30a-3p inhibitor (si-mirna-30a-3p) transfection by regulation MMP-2/9 proteins expression. References: 1. Li J, Yea C, Liaw D, et al: PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science 275: , Wullachleger S, Loewith R, Hall MN: TOR signaling in growth and metabolism. Cell 124: , Tsang CK, Zheng XF: TOR-in (g) the nucleus. Cell Cycle 6:25-29, Bi Y, Liu G, Yang R: MicroRNAs: novel regulators during the immune response. J Cell Physiol 218: , Yang S, Li Y: MicroRNAs: novel factors in clinical diagnosis and prognosis for nasopharyngeal carcinonia. Acta Pharmacol Sin 33: , Wang D, Qiu C, Zhang H, et al: Human microrna oncogenes and tumor suppressors show significantly different biological patterns: from functions to gargets. PLoS One 5: pii: e13067, Xu X, Yang X, Xing C, et al: mirna: The nemesis of gastric cancer (Review). Oncol Lett 6: , Song G, Ouyang G, Bao S: The activation of AKT/PKB signaling pathway and cell survival. J 15

14 Cel Mol Mel 9:59-71, Di Cristofano A, Pandolfi PP: The multiple roles of PTEN in tumor suppression. Cell 100: , Fecher LA, Amaravadi RK, Flaherty KT: The MAPK pathway in melanoma. Curr Opin Oncol, 20: , Junttila MR, Li SP, Westermarck J: Phosphatase-mediated crosstalk between MAPK signaling pathways in the regulation of cell survival. FASEB J 22: , Fisher MD: Strategies to restore p53 function in patients with lung cancer (J). Clin Lung Cancer 3: , Moll UM, Wolff S, Speidel D, et al: Transcription-independent pro-apoptotie functions of P53. Curr Opin Cell Biol 17: , Levine AJ, Finlay CA, Hinds PW: P53 is a tumor suppressor gene. Cell 116: 67-69, Kalo E, Buganim Y, Shapira KE, et al: Mutant p53 attenuates the SMAD-dependent transforming growth factor β1 (TGF-β1) signaling pathway by repressing the expression of TGF-β receptor type II. Mol Cell Biol 27: , Curran S, Murray GI: Matrix metalloproteinases: Molecular aspects of their roles in tumour invasion and metastasis. Eur J Cancer 36: , Dong Z, Bonfil RD, Chinni S, et al: Matrix metalloproteinase activity and osteolasts in experimental prostate cancer bone metastasis tissue. Am J Pathol 166: , Chang HR, Chen PN, Yang SF, et al: Silibinin inhibits the invasion and migration of renal carcinoma 786-O cells in vitro, inhibits the growth of xenografts in vivo and enhances chemosensitivity to 5-fluorouracil and paclitaxel. Mol Carcinog 50: , Rink M, Chun FK, Robinson B, et al: Tissue-based molecular markers for renal cell carcinoma. Minerva Urol Nefrol 63: ,

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed

More information

Advances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016)

Advances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) Expression of Beta-Adrenergic Receptor in Glioma LN229 Cells and Its Effect on Cell Proliferation Ping Wang1, Qingluan

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

LncRNA LET function as a tumor suppressor in breast cancer development

LncRNA LET function as a tumor suppressor in breast cancer development European Review for Medical and Pharmacological Sciences 2018; 22: 6002-6007 LncRNA LET function as a tumor suppressor in breast cancer development C.-X. ZHOU, X. WANG, N. YANG, S.-K. XUE, W.-C. LI, P.-P.

More information

PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells

PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells C.-G. Sun 1 *, J. Zhuang 1 *, W.-J. Teng 1, Z. Wang 2 and S.-S. Du 3 1 Department of Oncology,

More information

microrna Presented for: Presented by: Date:

microrna Presented for: Presented by: Date: microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions

More information

Cellular Physiology and Biochemistry

Cellular Physiology and Biochemistry Original Paper 2015 The Author(s). 2015 Published The Author(s) by S. Karger AG, Basel Published online: November 27, 2015 www.karger.com/cpb Published by S. Karger AG, Basel 2194 1421-9778/15/0376-2194$39.50/0

More information

Effects of metallothionein-3 and metallothionein-1e gene transfection on proliferation, cell cycle, and apoptosis of esophageal cancer cells

Effects of metallothionein-3 and metallothionein-1e gene transfection on proliferation, cell cycle, and apoptosis of esophageal cancer cells Effects of metallothionein-3 and metallothionein-1e gene transfection on proliferation, cell cycle, and apoptosis of esophageal cancer cells Z.Q. Tian 1, Y.Z. Xu 1, Y.F. Zhang 1, G.F. Ma 1, M. He 1 and

More information

Study on the expression of MMP-9 and NF-κB proteins in epithelial ovarian cancer tissue and their clinical value

Study on the expression of MMP-9 and NF-κB proteins in epithelial ovarian cancer tissue and their clinical value Study on the expression of MMP-9 and NF-κB proteins in epithelial ovarian cancer tissue and their clinical value Shen Wei 1,a, Chen Juan 2, Li Xiurong 1 and Yin Jie 1 1 Department of Obstetrics and Gynecology,

More information

Characterization and significance of MUC1 and c-myc expression in elderly patients with papillary thyroid carcinoma

Characterization and significance of MUC1 and c-myc expression in elderly patients with papillary thyroid carcinoma Characterization and significance of MUC1 and c-myc expression in elderly patients with papillary thyroid carcinoma Y.-J. Hu 1, X.-Y. Luo 2, Y. Yang 3, C.-Y. Chen 1, Z.-Y. Zhang 4 and X. Guo 1 1 Department

More information

Effect and mechanism of laminaria japonica polysaccharide (LJP) on apoptosis and cycle of nasopharyngeal carcinoma cells.

Effect and mechanism of laminaria japonica polysaccharide (LJP) on apoptosis and cycle of nasopharyngeal carcinoma cells. Biomedical Research 2017; 28 (15): 6706-6710 ISSN 0970-938X www.biomedres.info Effect and mechanism of laminaria japonica polysaccharide (LJP) on apoptosis and cycle of nasopharyngeal carcinoma cells.

More information

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model. A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth

More information

Supplementary Information

Supplementary Information Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6

More information

MicroRNA 98 suppresses cell growth and invasion of retinoblastoma via targeting the IGF1R/k Ras/Raf/MEK/ERK signaling pathway

MicroRNA 98 suppresses cell growth and invasion of retinoblastoma via targeting the IGF1R/k Ras/Raf/MEK/ERK signaling pathway INTERNATIONAL JOURNAL OF ONCOLOGY 54: 807-820, 2019 MicroRNA 98 suppresses cell growth and invasion of retinoblastoma via targeting the IGF1R/k Ras/Raf/MEK/ERK signaling pathway LONG GUO 1, YU BAI 2, SHUZHE

More information

mir-542-3p targets sphingosine-1-phosphate receptor 1 and regulates cell proliferation and invasion of breast cancer cells

mir-542-3p targets sphingosine-1-phosphate receptor 1 and regulates cell proliferation and invasion of breast cancer cells European Review for Medical and Pharmacological Sciences 2017; 21: 108-114 mir-542-3p targets sphingosine-1-phosphate receptor 1 and regulates cell proliferation and invasion of breast cancer cells H.-X.

More information

Targeting effect of microrna on CD133 and its impact analysis on proliferation and invasion of glioma cells

Targeting effect of microrna on CD133 and its impact analysis on proliferation and invasion of glioma cells Targeting effect of microrna on CD133 and its impact analysis on proliferation and invasion of glioma cells C. Zhao 1,2 *, Z.G. Ma 3 *, S.L. Mou 4, Y.X. Yang 2, Y.H. Zhang 2 and W.C. Yao 1 1 Department

More information

An Epstein-Barr virus-encoded microrna targets PUMA to promote host cell survival

An Epstein-Barr virus-encoded microrna targets PUMA to promote host cell survival An Epstein-Barr virus-encoded microrna targets to promote host cell survival The Journal of Experimental Medicine 205(11): 2551-2560, 2008. 1 Elizabeth Yee-Wai Choy, Kam-Leung Siu, Kin-Hang Kok, Raymond

More information

Research on the inhibitory effect of metformin on human oral squamous cell carcinoma SCC-4 and CAL-27 cells and the relevant molecular mechanism.

Research on the inhibitory effect of metformin on human oral squamous cell carcinoma SCC-4 and CAL-27 cells and the relevant molecular mechanism. Biomedical Research 2017; 28 (14): 6350-6354 ISSN 0970-938X www.biomedres.info Research on the inhibitory effect of metformin on human oral squamous cell carcinoma SCC-4 and CAL-27 cells and the relevant

More information

Effects of AFP gene silencing on Survivin mrna expression inhibition in HepG2 cells

Effects of AFP gene silencing on Survivin mrna expression inhibition in HepG2 cells mrna expression inhibition in HepG2 cells Z.L. Fang 1, N. Fang 2, X.N. Han 3, G. Huang 2, X.J. Fu 2, G.S. Xie 2, N.R. Wang 2 and J.P. Xiong 1 1 Department of Medical Oncology, The First Affiliated Hospital

More information

MiR-508-5p is a prognostic marker and inhibits cell proliferation and migration in glioma

MiR-508-5p is a prognostic marker and inhibits cell proliferation and migration in glioma European Review for Medical and Pharmacological Sciences MiR-508-5p is a prognostic marker and inhibits cell proliferation and migration in glioma Y.-H. LIU 1, B. LI 1, F.-G. MENG 1, L. QIU 2 2017; 21:

More information

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic

More information

Long non coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating mir 32 5p/PTEN axis

Long non coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating mir 32 5p/PTEN axis https://doi.org/10.1186/s13578-017-0192-0 Cell & Bioscience RESEARCH Open Access Long non coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating mir 32 5p/PTEN axis Zhi Qiang Gao *,

More information

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl

More information

Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis by regulating EZH2 and repressing E-cadherin in esophageal squamous cell carcinoma

Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis by regulating EZH2 and repressing E-cadherin in esophageal squamous cell carcinoma JBUON 2018; 23(1): 157-162 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis

More information

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation

More information

Effect of lncrna LET on proliferation and invasion of osteosarcoma cells

Effect of lncrna LET on proliferation and invasion of osteosarcoma cells European Review for Medical and Pharmacological Sciences 2018; 22: 1609-1614 Effect of lncrna LET on proliferation and invasion of osteosarcoma cells G. KONG 1, X.-J. QI 2, J.-F. WANG 3 1 Department of

More information

mir-367 promotes uveal melanoma cell proliferation and migration by regulating PTEN

mir-367 promotes uveal melanoma cell proliferation and migration by regulating PTEN mir-367 promotes uveal melanoma cell proliferation and migration by regulating PTEN J.W. Ling 1, P.R. Lu 2, Y.B. Zhang 1, S. Jiang 1 and Z.C. Zhang 1 1 Department of Ophthalmology, Third Hospital of Zhangjiagang,

More information

mir-132 inhibits lung cancer cell migration and invasion by targeting SOX4

mir-132 inhibits lung cancer cell migration and invasion by targeting SOX4 Original Article inhibits lung cancer cell migration and invasion by targeting SOX4 Yang Li, Lingling Zu, Yuli Wang, Min Wang, Peirui Chen, Qinghua Zhou Tianjin Key Laboratory of Lung Cancer Metastasis

More information

RESEARCH ARTICLE Jianjun Han, et al.: mir-361-5p in breast cancer

RESEARCH ARTICLE Jianjun Han, et al.: mir-361-5p in breast cancer The Bosnian Journal of Basic Medical Sciences publishes an Advanced online manuscript format as a free service to authors in order to expedite the dissemination of scientific findings to the research community

More information

Original Article mir-338-3p inhibits the proliferation and migration of gastric cancer cells by targeting ADAM17

Original Article mir-338-3p inhibits the proliferation and migration of gastric cancer cells by targeting ADAM17 Int J Clin Exp Pathol 2015;8(9):10922-10928 www.ijcep.com /ISSN:1936-2625/IJCEP0011715 Original Article mir-338-3p inhibits the proliferation and migration of gastric cancer cells by targeting ADAM17 Jiang-Tao

More information

Original Article MiR-130a regulates the proliferation and metastasis of HCC cells through targeting ZEB1/2

Original Article MiR-130a regulates the proliferation and metastasis of HCC cells through targeting ZEB1/2 Int J Clin Exp Pathol 2017;10(3):2744-2753 www.ijcep.com /ISSN:1936-2625/IJCEP0046135 Original Article MiR-130a regulates the proliferation and metastasis of HCC cells through targeting ZEB1/2 Ting Wang

More information

The effect of insulin on chemotherapeutic drug sensitivity in human esophageal and lung cancer cells

The effect of insulin on chemotherapeutic drug sensitivity in human esophageal and lung cancer cells The effect of insulin on chemotherapeutic drug sensitivity in human esophageal and lung cancer cells Published in: Natl Med J China, February 10, 2003; Vol 83, No 3, Page 195-197. Authors: JIAO Shun-Chang,

More information

TGF-β1 promotes human gastric carcinoma SGC7901 cells invasion by inducing autophagy

TGF-β1 promotes human gastric carcinoma SGC7901 cells invasion by inducing autophagy European Review for Medical and Pharmacological Sciences 2017; 21: 1013-1019 TGF-β1 promotes human gastric carcinoma SGC7901 cells invasion by inducing autophagy J. SHEN 1, D.-S. ZHAO 2, M.-Z. LI 1 1 Department

More information

Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases

Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Brief Communication Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Qinghai Zeng 1 *, Cuihong Jin 2 *, Wenhang Chen 2, Fang Xia 3, Qi Wang 3, Fan Fan 4,

More information

The pseudogene TUSC2P promotes TUSC2 function by binding multiple micrornas

The pseudogene TUSC2P promotes TUSC2 function by binding multiple micrornas Received 9 Aug 3 Accepted Nov 3 Published 7 Jan DOI:.38/ncomms39 The pseudogene promotes TUSC function by binding multiple micrornas OPEN Zina Jeyapalan Rutnam,, *, William W. Du,, *, Weining Yang, Xiangling

More information

Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas

Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Wang et al. Journal of Hematology & Oncology (2016) 9:90 DOI 10.1186/s13045-016-0323-9 RESEARCH Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Open Access Xiaofeng

More information

Influence of RNA Interference Targeting Rab5a on Proliferation and Invasion of Breast Cancer Cell Line MCF-7

Influence of RNA Interference Targeting Rab5a on Proliferation and Invasion of Breast Cancer Cell Line MCF-7 The Open Breast Cancer Journal, 2011, 3, 1-5 1 Open Access Influence of RNA Interference Targeting Rab5a on Proliferation and Invasion of Breast Cancer Cell Line MCF-7 Nier Cha 1,2, Xinyue Gu 1, Fengyun

More information

CytoSelect 48-Well Cell Adhesion Assay (Fibronectin-Coated, Colorimetric Format)

CytoSelect 48-Well Cell Adhesion Assay (Fibronectin-Coated, Colorimetric Format) Product Manual CytoSelect 48-Well Cell Adhesion Assay (Fibronectin-Coated, Colorimetric Format) Catalog Number CBA-050 48 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction

More information

Blocking the expression of the hepatitis B virus S gene in hepatocellular carcinoma cell lines with an anti-gene locked nucleic acid in vitro

Blocking the expression of the hepatitis B virus S gene in hepatocellular carcinoma cell lines with an anti-gene locked nucleic acid in vitro Blocking the expression of the hepatitis B virus S gene in hepatocellular carcinoma cell lines with an anti-gene locked nucleic acid in vitro Y.-B. Deng, H.-J. Qin, Y.-H. Luo, Z.-R. Liang and J.-J. Zou

More information

mir 140 5p inhibits cell proliferation and invasion in colorectal carcinoma by targeting SOX4

mir 140 5p inhibits cell proliferation and invasion in colorectal carcinoma by targeting SOX4 ONCOLOGY LETTERS mir 140 5p inhibits cell proliferation and invasion in colorectal carcinoma by targeting SOX4 ZHONGSONG ZHAO, WEIWEI LIU and JIANHUA LI Digestive System Department, Shandong Provincial

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

MicroRNA-30a functions as tumor suppressor and inhibits the proliferation and invasion of prostate cancer cells by down-regulation of SIX1

MicroRNA-30a functions as tumor suppressor and inhibits the proliferation and invasion of prostate cancer cells by down-regulation of SIX1 Human Cell (2017) 30:290 299 DOI 10.1007/s13577-017-0170-1 RESEARCH ARTICLE MicroRNA-30a functions as tumor suppressor and inhibits the proliferation and invasion of prostate cancer cells by down-regulation

More information

Supplementary Material

Supplementary Material Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

More information

Original Article Artemin promotes proliferation and metastasis in human laryngeal squamous cell carcinoma

Original Article Artemin promotes proliferation and metastasis in human laryngeal squamous cell carcinoma Int J Clin Exp Pathol 2017;10(10):10413-10418 www.ijcep.com /ISSN:1936-2625/IJCEP0058793 Original Article Artemin promotes proliferation and metastasis in human laryngeal squamous cell carcinoma Chao-Bing

More information

Long noncoding RNA DARS-AS1 acts as an oncogene by targeting mir-532-3p in ovarian cancer

Long noncoding RNA DARS-AS1 acts as an oncogene by targeting mir-532-3p in ovarian cancer European Review for Medical and Pharmacological Sciences 2019; 23: 2353-2359 Long noncoding RNA DARS-AS1 acts as an oncogene by targeting mir-532-3p in ovarian cancer K. HUANG, W.-S. FAN, X.-Y. FU, Y.-L.

More information

mir 375 inhibits the proliferation of gastric cancer cells by repressing ERBB2 expression

mir 375 inhibits the proliferation of gastric cancer cells by repressing ERBB2 expression EXPERIMENTAL AND THERAPEUTIC MEDICINE 7: 1757-1761, 2014 mir 375 inhibits the proliferation of gastric cancer cells by repressing ERBB2 expression ZHI YONG SHEN *, ZI ZHEN ZHANG *, HUA LIU, EN HAO ZHAO

More information

mir-19a promotes invasion and epithelial to mesenchymal transition of bladder cancer cells by targeting RhoB

mir-19a promotes invasion and epithelial to mesenchymal transition of bladder cancer cells by targeting RhoB JBUON 2019; 24(2): 797-804 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE mir-19a promotes invasion and epithelial to mesenchymal transition of

More information

Pleiotrophin, a target of mir-384, promotes proliferation, metastasis and lipogenesis in HBV-related hepatocellular carcinoma

Pleiotrophin, a target of mir-384, promotes proliferation, metastasis and lipogenesis in HBV-related hepatocellular carcinoma J. Cell. Mol. Med. Vol XX, No X, 2017 pp. 1-21 Pleiotrophin, a target of mir-384, promotes proliferation, metastasis and lipogenesis in HBV-related hepatocellular carcinoma Pei-song Bai a, #, Nan Xia b,

More information

Correspondence to: Jun-nian Zheng, * These authors contributed equally to this paper.

Correspondence to: Jun-nian Zheng,   * These authors contributed equally to this paper. Decreased expression of CHIP leads to increased angiogenesis via VEGF-VEGFR2 pathway and poor prognosis in human renal cell carcinoma Chao Sun 1, 2, 4, *, Hai-long Li 1, 2, *, Hai-rong Chen 6, *, Mei-lin

More information

Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation

Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation J. Du 1, Z.H. Tao 2, J. Li 2, Y.K. Liu 3 and L. Gan 2 1 Department of Chemistry,

More information

MiR-411-5p acts as a tumor suppressor in non-small cell lung cancer through targeting PUM1

MiR-411-5p acts as a tumor suppressor in non-small cell lung cancer through targeting PUM1 European Review for Medical and Pharmacological Sciences 2018; 22: 5546-5553 MiR-411-5p acts as a tumor suppressor in non-small cell lung cancer through targeting PUM1 L.-H. XIA 1, Q.-H. YAN 2, Q.-D. SUN

More information

ONCOLOGY LETTERS 15: , 2018

ONCOLOGY LETTERS 15: , 2018 10098 MicroRNA 154 functions as a tumor suppressor in non small cell lung cancer through directly targeting B cell specific Moloney murine leukemia virus insertion site 1 SIDA LIU 1, YANG YANG 2, LU CHEN

More information

B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer

B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small

More information

Effects of EZH2 gene on the growth and migration of hepatocellular carcinoma HepG2 cells

Effects of EZH2 gene on the growth and migration of hepatocellular carcinoma HepG2 cells Original Article Effects of EZH2 gene on the growth and migration of hepatocellular carcinoma HepG2 cells Hongtao Zhao 1, Yiyao Xu 2, Yilei Mao 2, Yangde Zhang 1 1 Hepatobiliary and Intestinal Surgery

More information

Long non-coding RNA SNHG15 indicates poor prognosis of non-small cell lung cancer and promotes cell proliferation and invasion

Long non-coding RNA SNHG15 indicates poor prognosis of non-small cell lung cancer and promotes cell proliferation and invasion European Review for Medical and Pharmacological Sciences 2018; 22: 2671-2679 Long non-coding RNA SNHG15 indicates poor prognosis of non-small cell lung cancer and promotes cell proliferation and invasion

More information

Mir-138-5p acts as a tumor suppressor by targeting pyruvate dehydrogenase kinase 1 in human retinoblastoma

Mir-138-5p acts as a tumor suppressor by targeting pyruvate dehydrogenase kinase 1 in human retinoblastoma European Review for Medical and Pharmacological Sciences 2017; 21: 5624-5629 Mir-138-5p acts as a tumor suppressor by targeting pyruvate dehydrogenase kinase 1 in human retinoblastoma Z. WANG 1, Y.-J.

More information

Association between downexpression of mir-1301 and poor prognosis in patients with glioma

Association between downexpression of mir-1301 and poor prognosis in patients with glioma European Review for Medical and Pharmacological Sciences 2017; 21: 4298-4303 Association between downexpression of mir-1301 and poor prognosis in patients with glioma Q.-L. BAI, C.-W. HU, X.-R. WANG, G.-F.

More information

Effect of sirna targeting EZH2 on cell viability and apoptosis of bladder cancer T24 cells

Effect of sirna targeting EZH2 on cell viability and apoptosis of bladder cancer T24 cells Effect of sirna targeting EZH2 on cell viability and apoptosis of bladder cancer T24 cells H.F. Wang 1, H. Yang 2, L.B. Hu 2, Y.H. Lei 2, Y. Qin 2, J. Li 2, C.W. Bi 2, J.S. Wang 1 and Q. Huo 1 1 Department

More information

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplementary data Supplementary Figure 1 Supplementary Figure 2 Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna

More information

Effect of ABCE1-silencing gene, transfected by electrotransfer, on the proliferation, invasion, and migration of human thyroid carcinoma SW579 cells

Effect of ABCE1-silencing gene, transfected by electrotransfer, on the proliferation, invasion, and migration of human thyroid carcinoma SW579 cells Effect of ABCE1-silencing gene, transfected by electrotransfer, on the proliferation, invasion, and migration of human thyroid carcinoma SW579 cells X. Qu 1,2 and L. Zhang 1 1 ENT and Maxillofacial Oncology,

More information

IL-24 AND ITS ROLE IN WOUND HEALING

IL-24 AND ITS ROLE IN WOUND HEALING IL-24 AND ITS ROLE IN WOUND HEALING Nancy J. Poindexter, Ryan Williams, Garth Powis, Sunil Chada, and Elizabeth A. Grimm & Introgen Therapeutics, Inc., Houston, TX IL-24/MDA 24/MDA-77 is a Tumor Suppressor

More information

MicroRNA-132 inhibits migration, invasion and epithelial-mesenchymal transition by regulating TGFβ1/Smad2 in human non-small cell lung cancer

MicroRNA-132 inhibits migration, invasion and epithelial-mesenchymal transition by regulating TGFβ1/Smad2 in human non-small cell lung cancer European Review for Medical and Pharmacological Sciences MicroRNA-132 inhibits migration, invasion and epithelial-mesenchymal transition by regulating TGFβ1/Smad2 in human non-small cell lung cancer J.-X.

More information

MicroRNA 124 3p inhibits cell growth and metastasis in cervical cancer by targeting IGF2BP1

MicroRNA 124 3p inhibits cell growth and metastasis in cervical cancer by targeting IGF2BP1 EXPERIMENTAL AND THERAPEUTIC MEDICINE 15: 1385-1393, 2018 MicroRNA 124 3p inhibits cell growth and metastasis in cervical cancer by targeting IGF2BP1 PING WANG 1, LI ZHANG 1, JUNHUI ZHANG 1 and GANGSHU

More information

LncSNHG14 promotes the development and progression of bladder cancer by targeting mirna-150-5p

LncSNHG14 promotes the development and progression of bladder cancer by targeting mirna-150-5p European Review for Medical and Pharmacological Sciences 2019; 23: 1022-1029 LncSNHG14 promotes the development and progression of bladder cancer by targeting mirna-150-5p J. LI 1,2, A.-S. WANG 2, S. WANG

More information

microrna 761 regulates glycogen synthase kinase 3β expression and promotes the proliferation and cell cycle of human gastric cancer cells

microrna 761 regulates glycogen synthase kinase 3β expression and promotes the proliferation and cell cycle of human gastric cancer cells ONCOLOGY LETTERS 16: 3459-3464, 2018 microrna 761 regulates glycogen synthase kinase 3β expression and promotes the proliferation and cell cycle of human gastric cancer cells XINFANG SUN, HONGTAO HOU,

More information

Correlation between expression and significance of δ-catenin, CD31, and VEGF of non-small cell lung cancer

Correlation between expression and significance of δ-catenin, CD31, and VEGF of non-small cell lung cancer Correlation between expression and significance of δ-catenin, CD31, and VEGF of non-small cell lung cancer X.L. Liu 1, L.D. Liu 2, S.G. Zhang 1, S.D. Dai 3, W.Y. Li 1 and L. Zhang 1 1 Thoracic Surgery,

More information

MicroRNA-590-5p suppresses the proliferation and invasion of non-small cell lung cancer by regulating GAB1

MicroRNA-590-5p suppresses the proliferation and invasion of non-small cell lung cancer by regulating GAB1 European Review for Medical and Pharmacological Sciences 2018; 22: 5954-5963 MicroRNA-590-5p suppresses the proliferation and invasion of non-small cell lung cancer by regulating GAB1 B.-B. XU 1, Z.-F.

More information

Carcinogenesis, 2015, Vol. 36, No. 6,

Carcinogenesis, 2015, Vol. 36, No. 6, Carcinogenesis, 2015, Vol. 36, No. 6, 676 684 doi:10.1093/carcin/bgv027 Advance Access publication April 11, 2015 Original Manuscript original manuscript mir-29c suppresses pancreatic cancer liver metastasis

More information

SUPPLEMENT. Materials and methods

SUPPLEMENT. Materials and methods SUPPLEMENT Materials and methods Cell culture and reagents Cell media and reagents were from Invitrogen unless otherwise indicated. Antibiotics and Tet-certified serum were from Clontech. In experiments

More information

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,

More information

Research Communication

Research Communication IUBMB Life, 64(7): 628 635, July 2012 Research Communication MicroRNA-181b Targets camp Responsive Element Binding Protein 1 in Gastric Adenocarcinomas Lin Chen*, Qian Yang*, Wei-Qing Kong*, Tao Liu, Min

More information

LncRNA NKILA suppresses colon cancer cell proliferation and migration by inactivating PI3K/Akt pathway

LncRNA NKILA suppresses colon cancer cell proliferation and migration by inactivating PI3K/Akt pathway Original Article LncRNA NKILA suppresses colon cancer cell proliferation and migration by inactivating PIK/Akt pathway Jian Huang #, Lingfeng Zhao #, Wei Chen #, Jian Duan 4, Dibesh Shrestha, Ruize Zhou,

More information

KDR gene silencing inhibits proliferation of A549cells and enhancestheir sensitivity to docetaxel

KDR gene silencing inhibits proliferation of A549cells and enhancestheir sensitivity to docetaxel KDR gene silencing inhibits proliferation of A549cells and enhancestheir sensitivity to docetaxel R. Wei and J.-P. Zang Department of Respiratory Medicine, People s Hospital of Zhengzhou, Zhengzhou, China

More information

Long noncoding RNA CASC2 inhibits metastasis and epithelial to mesenchymal transition of lung adenocarcinoma via suppressing SOX4

Long noncoding RNA CASC2 inhibits metastasis and epithelial to mesenchymal transition of lung adenocarcinoma via suppressing SOX4 European Review for Medical and Pharmacological Sciences 2017; 21: 4584-4590 Long noncoding RNA CASC2 inhibits metastasis and epithelial to mesenchymal transition of lung adenocarcinoma via suppressing

More information

Supporting Information For

Supporting Information For Supporting Information For MicroRNA-Catalyzed Cancer Therapeutics Based on DNA-Programmed Nanoparticle Complex Xucheng Luo, 1 Zhi Li, 1 Ganglin Wang, 1 Xuewen He, 2,3 Xiaoqin Shen, 1 Quanhong Sun, 1 Li

More information

The Research of Nanocrystallized Realgar for the Treatment of Skin Cancer

The Research of Nanocrystallized Realgar for the Treatment of Skin Cancer Journal of Cancer Therapy, 2013, 4, 43-47 http://dx.doi.org/10.4236/jct.2013.46a1007 Published Online July 2013 (http://www.scirp.org/journal/jct) 43 The Research of Nanocrystallized Realgar for the Treatment

More information

Supporting Information

Supporting Information Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)

More information

Mechanism of mirna-21-5p on apoptosis of IL-1β- induced rat. synovial cells

Mechanism of mirna-21-5p on apoptosis of IL-1β- induced rat. synovial cells Mechanism of mirna-21-5p on apoptosis of IL-1β- induced rat synovial cells Zhen Li 1,2,3,4, Xiaofu Li 4, Yi Wang 4, Qingjun Wei 1,2,3,* 1 Orthopaedic Department, the First Affiliated Hospital of Guangxi

More information

Supporting Information

Supporting Information Copyright WILEY-VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 212. Supporting Information for Adv. Funct. Mater., DOI:.2/adfm.2122233 MnO Nanocrystals: A Platform for Integration of MRI and Genuine

More information

LncRNA TUG1 promoted KIAA1199 expression via mir-600 to accelerate cell metastasis and epithelial-mesenchymal transition in colorectal cancer

LncRNA TUG1 promoted KIAA1199 expression via mir-600 to accelerate cell metastasis and epithelial-mesenchymal transition in colorectal cancer Sun et al. Journal of Experimental & Clinical Cancer Research (2018) 37:106 https://doi.org/10.1186/s13046-018-0771-x RESEARCH Open Access LncRNA TUG1 promoted KIAA1199 expression via mir-600 to accelerate

More information

The inhibitory effect of mir-375 targeting sp1 in colorectal cancer cell proliferation

The inhibitory effect of mir-375 targeting sp1 in colorectal cancer cell proliferation European Review for Medical and Pharmacological Sciences 2018; 22: 405-411 The inhibitory effect of mir-375 targeting sp1 in colorectal cancer cell proliferation X.-H. LIU, J. WANG, Y.-H. DONG Department

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

MiRNA-202 impacts proliferation and apoptosis of granulose cells

MiRNA-202 impacts proliferation and apoptosis of granulose cells MiRNA-202 impacts proliferation and apoptosis of granulose cells Liqiong Huang, Bo Zheng*, Yi He Department of Obstetrics and Gynecology, Xianning Central Hospital, The First Affiliated Hospital Of Hubei

More information

mir 146a 5p targets interleukin 1 receptor associated kinase 1 to inhibit the growth, migration, and invasion of breast cancer cells

mir 146a 5p targets interleukin 1 receptor associated kinase 1 to inhibit the growth, migration, and invasion of breast cancer cells ONCOLOGY LETTERS mir 146a 5p targets interleukin 1 receptor associated kinase 1 to inhibit the growth, migration, and invasion of breast cancer cells JING PEI LONG, LI FENG DONG, FANG FANG CHEN and YANG

More information

LncRNA-GAS5 induces PTEN expression through inhibiting mir-103 in endometrial cancer cells

LncRNA-GAS5 induces PTEN expression through inhibiting mir-103 in endometrial cancer cells Guo et al. Journal of Biomedical Science (2015) 22:100 DOI 10.1186/s12929-015-0213-4 RESEARCH Open Access LncRNA-GAS5 induces PTEN expression through inhibiting mir-103 in endometrial cancer cells Chen

More information

CytoSelect Tumor- Endothelium Adhesion Assay

CytoSelect Tumor- Endothelium Adhesion Assay Product Manual CytoSelect Tumor- Endothelium Adhesion Assay Catalog Number CBA- 215 100 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cancer metastasis comprises several

More information

Knockdown of Long Noncoding RNA LUCAT1 Inhibits Cell Viability and Invasion by Regulating mir-375 in Glioma

Knockdown of Long Noncoding RNA LUCAT1 Inhibits Cell Viability and Invasion by Regulating mir-375 in Glioma Oncology Research, Vol. 26, pp. 307 313 0965-0407/18 $90.00 +.00 Printed in the USA. All rights reserved. DOI: https://doi.org/10.3727/096504017x15088061795756 Copyright Ó 2018 Cognizant, LLC. E-ISSN 1555-3906

More information

Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.

Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence. Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the mutated sequence. 1 Supplementary Figure 2. Expression of mir-182 and SMAD7 in various cell lines. (A) Basal levels of mir-182 expression

More information

Quantitative Data Analysis Assignment Sample Newessays.co.uk

Quantitative Data Analysis Assignment Sample Newessays.co.uk Absorbance Quantitative Data Analysis Assignment Sample Newessays.co.uk Part A: Results of the Study Is there a difference of curve profile between the MTT assay and the cell number? What do the different

More information

Correlation between estrogen receptor β expression and the curative effect of endocrine therapy in breast cancer patients

Correlation between estrogen receptor β expression and the curative effect of endocrine therapy in breast cancer patients 1568 Correlation between estrogen receptor β expression and the curative effect of endocrine therapy in breast cancer patients LIYING GUO 1, YU ZHANG 2, WEI ZHANG 3 and DILIMINA YILAMU 1 1 Department of

More information

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.

More information

Tian-Song Liang, Ying-Juan Zheng, Juan Wang, Jing-Yi Zhao, Dao-Ke Yang * and Zhang-Suo Liu *

Tian-Song Liang, Ying-Juan Zheng, Juan Wang, Jing-Yi Zhao, Dao-Ke Yang * and Zhang-Suo Liu * Liang et al. Journal of Experimental & Clinical Cancer Research (29) 38:97 https://doi.org/.86/s346-9-23-4 RESEARCH Open Access MicroRNA-56 inhibits tumor growth and metastasis in nasopharyngeal carcinoma

More information

Prostate cancer (PCa) is a malignant tumor common

Prostate cancer (PCa) is a malignant tumor common UROLOGICAL ONCOLOGY Evaluation of Vitronectin Expression in Prostate Cancer and the Clinical Significance of the Association of Vitronectin Expression with Prostate Specific Antigen in Detecting Prostate

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny

More information

A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified

A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified Cell culture and animal model A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum at 37 C in humidified atmosphere containing

More information

Association of mir-21 with esophageal cancer prognosis: a meta-analysis

Association of mir-21 with esophageal cancer prognosis: a meta-analysis Association of mir-21 with esophageal cancer prognosis: a meta-analysis S.-W. Wen 1, Y.-F. Zhang 1, Y. Li 1, Z.-X. Liu 2, H.-L. Lv 1, Z.-H. Li 1, Y.-Z. Xu 1, Y.-G. Zhu 1 and Z.-Q. Tian 1 1 Department of

More information

Long non coding RNA NEAT1 promotes migration and invasion of oral squamous cell carcinoma cells by sponging microrna 365

Long non coding RNA NEAT1 promotes migration and invasion of oral squamous cell carcinoma cells by sponging microrna 365 EXPERIMENTAL AND THERAPEUTIC MEDICINE 16: 2243-2250, 2018 Long non coding RNA NEAT1 promotes migration and invasion of oral squamous cell carcinoma cells by sponging microrna 365 XIAOHUA LIU, WENZHI SHANG

More information

Original Article microrna-377 inhibits non-small-cell lung cancer through targeting AEG-1

Original Article microrna-377 inhibits non-small-cell lung cancer through targeting AEG-1 Int J Clin Exp Pathol 2015;8(11):13853-13863 www.ijcep.com /ISSN:1936-2625/IJCEP0010479 Original Article microrna-377 inhibits non-small-cell lung cancer through targeting AEG-1 Fanlu Meng, Linlin Zhang,

More information