Breast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data
|
|
- Willa Tyler
- 5 years ago
- Views:
Transcription
1 Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing and Data Mining Spring 2010 Breast cancer is a cancer that starts in the tissues of the breast Over the course of a lifetime, 1 in 8 women will be diagnosed with breast cancer. What are the causes? Can we do anything about this? Lu CSC 209 Fall Risk factors you cannot change include: Age and gender Family history of breast cancer Genes -- defects in the BRCA1 and BRCA2 genes Menstrual cycle. Treatment Plan Selection Treatment is based on many factors, including type and stage of the cancer whether the cancer is sensitive to certain hormones whether or not the cancer overproduces (over-expresses) a gene called HER2/neu Lu CSC 209 Fall Lu CSC 209 Fall
2 Cancer Treatments Chemotherapy to kill cancer cells Radiation therapy to destroy cancerous tissue Surgery to remove cancerous tissue Hormonal therapy to block certain hormones that fuel cancer growth Targeted therapy to interfere with cancer cell grow and function Targeted therapy newer type also called biologic therapy uses special anti-cancer drugs that identify certain changes in a cell that can lead to cancer this type of medicine plus chemotherapy can cut the risk of the cancer coming back by 50% Lu CSC 209 Fall Lu CSC 209 Fall Targeted Therapy for Breast Cancer Treatment Aimed at specific processes of cancer cell growth, division and lifecycle Existing targeted therapies for breast cancer include Avastin, Herceptin, Iressa, and Tykerb Each of these drugs has specific effects on cancer cells Needs for new drug Microarray Profile Data An Array or slide is a collection of features spatially arranged in a two dimensional grid, arranged in columns and rows microarrays can be used to measure changes in expression levels, to detect problems of our body Lu CSC 209 Fall Lu CSC 209 Fall
3 Our body Our body consists of a number of organs Each organ composes of a number of tissues Each tissue composes of cells of the same type. Cell Cell performs two type of functions Perform chemical reactions necessary to maintain our life Pass the information for maintaining life to the next generation We also know that Protein performs chemical reactions DNA stores and passes information RNA is the intermediate between DNA and proteins Lu CSC 209 Fall Lu CSC 209 Fall DNA DNA stores the instruction needed by the cell to perform daily life function. It consists of two strands which interwoven together and form a double helix. Each strand is a chain of some small molecules called nucleotides. Double stranded DNA Normally, DNA is double stranded within a cell. The two strands are antiparallel. One strand is the reverse complement of another one. The double strands are interwoven together and form a double helix. One reason for double stranded is that it eases DNA replicate. Lu CSC 209 Fall Lu CSC 209 Fall
4 Some terms related to DNA Genome Chromosome Gene Lu CSC 209 Fall Chromosome Usually, a DNA is tightly wound around histone proteins and forms a chromosome. The total information stored in all chromosomes constitute a genome. In most multi-cell organisms, every cell contains the same complete set of genome. May have some small difference due to mutation Example: Human Genome: has 3G base pairs, organized in 23 pairs of chromosomes Lu CSC 209 Fall Gene A gene is a sequence of DNA that encodes a protein or an RNA molecule. In human genome, it is expected there are 30,000 35,000 genes. For gene that encodes protein, In Prokaryotic genome, one gene corresponds to one protein In Eukaryotic genome, one gene can corresponds to more than one protein because of the process alternative splicing Lu CSC 209 Fall Central Dogma Central Dogma tells us how we get the protein from the gene. This process is called gene expression. The expression of gene consists of two steps Transcription: DNA mrna Translation: mrna Protein Post-translation Modification: Protein Modified protein RNA AAAA DNA Protein Modified Protein Lu CSC 209 Fall
5 More on Gene Structure regulatory region 5' untranslated region coding region 3' untranslated region Gene has 4 regions Coding region contains the codons for protein. It is also called open reading frame. Its length is a multiple of 3. It must begin with start codon, end with end codon, and the rest of its codons are not a end codon. mrna transcript contains 5 untranslated region + coding region + 3 untranslated region Regulatory region contains promoter, which regulate the transcription process. Lu CSC 209 Fall Hybridization Among thousands of DNA fragments, Biologists routinely need to find a DNA fragment which contains a particular DNA subsequence. This can be done based on hybridization. 1. Suppose we need to find a DNA fragments which contains ACCGAT. 2. Create probes which is inversely complementary to ACCGAT. 3. Mix the probes with the DNA fragments. 4. Due to the hybridization rule (A=T, C G), DNA fragments which contain ACCGAT will hybridize with the probes. Lu CSC 209 Fall DNA array The idea of hybridization leads to the DNA array technology. In the past, one gene in one experiment Hard to get the whole picture DNA array is a technology which allows researchers to do experiment on a set of genes or even the whole genome. DNA array s idea (I) An orderly arrangement of thousands of spots. Each spot contains many copies of the same DNA fragment. Lu CSC 209 Fall Lu CSC 209 Fall
6 DNA array s idea (II) When the array is exposed to the target solution, DNA fragments in both array and target solution will match based on hybridization rule: A=T, C G (hydrogen bond) Such idea allows us to do thousands of hybridization experiments at the same time. DNA sample hybridize Applications of DNA arrays Sequencing by hybridization A promising alternative to sequencing by gel electrophoresis It may be able to reconstruct longer DNA sequences in shorter time Expression profile of a cell DNA arrays allow us to monitor the activities within a cell Each spot contains the complement of a particular gene Due to hybridization, we can measure the concentration of different mrnas within a cell SNP detection Using probes with different alleles to detect the single nucleotide variation. Many many other applications! Lu CSC 209 Fall Lu CSC 209 Fall Gene regulation Every cell of an organism has exactly the same genome Different cells express different set of genes to form different types of tissues How does a cell know what genes are required and when they should express? the process of controlling the expression of gene is called gene regulation Lu CSC 209 Fall Transcription Factors (TF s) Gene regulation dictates when, where (in what tissue) and how much quantity of a particular proteins is produced The most direct control mechanism is transcription regulation RNA-polymerase is responsible for the transcription with the assistance of a number of DNA binding proteins called transcription factors (TF s) Lu CSC 209 Fall
7 Binding-sites finding using ChIP-PET or ChIP-seq What is Binding site? Problem: objectives looking for the association rules between a group of TF s (module) and a target gene behavior ( or ) from a single time-series profile data Binding site of Fos Genome Lu CSC 209 Fall Lu CSC 209 Fall Problem: outputs Desired results which are expressed in association rules: (TF1 TF2 TF3 ) target gene (TF1 TF2, 28 dist. 30) ( ) target gene Lu CSC 209 Fall Enhancers - 1 One type of TF -- transcription factors ("Enhancer-binding protein") bind to regions of DNA that are thousands of base pairs away from the gene they control. Binding increases the rate of transcription of the gene. Enhancers can be located upstream, downstream, or even within the gene they control. Lu CSC 209 Fall
8 Enhancer - 2 Silencers Another type of TF Silencers are control regions of DNA that, like enhancers, may be located thousands of base pairs away from the gene they control. However, when transcription factors bind to them, expression of the gene they control is repressed. Lu CSC 209 Fall Lu CSC 209 Fall Problem: Input data - 1 Data file 1: describes the details of each candidate enhancer: location of the TF binding site relative to the peak location of the enhancer Each row is an enhancer. Each factor has 3 columns: Column 1: position Column 2: PWM score Column 3: p-value Problem: Input Data - 2 Data file 2 the enhancer expression time series profile data for a particular breast cancer patient. Column Columns A F are for enhancer candidate Columns G S are for breast gene K: transcription start site (TSS) L: transcription end site M: distance between TSS and the peak location M, O, P, Q, R, S: the microarray expression Level at different time (3hr, 6hr, 9hr, 12hr, 24hr, and 48hr) Lu CSC 209 Fall Lu CSC 209 Fall
9 Inferring Transcriptional Module Methods Data pre-processing Efficient algorithm for ranking and sorting profile data into input data for the data mining algorithm to be used Data mining Algorithm to identify the association rules that can be helpful to our understanding of regulatory network drug design Early work -1 GRAM 2003 [1] The GRAM algorithm explicitly links genes to the factors that regulate them by incorporating DNA binding data > biological insights into the regulatory network GSEA 2005 [2] Gene Set Enrichment Analysis (GSEA) yields insights into several cancer-related data sets including Leukemia and lung cancer. Lu CSC 209 Fall Lu CSC 209 Fall Early work - 2 ReMoDiscovery 2006 [3] A two-step methodology to unravel active modules based on the concurrent analysis of three data sources: Seed discovery step predicts seed module Seed extension step optimizes the gene content of the module and indicates whether the module is active or not in regulation Data integration is tackled using the Apriori algorithm Early work - 3 EEM 2009 [4] We still have little knowledge about regulatory mechanisms underlying the trascriptome EEM the latest module discovery method by extending previously reported module discovery methods, and applied it to breast cancer expression data Identified 10 principle expression modules based on their expression coherence Lu CSC 209 Fall Lu CSC 209 Fall
10 Spring 2019 CSC 177 Data Warehousing and Data Mining Elective for both CSC graduate and undergraduate A course term project can lead to a MS project on data warehousing or data mining CSC 177 MS Project topics Data mining applications: Inferring transcriptional modules from cancer profile data Your choices of data mining problem domain Data warehousing courseware development [5] Data mining concept animation library [6] Lu CSC 209 Fall Lu CSC 209 Fall References 1. Computational discovery of gene modules and regulatory networks by Z. Bar-Joseph, Nature Biotechnology, November Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles by A. Subramanian, PNAS, October Inferring transcriptional modules from ChIP-chip, motif and microarray data by Karen Lemmens, Genome Biology, Gene set-based module discovery in the breast cancer transcriptome by Atsushi Niida, BMC Bioinformatics, February, Towards a data mining concept animation library by Nisarg Rajesh Shah and Meiliu Lu, Research, Reflections and Innovations in Integrating ICT I Education Vol. 3, Lu CSC 209 Fall
RNA-seq Introduction
RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated
More informationVariant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
More informationComputational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological
More informationTranscriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc
Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression Chromatin Array of nuc 1 Transcriptional control in Eukaryotes: Chromatin undergoes structural changes
More informationCh. 18 Regulation of Gene Expression
Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate
More informationThe Biology and Genetics of Cells and Organisms The Biology of Cancer
The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried
More informationDiscovery of Novel Human Gene Regulatory Modules from Gene Co-expression and
Discovery of Novel Human Gene Regulatory Modules from Gene Co-expression and Promoter Motif Analysis Shisong Ma 1,2*, Michael Snyder 3, and Savithramma P Dinesh-Kumar 2* 1 School of Life Sciences, University
More informationTRANSCRIPTION. DNA à mrna
TRANSCRIPTION DNA à mrna Central Dogma Animation DNA: The Secret of Life (from PBS) http://www.youtube.com/watch? v=41_ne5ms2ls&list=pl2b2bd56e908da696&index=3 Transcription http://highered.mcgraw-hill.com/sites/0072507470/student_view0/
More informationComputer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015
Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a
More informationBio 111 Study Guide Chapter 17 From Gene to Protein
Bio 111 Study Guide Chapter 17 From Gene to Protein BEFORE CLASS: Reading: Read the introduction on p. 333, skip the beginning of Concept 17.1 from p. 334 to the bottom of the first column on p. 336, and
More informationIntroduction to Genetics
Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist
More informationLife Sciences 1A Midterm Exam 2. November 13, 2006
Name: TF: Section Time Life Sciences 1A Midterm Exam 2 November 13, 2006 Please write legibly in the space provided below each question. You may not use calculators on this exam. We prefer that you use
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationRegulation of Gene Expression in Eukaryotes
Ch. 19 Regulation of Gene Expression in Eukaryotes BIOL 222 Differential Gene Expression in Eukaryotes Signal Cells in a multicellular eukaryotic organism genetically identical differential gene expression
More informationBi 8 Lecture 17. interference. Ellen Rothenberg 1 March 2016
Bi 8 Lecture 17 REGulation by RNA interference Ellen Rothenberg 1 March 2016 Protein is not the only regulatory molecule affecting gene expression: RNA itself can be negative regulator RNA does not need
More informationDNA codes for RNA, which guides protein synthesis.
Section 3: DNA codes for RNA, which guides protein synthesis. K What I Know W What I Want to Find Out L What I Learned Vocabulary Review synthesis New RNA messenger RNA ribosomal RNA transfer RNA transcription
More informationLESSON 4.4 WORKBOOK. How viruses make us sick: Viral Replication
DEFINITIONS OF TERMS Eukaryotic: Non-bacterial cell type (bacteria are prokaryotes).. LESSON 4.4 WORKBOOK How viruses make us sick: Viral Replication This lesson extends the principles we learned in Unit
More informationComputational aspects of ChIP-seq. John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory
Computational aspects of ChIP-seq John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory ChIP-seq Using highthroughput sequencing to investigate DNA
More informationEukaryotic Gene Regulation
Eukaryotic Gene Regulation Chapter 19: Control of Eukaryotic Genome The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different,
More informationHands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
More informationChIP-seq data analysis
ChIP-seq data analysis Harri Lähdesmäki Department of Computer Science Aalto University November 24, 2017 Contents Background ChIP-seq protocol ChIP-seq data analysis Transcriptional regulation Transcriptional
More informationPROTEIN SYNTHESIS. It is known today that GENES direct the production of the proteins that determine the phonotypical characteristics of organisms.
PROTEIN SYNTHESIS It is known today that GENES direct the production of the proteins that determine the phonotypical characteristics of organisms.» GENES = a sequence of nucleotides in DNA that performs
More informationPeak-calling for ChIP-seq and ATAC-seq
Peak-calling for ChIP-seq and ATAC-seq Shamith Samarajiwa CRUK Autumn School in Bioinformatics 2017 University of Cambridge Overview Peak-calling: identify enriched (signal) regions in ChIP-seq or ATAC-seq
More informationAccessing and Using ENCODE Data Dr. Peggy J. Farnham
1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000
More informationBreast Cancer and Biotechnology Jacquie Bay, Jo Perry, Michal Denny and Peter Lobie
LENScience Senior Biology Seminar Series Breast Cancer and Biotechnology Jacquie Bay, Jo Perry, Michal Denny and Peter Lobie Breast Cancer Each year in New Zealand, approximately 2,400 women and 20 men
More informationEPIGENOMICS PROFILING SERVICES
EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation
More informationSection 6. Junaid Malek, M.D.
Section 6 Junaid Malek, M.D. The Golgi and gp160 gp160 transported from ER to the Golgi in coated vesicles These coated vesicles fuse to the cis portion of the Golgi and deposit their cargo in the cisternae
More informationTake-Home Final Exam: Mining Regulatory Modules from Gene Expression Data
Take-Home Final Exam: Mining Regulatory Modules from Gene Expression Data 36-350, Data Mining; Fall 2009 Due at 5 pm on Tuesday, 15 December 2009 There are three problems, each with several parts. All
More informationRNA- seq Introduc1on. Promises and pi7alls
RNA- seq Introduc1on Promises and pi7alls DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different func1onal RNAs Which RNAs (and some1mes
More informationBIOLOGY 111. CHAPTER 9: The Links in Life s Chain Genetics and Cell Division
BIOLOGY 111 CHAPTER 9: The Links in Life s Chain Genetics and Cell Division The Links in Life s Chain: Genetics and Cell Division 9.1 An Introduction to Genetics 9.2 An Introduction to Cell Division 9.3
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationSTAT1 regulates microrna transcription in interferon γ stimulated HeLa cells
CAMDA 2009 October 5, 2009 STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells Guohua Wang 1, Yadong Wang 1, Denan Zhang 1, Mingxiang Teng 1,2, Lang Li 2, and Yunlong Liu 2 Harbin
More informationLast time we talked about the few steps in viral replication cycle and the un-coating stage:
Zeina Al-Momani Last time we talked about the few steps in viral replication cycle and the un-coating stage: Un-coating: is a general term for the events which occur after penetration, we talked about
More informationMolecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC
Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationRNA Processing in Eukaryotes *
OpenStax-CNX module: m44532 1 RNA Processing in Eukaryotes * OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression II TRANSLATION RIBOSOMES: protein synthesizing machines Translation takes place on defined
More informationProtein Synthesis
Protein Synthesis 10.6-10.16 Objectives - To explain the central dogma - To understand the steps of transcription and translation in order to explain how our genes create proteins necessary for survival.
More informationRaymond Auerbach PhD Candidate, Yale University Gerstein and Snyder Labs August 30, 2012
Elucidating Transcriptional Regulation at Multiple Scales Using High-Throughput Sequencing, Data Integration, and Computational Methods Raymond Auerbach PhD Candidate, Yale University Gerstein and Snyder
More informationHuman Genome: Mapping, Sequencing Techniques, Diseases
Human Genome: Mapping, Sequencing Techniques, Diseases Lecture 4 BINF 7580 Fall 2005 1 Let us review what we talked about at the previous lecture. Please,... 2 The central dogma states that the transfer
More informationRNA (Ribonucleic acid)
RNA (Ribonucleic acid) Structure: Similar to that of DNA except: 1- it is single stranded polunucleotide chain. 2- Sugar is ribose 3- Uracil is instead of thymine There are 3 types of RNA: 1- Ribosomal
More informationGenetics. Instructor: Dr. Jihad Abdallah Transcription of DNA
Genetics Instructor: Dr. Jihad Abdallah Transcription of DNA 1 3.4 A 2 Expression of Genetic information DNA Double stranded In the nucleus Transcription mrna Single stranded Translation In the cytoplasm
More informationGeneral Biology 1004 Chapter 11 Lecture Handout, Summer 2005 Dr. Frisby
Slide 1 CHAPTER 11 Gene Regulation PowerPoint Lecture Slides for Essential Biology, Second Edition & Essential Biology with Physiology Presentation prepared by Chris C. Romero Neil Campbell, Jane Reece,
More informationTranscription and RNA processing
Transcription and RNA processing Lecture 7 Biology 3310/4310 Virology Spring 2018 It is possible that Nature invented DNA for the purpose of achieving regulation at the transcriptional rather than at the
More informationFor all of the following, you will have to use this website to determine the answers:
For all of the following, you will have to use this website to determine the answers: http://blast.ncbi.nlm.nih.gov/blast.cgi We are going to be using the programs under this heading: Answer the following
More informationgenomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
More informationPoint total. Page # Exam Total (out of 90) The number next to each intermediate represents the total # of C-C and C-H bonds in that molecule.
This exam is worth 90 points. Pages 2- have questions. Page 1 is for your reference only. Honor Code Agreement - Signature: Date: (You agree to not accept or provide assistance to anyone else during this
More informationChapter 11 How Genes Are Controlled
Chapter 11 How Genes Are Controlled PowerPoint Lectures for Biology: Concepts & Connections, Sixth Edition Campbell, Reece, Taylor, Simon, and Dickey Copyright 2009 Pearson Education, Inc. Lecture by Mary
More informationThe Blueprint of Life: DNA to Protein. What is genetics? DNA Structure 4/27/2011. Chapter 7
The Blueprint of Life: NA to Protein Chapter 7 What is genetics? The science of heredity; includes the study of genes, how they carry information, how they are replicated, how they are expressed NA Structure
More informationThe Blueprint of Life: DNA to Protein
The Blueprint of Life: NA to Protein Chapter 7 What is genetics? The science of heredity; includes the y; study of genes, how they carry information, how they are replicated, how they are expressed 1 NA
More informationCentral Dogma. Central Dogma. Translation (mrna -> protein)
Central Dogma Central Dogma Translation (mrna -> protein) mrna code for amino acids 1. Codons as Triplet code 2. Redundancy 3. Open reading frames 4. Start and stop codons 5. Mistakes in translation 6.
More informationUnit 9: The Cell Cycle
Unit 9: The Cell Cycle Name: Period: Test Date: 1 Table of Contents Title of Page Page Number Teacher Stamp Unit 9 Warm-Ups 3-4 Cell Cycle/Interphase Notes 5-6 DNA Replication Notes 7-8 DNA replication
More informationGene Regulation Part 2
Michael Cummings Chapter 9 Gene Regulation Part 2 David Reisman University of South Carolina Other topics in Chp 9 Part 2 Protein folding diseases Most diseases are caused by mutations in the DNA that
More informationMolecular Cell Biology - Problem Drill 10: Gene Expression in Eukaryotes
Molecular Cell Biology - Problem Drill 10: Gene Expression in Eukaryotes Question No. 1 of 10 1. Which of the following statements about gene expression control in eukaryotes is correct? Question #1 (A)
More informationAlternative RNA processing: Two examples of complex eukaryotic transcription units and the effect of mutations on expression of the encoded proteins.
Alternative RNA processing: Two examples of complex eukaryotic transcription units and the effect of mutations on expression of the encoded proteins. The RNA transcribed from a complex transcription unit
More informationGene expression analysis. Roadmap. Microarray technology: how it work Applications: what can we do with it Preprocessing: Classification Clustering
Gene expression analysis Roadmap Microarray technology: how it work Applications: what can we do with it Preprocessing: Image processing Data normalization Classification Clustering Biclustering 1 Gene
More informationProfiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola
Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the
More informationUnit 9: The Cell Cycle
Unit 9: The Cell Cycle Name: Period: Test Date: 1 Table of Contents Title of Page Page Number Teacher Stamp Unit 9 Warm-Ups 3-4 Cell Cycle/Interphase Notes 5 DNA Replication Video 6 Cancer Notes 15-16
More informationMicroRNA and Male Infertility: A Potential for Diagnosis
Review Article MicroRNA and Male Infertility: A Potential for Diagnosis * Abstract MicroRNAs (mirnas) are small non-coding single stranded RNA molecules that are physiologically produced in eukaryotic
More informationLESSON 3.2 WORKBOOK. How do normal cells become cancer cells? Workbook Lesson 3.2
For a complete list of defined terms, see the Glossary. Transformation the process by which a cell acquires characteristics of a tumor cell. LESSON 3.2 WORKBOOK How do normal cells become cancer cells?
More informationBreast Cancer and Biotechnology Jacquie L. Bay, Jo K. Perry and Peter E. Lobie
LENScience Senior Biology Seminar Series Breast Cancer and Biotechnology Jacquie L. Bay, Jo K. Perry and Peter E. Lobie Breast Cancer Each year in New Zealand, approximately 2,400 women and 20 men are
More informationIPA Advanced Training Course
IPA Advanced Training Course October 2013 Academia sinica Gene (Kuan Wen Chen) IPA Certified Analyst Agenda I. Data Upload and How to Run a Core Analysis II. Functional Interpretation in IPA Hands-on Exercises
More informationChapter 9. Cells Grow and Reproduce
Chapter 9 Cells Grow and Reproduce DNA Replication DNA polymerase Addition of a nucleotide to the 3 end of a growing strand Use dntps as substrate Release of pyrophosphate Initiation of Replication Replication
More informationChapter 1 : Genetics 101
Chapter 1 : Genetics 101 Understanding the underlying concepts of human genetics and the role of genes, behavior, and the environment will be important to appropriately collecting and applying genetic
More informationUser Guide. Association analysis. Input
User Guide TFEA.ChIP is a tool to estimate transcription factor enrichment in a set of differentially expressed genes using data from ChIP-Seq experiments performed in different tissues and conditions.
More information1 By Drs. Ingrid Waldron and. Jennifer Doherty, Department of Biology, University of Pennsylvania, These Teacher
Teacher Preparation Notes for "From Gene to Protein via Transcription and Translation" 1 In this analysis and discussion activity, students learn (1) how genes provide the instructions for making a protein
More informationCytogenetics Technologies, Companies & Markets
Cytogenetics Technologies, Companies & Markets By Prof. K. K. Jain MD, FRACS, FFPM Jain PharmaBiotech Basel, Switzerland November 2018 A Jain PharmaBiotech Report A U T H O R ' S B I O G R A P H Y Professor
More informationOverview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment
Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development
More informationChIP-seq analysis. J. van Helden, M. Defrance, C. Herrmann, D. Puthier, N. Servant, M. Thomas-Chollier, O.Sand
ChIP-seq analysis J. van Helden, M. Defrance, C. Herrmann, D. Puthier, N. Servant, M. Thomas-Chollier, O.Sand Tuesday : quick introduction to ChIP-seq and peak-calling (Presentation + Practical session)
More informationGene Regulation - 4. One view of the Lactose Operon
Gene Regulation - 1 Regulating Genes We have been discussing the structure of DNA and that the information stored in DNA is used to direct protein synthesis. We've studied how RNA molecules are used to
More informationProcessing, integrating and analysing chromatin immunoprecipitation followed by sequencing (ChIP-seq) data
Processing, integrating and analysing chromatin immunoprecipitation followed by sequencing (ChIP-seq) data Bioinformatics methods, models and applications to disease Alex Essebier ChIP-seq experiment To
More informationAssociation mapping (qualitative) Association scan, quantitative. Office hours Wednesday 3-4pm 304A Stanley Hall. Association scan, qualitative
Association mapping (qualitative) Office hours Wednesday 3-4pm 304A Stanley Hall Fig. 11.26 Association scan, qualitative Association scan, quantitative osteoarthritis controls χ 2 test C s G s 141 47
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationPatrick: An Introduction to Medicinal Chemistry 5e Chapter 06
01) Match the following structures to their names. a. b. c. d. 02) ame the following structures (i) (iv) i) H ii) 2 iii) iv) H 2 CH 3 H H H H H H a. Deoxyadenosine = b. Deoxyguanosine = c. Deoxythymidine
More informationThe bases on complementary strands of DNA bond with each other in a specific way A-T and G-C
1 Bio 1101 Lecture 6 (Guided Notes) Ch. 8: Cellular Basis of Reproduction 2 3 4 5 6 Cellular Basis of Reproduction & Inheritance In order for an organism to replace dead cells or to grow and produce new
More informationCancer. October is National Breast Cancer Awareness Month
Cancer October is National Breast Cancer Awareness Month Objectives 1: Gene regulation Explain how cells in all the different parts of your body develop such different characteristics and functions. Contrast
More informationnumbe r Done by Corrected by Doctor
numbe r 5 Done by Mustafa Khader Corrected by Mahdi Sharawi Doctor Ashraf Khasawneh Viral Replication Mechanisms: (Protein Synthesis) 1. Monocistronic Method: All human cells practice the monocistronic
More information7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
More informationEXPression ANalyzer and DisplayER
EXPression ANalyzer and DisplayER Tom Hait Aviv Steiner Igor Ulitsky Chaim Linhart Amos Tanay Seagull Shavit Rani Elkon Adi Maron-Katz Dorit Sagir Eyal David Roded Sharan Israel Steinfeld Yossi Shiloh
More informationMechanisms of alternative splicing regulation
Mechanisms of alternative splicing regulation The number of mechanisms that are known to be involved in splicing regulation approximates the number of splicing decisions that have been analyzed in detail.
More informationThe bases on complementary strands of DNA bond with each other in a specific way A-T and G-C
1 Bio 1101 Lecture 6 Ch. 8: Cellular Basis of Reproduction 2 3 4 5 6 Cellular Basis of Reproduction & Inheritance In order for an organism to replace dead cells or to grow and produce new cells, existing
More informationNot IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
More informationData mining with Ensembl Biomart. Stéphanie Le Gras
Data mining with Ensembl Biomart Stéphanie Le Gras (slegras@igbmc.fr) Guidelines Genome data Genome browsers Getting access to genomic data: Ensembl/BioMart 2 Genome Sequencing Example: Human genome 2000:
More informationThe Meaning of Genetic Variation
Activity 2 The Meaning of Genetic Variation Focus: Students investigate variation in the beta globin gene by identifying base changes that do and do not alter function, and by using several CD-ROM-based
More informationGenomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
More informationSupplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
More informationMRC-Holland MLPA. Description version 08; 30 March 2015
SALSA MLPA probemix P351-C1 / P352-D1 PKD1-PKD2 P351-C1 lot C1-0914: as compared to the previous version B2 lot B2-0511 one target probe has been removed and three reference probes have been replaced.
More informationDNA, Genes, and Chromosomes. The instructions for life!!!
DNA, Genes, and Chromosomes The instructions for life!!! Gene Segment of DNA that has the information (the code) for a protein or RNA. A single molecule of DNA has thousands of genes on the molecule. Remember
More informationCELLS. Cells. Basic unit of life (except virus)
Basic unit of life (except virus) CELLS Prokaryotic, w/o nucleus, bacteria Eukaryotic, w/ nucleus Various cell types specialized for particular function. Differentiation. Over 200 human cell types 56%
More informationGenetics and Genomics in Medicine Chapter 6 Questions
Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions
More informationCytogenetics 101: Clinical Research and Molecular Genetic Technologies
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these
More informationPRECISION INSIGHTS. GPS Cancer. Molecular Insights You Can Rely On. Tumor-normal sequencing of DNA + RNA expression.
PRECISION INSIGHTS GPS Cancer Molecular Insights You Can Rely On Tumor-normal sequencing of DNA + RNA expression www.nanthealth.com Cancer Care is Evolving Oncologists use all the information available
More informationA Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis
A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis Jian Xu, Ph.D. Children s Research Institute, UTSW Introduction Outline Overview of genomic and next-gen sequencing technologies
More informationGenome-wide Association Studies (GWAS) Pasieka, Science Photo Library
Lecture 5 Genome-wide Association Studies (GWAS) Pasieka, Science Photo Library Chi-squared test to evaluate whether the odds ratio is different from 1. Corrected for multiple testing Source: wikipedia.org
More informationSeptember 20, Submitted electronically to: Cc: To Whom It May Concern:
History Study (NOT-HL-12-147), p. 1 September 20, 2012 Re: Request for Information (RFI): Building a National Resource to Study Myelodysplastic Syndromes (MDS) The MDS Cohort Natural History Study (NOT-HL-12-147).
More information6.3 DNA Mutations. SBI4U Ms. Ho-Lau
6.3 DNA Mutations SBI4U Ms. Ho-Lau DNA Mutations Gene expression can be affected by errors that occur during DNA replication. Some errors are repaired, but others can become mutations (changes in the nucleotide
More informationQuestion #1 Controls on cell growth and division turned on and off
Lesson Overview 10.3 Regulating the Cell Cycle Question #1 Controls on cell growth and division turned on and off When cells are grown in the laboratory, most cells will divide until they come into contact
More informationLecture 2: Virology. I. Background
Lecture 2: Virology I. Background A. Properties 1. Simple biological systems a. Aggregates of nucleic acids and protein 2. Non-living a. Cannot reproduce or carry out metabolic activities outside of a
More informationIntegrative Omics for The Systems Biology of Complex Phenotypes
Integrative Omics for The Systems Biology of Complex Phenotypes Mehmet Koyutürk Case Western Reserve University (1) Electrical Engineering and Computer Science (2) Center for Proteomics and Bioinformatics
More informationSections 12.3, 13.1, 13.2
Sections 12.3, 13.1, 13.2 Now that the DNA has been copied, it needs to send its genetic message to the ribosomes so proteins can be made Transcription: synthesis (making of) an RNA molecule from a DNA
More information