A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples
|
|
|
- Jonah Richards
- 5 years ago
- Views:
Transcription
1 A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples Sona Pekova, MD., PhD. Chambon Ltd., Laboratory for molecular diagnostics, Prague, Czech Republic , Konference DNA analýza X, Novotel Praha
2 TP53 The Guardian of the Genome (David Lane, 1992) mapped to 17p G1/S arrest vs apoptosis physiologically low level of TP53 activity of TP53 tightly regulated (MDM-2, ATM, ATR, p19arf )
3 Functional analysis of TP53 Genotype does not necessarily need to translate into phenotype FASAY Functional Analysis of Separated Alleles in Yeast in vitro test of the functional activity of TP53 DNA-binding domain color of transgenic yeast colonies indicates mutated or wild type TP53 allele
4 The principle of FASAY in vitro recombination of TP53 into GM yeasts p53 promotor Selection medium with low adenine Red colonies mut White colonies wt p53 respons promotor ADE2 pss16 p53 Red colonies are re-sequenced to identify clonal TP53 mutation
5 A. Detection of biologically relevant TP53 variants C277Y 60.1 % red colonies
6 B. Identification of small subclones with TP53 mutation E220R 27.5 % red colonies
7 C. Splicing TP53 variants delta ex6 TP53 splicing variant in CLL 45.3 % red colonies on FASAY Pekova et al., Leukemia Research, 2010
8
9 Bourdon et al., Genes Dev., 2005
10 Protein expression of the D ex6 TP53 variant Pekova et al., Leukemia Research, 2010
11 Pekova et al., Leukemia Research, 2010 In vitro growth properties of stabledex6 TP53 cell lines H1299 Dex6 H1299 mock
12 Growth curves of stable Dex6 TP53 and mock transfected H1299 cell lines Pekova et al., Leukemia Research, 2010
13 Pekova et al., Leukemia Research, 2010 Expression profiles of Dex6 TP53 and mock transfected H1299 cell lines Dex6 vs mock Affymetrix GeneChip Human Exon 1.0 ST array
14 Pekova et al., Leukemia Research, 2010 In vitro properties of the Dex6 TP53 variant: cyclins (A1, G1, G2, F, I, B2, A2, T2) matrix metalloproteinases serine proteases hyaluronidases inhibitors of caspases adhesion molecules molecules of intercellular matrix Accented proliferative phenotype, loss of intercellular contacts, defects of apoptosis
15 D. Identification of temperature-sensitive TP53 variants S127F
16 Mr. Brother and Mrs. Sister Case Pekova et al., Leukemia Research, 2010 FASAY: wild type p53 FASAY: 51.8% t.s. colonies
17 Back-tracking the t.s. variant R283C, cdna sequencing Pekova et al., Leukemia Research, 2010
18 Pekova et al., Leukemia Research, 2010
19 Site-directed mutagenesis/ Megaprimer Eco RI Eco RV C/T T T
20 Pekova et al., Leukemia Research, 2010
21 Pekova et al., Leukemia Research, 2010 Production of H1299 stable cell lines harboring temperature-sensitive TP53 variants
22 Pekova et al., Leukemia Research, 2010 Stable H1299 cell lines expressing temperature-sensitive variants of TP53 Temperature-sensitive TP53 variants V157F, A161T, S215I, V216M, Y234C resemble in vitro R175H Temperature-sensitive TP53 variants N235S, R283C, K320E, K320T resemble in vitro WT TP53
23 List of all TP53 mutations/variants identified in the study Table 1: List of all TP53 mutations/variants identified in the study. Temperature-sensitive variants are highlighted in blue. Mutation Nr. Mutation Nr. Mutation Nr. Mutation Nr. Mutation Nr. Mutation Nr. TP53 splicing variant Delta E68X 3 K164E 1 H214R 1 P250L 1 D281V 2 Ex6 16 W91X 1 Q167X 1 S215I 1 P250S 1 R282W 1 c.780_781insagt 1 K101E 1 V172A 1 V216M 1 I251V 1 R283C 7 c.559_560insg 1 P109I 1 V173A 2 R219I 1 I255T 2 T284S 1 c.782_783instat 1 R110L 2 R175H 2 Y220C 4 T256P 1 E286G 1 c.102_103insc 1 F113S 2 C176R 2 Y220H 1 E258G 1 K305M 1 Y126C 2 C176W 1 P222L 1 E258K 1 K320E 1 Y126H 1 P177L 1 S227P 1 D259G 2 K320T 1 K132N 2 H178R 1 H233R 4 D259S 1 L330P 1 Q136E 1 P178S 1 Y234C 5 G266R 1 c.302_del 1 A138V 1 H179L 1 Y234D 3 R267P 1 c.328_339del 1 K139R 2 H179R 4 Y234H 1 R267W 1 c.503_ 578del 1 C141Y 1 R181S 1 N235S 2 R273C 2 c.504_578del 1 Q144X 2 D186N 1 M237I 2 R273H 4 c.515_559del 1 W146X 1 G187D 1 N239D 1 R273S 1 c. 550_576del 1 P151S 1 L188P 1 S241C 1 C275G 1 c. 636del 1 P152L 1 P190H 1 M243T 1 C275Y 1 c.704_709del 1 P153L 1 P190S 1 G245D 1 A276V 1 c.716_736del 1 R156P 1 H193L 2 G245S 8 C277F 1 c.724_739del 1 V157F 2 H193R 2 N247D 1 C277Y 2 c.749_751del 1 V157G 1 L194P 1 R248Q 1 R280K 1 c.792_794del 1 A159P 2 R196X 1 R248W 8 R280P 1 c.828del 1 A161T 3 Y205C 1 R249S 3 R280T 1 c. 532_ 549del 1 TP53 splicing variant Y163H 2 R213X 1 R249W 1 D281G 1 Beta 30
24 Pekova et al., Leukemia Research, 2010 Summary 1,287 diagnostic CLL samples tested 18,4% of FASAY-corroborated TP53 mutations/variants Modes of TP53 inactivation diverse (point mutations, insertions, deletions, temperature-sensitive variants, aberrant splicing variants) Splicing variants might play biological role Temperature-sensitive TP53 variants V157F, A161T, S215I, V216M, Y234C resemble in vitro R175H Temperature-sensitive TP53 variants N235S, R283C, K320E, K320T resemble in vitro WT TP53
25 Thank you for your attention
Supplementary Figure 1
Count Count Supplementary Figure 1 Coverage per amplicon for error-corrected sequencing experiments. Errorcorrected consensus sequence (ECCS) coverage was calculated for each of the 568 amplicons in the
Supplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E,
Supplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E, TY93/H5N1 GFP-627K, or the TY93/H5N1 PB2(588-759) virus library. To establish our GFP- FACS screening platform, we compared
Virological failure to Protease inhibitors in Monotherapy is linked to the presence of signature mutations in Gag without changes in HIV-1 replication
Virological failure to Protease inhibitors in Monotherapy is linked to the presence of signature mutations in Gag without changes in HIV-1 replication Oscar Blanch-Lombarte Rome, 7-9 June, 2017 European
SUPPLEMENTARY INFORMATION. Rare independent mutations in renal salt handling genes contribute to blood pressure variation
SUPPLEMENTARY INFORMATION Rare independent mutations in renal salt handling genes contribute to blood pressure variation Weizhen Ji, Jia Nee Foo, Brian J. O Roak, Hongyu Zhao, Martin G. Larson, David B.
Deliverable 2.1 List of relevant genetic variants for pre-emptive PGx testing
GA N 668353 H2020 Research and Innovation Deliverable 2.1 List of relevant genetic variants for pre-emptive PGx testing WP N and Title: WP2 - Towards shared European Guidelines for PGx Lead beneficiary:
Susanne Schnittger. Workflow of molecular investigations in JAK2-negative MPNs - the Munich experience
Susanne Schnittger Workflow of molecular investigations in JAK2negative MPNs the Munich experience Cohort single centre experience to apply new markers in a daily diagnostic work flow total: 20,547 cases
Vertical Magnetic Separation of Circulating Tumor Cells and Somatic Genomic-Alteration Analysis in Lung Cancer Patients
Vertical Magnetic Separation of Circulating Cells and Somatic Genomic-Alteration Analysis in Lung Cancer Patients Chang Eun Yoo 1,2#, Jong-Myeon Park 3#, Hui-Sung Moon 1,2, Je-Gun Joung 2, Dae-Soon Son
modified dye uptake assay including formazan test EC 90 not tested plaque reduction assay
Sauerbrei A, Bohn-Wippert K, Kaspar M, Krumbholz A, Karrasch M, Zell R. 2015. Database on natural polymorphisms and resistance-related non-synonymous mutations in thymidine kinase and DNA polymerase genes
To test the possible source of the HBV infection outside the study family, we searched the Genbank
Supplementary Discussion The source of hepatitis B virus infection To test the possible source of the HBV infection outside the study family, we searched the Genbank and HBV Database (http://hbvdb.ibcp.fr),
Fabry Disease X-linked genetic, multi-organ disorder. Fabry disease screening program in Hypertrophic p Cardiomyopathy: preliminary results.
Fabry Disease X-linked genetic, multi-organ disorder Fabry disease screening program in Hypertrophic p Cardiomyopathy: y preliminary results. Globotriaosylceramide, GL3 Brain -galactosidase A Eyes Lactosylceramide
Supplementary Figure 1 Weight and body temperature of ferrets inoculated with
Supplementary Figure 1 Weight and body temperature of ferrets inoculated with A/Anhui/1/2013 (H7N9) influenza virus. (a) Body temperature and (b) weight change of ferrets after intranasal inoculation with
Pharmacogenomics in Rare Diseases: Development Strategy for Ivacaftor as a Therapy for Cystic Fibrosis
Pharmacogenomics in Rare Diseases: Development Strategy for Ivacaftor as a Therapy for Cystic Fibrosis Federico Goodsaid Vice President Strategic Regulatory Intelligence Vertex Pharmaceuticals Is there
SUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL SUPPLEMENTAL MATERIAL Supplemental Methods Phenotype Prediction Analyses In order to assess the phylogenetic properties of nssnvs, sequence conservation analysis was conducted using
Supplemental Table 1. The list of variants with their respective scores for each variant classifier Gene DNA Protein Align-GVGD Polyphen-2 CADD MAPP
Supplemental Table 1. The list of variants with their respective scores for each variant classifier Gene DNA Protein Align-GVGD Polyphen-2 CADD MAPP Frequency Domain Mammals a 3 S/P b Mammals a 3 S/P b
SUPPLEMENTARY INFORMATION
doi:10.1038/nature13898 Supplementary Information Table 1 Kras mutation status of carcinogen-induced mouse lung adenomas Tumour Treatment Strain Grade Genotype Kras status (WES)* Kras status (Sanger) 32T1
Deep-Sequencing of HIV-1
Deep-Sequencing of HIV-1 The quest for true variants Alexander Thielen, Martin Däumer 09.05.2015 Limitations of drug resistance testing by standard-sequencing Blood plasma RNA extraction RNA Reverse Transcription/
CPTR title slide. A Standardized System for Grading Mutations in Mycobacterium tuberculosis for Association with Drug Resistance
CPTR title slide A Standardized System for Grading Mutations in Mycobacterium tuberculosis for Association with Drug Resistance PAOLO MIOTTO CPTR 2017 Workshop, March 20 23 The Need A lack of user-friendly
Sample Metrics. Allele Frequency (%) Read Depth Ploidy. Gene CDS Effect Protein Effect. LN Metastasis Tumor Purity Computational Pathology 80% 60%
Supplemental Table 1: Estimated tumor purity, allele frequency, and independent read depth for all gene mutations classified as either potentially pathogenic or VUS in the metatastic and primary tumor
Transgenic Mice and Genetargeting
Transgenic Mice and Genetargeting mice In Biomedical Science Techniques of transgenic and gene-targeting mice are indispensable for analyses of in vivo functions of particular genes and roles of their
Changing demographics of smoking and its effects during therapy
Changing demographics of smoking and its effects during therapy Egbert F. Smit MD PhD. Dept. Pulmonary Diseases, Vrije Universiteit Medical Centre, Amsterdam, The Netherlands Smoking prevalence adults
HCV NS3 Protease Drug Resistance
test code: cpt code: 10000 87902 category: Infectious Disease HCV genotype 1a CODON Glecaprevir 1a Grazoprevir 1a Paritaprevir 1a Simeprevir 1a Voxilaprevir 1a V36A S 13 R 10 Comment V36C V36G V36I V36L
Kalydeco. Kalydeco (ivacaftor) Description
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.45.03 Subject: Kalydeco Page: 1 of 6 Last Review Date: November 30, 2018 Kalydeco Description Kalydeco
THE UMD TP53 MUTATION DATABASE UPDATES AND BENEFITS. Pr. Thierry Soussi
THE UMD TP53 MUTATION DATABASE UPDATES AND BENEFITS Pr. Thierry Soussi thierry.soussi@ki.se thierry.soussi@upmc.fr TP53: 33 YEARS AND COUNTING STRUCTURE FUNCTION RELATIONSHIP OF WILD AND MUTANT TP53 1984
HCV NS3 Protease Drug Resistance
test code: cpt code: 10000 87902 category: Infectious Disease HCV genotypes 1a CODON Simeprevir 1a Boceprevir 1a Telaprevir 1a Paritaprevir 1a Grazoprevir 1a V36A Comment R 3 R 10, 11 R 16 S 24 V36C V36G
w ª wy xvwz A ª vw xvw P ª w} xvw w Æ w Æ V w,x Æ w Æ w Æ y,z Æ { Æ y,z, w w w~ w wy}æ zy Æ wyw{ xæ wz w xywæ xx Æ wv Æ } w x w x w Æ w Æ wy} zy Æ wz
w ª wy xvwz A ª vw xvw P ª w} xvw w Æ w Æ V w,x Æ w Æ w Æ y,z Æ { Æ y,z, w w w~ w wy}æ zy Æ wyw{ xæ wz w xywæ xx Æ wv Æ } w x w x w Æ w Æ wy} zy Æ wz {w Æ Æ wyw{ x w Germ-line mutations in BRCA1 are associated
Supplementary Figure 1. Cytoscape bioinformatics toolset was used to create the network of protein-protein interactions between the product of each
Supplementary Figure 1. Cytoscape bioinformatics toolset was used to create the network of protein-protein interactions between the product of each mutated gene and the panel of 125 cancer-driving genes
CYP21A2 Mutations Found in Congenital Adrenal Hyperplasia Patients in the California Population
CYP21A2 Mutations Found in Congenital Adrenal Hyperplasia Patients in the California Population Christopher N. Greene, Ph.D. Newborn Screening and Molecular Biology Branch National Center for Environmental
Importance of minor TP53 mutated clones in the clinic
Importance of minor TP53 mutated clones in the clinic Davide Rossi, M.D., Ph.D. Hematology IOSI - Oncology Institute of Southern Switzerland IOR - Institute of Oncology Reserach Bellinzona - Switzerland
J. A. Mayfield et al. FIGURE S1. Methionine Salvage. Methylthioadenosine. Methionine. AdoMet. Folate Biosynthesis. Methylation SAH.
FIGURE S1 Methionine Salvage Methionine Methylthioadenosine AdoMet Folate Biosynthesis Methylation SAH Homocysteine Homocystine CBS Cystathionine Cysteine Glutathione Figure S1 Biochemical pathway of relevant
CHAPTER 8 ONCOGENIC MARKER DETECTION FROM P53 MUTANT AMINO-ACID SUBSTITUTIONS
134 CHAPTER 8 ONCOGENIC MARKER DETECTION FROM P53 MUTANT AMINO-ACID SUBSTITUTIONS The recent past has witnessed a rapid rise in the utilization of computational techniques to aid and accelerate biological
Medical Policy An independent licensee of the Blue Cross Blue Shield Association
Cystic Fibrosis Transmembrane Page 1 of 11 Medical Policy An independent licensee of the Blue Cross Blue Shield Association Title: Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Prime Therapeutics
CANCER. Inherited Cancer Syndromes. Affects 25% of US population. Kills 19% of US population (2nd largest killer after heart disease)
CANCER Affects 25% of US population Kills 19% of US population (2nd largest killer after heart disease) NOT one disease but 200-300 different defects Etiologic Factors In Cancer: Relative contributions
Clinical Spectrum and Genetic Mechanism of GLUT1-DS. Yasushi ITO (Tokyo Women s Medical University, Japan)
Clinical Spectrum and Genetic Mechanism of GLUT1-DS Yasushi ITO (Tokyo Women s Medical University, Japan) Glucose transporter type 1 (GLUT1) deficiency syndrome Mutation in the SLC2A1 / GLUT1 gene Deficiency
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
Supplementary Table e1. Clinical and genetic data on the 37 participants from the WUSM
Supplementary Data Supplementary Table e1. Clinical and genetic data on the 37 participants from the WUSM cohort. Supplementary Table e2. Specificity, sensitivity and unadjusted ORs for glioma in participants
ggcatgcattattcgacgtcgtatcgatgcaaagtggctaggacgtcgatgctagtcgatcga tgactcgatcgatcgatcgagtcgtactgggaacgtctccgccgctctacgtcagcgtctggt
ggcgcgtcgagatgatcacgacggcatgctagctagccatacgcgtcaatcgtagctagct actctagtacgatgctagctacgtacgtcatgatcgatcgatcgtagctagctagctagctaga gggcgctgctcttcgttgtgcacacttacgtagcatgctagctagctagctgtcagtcagtacga tac Cell
Intron 1 IVS1+5G>T --- Greenberg et al, Exon II del2 Tsai et al, 2017 K42R 125A>G Spector et al, unpublished
Exon I M1V 1A>G Kolker et al, 2007 --- 11delG Spector & Sharer, unpublished S25L 74C>T Spector et al, unpublished --- 89/90 delc Mushimoto et al, 2011 88-91del4+IVS1 gtca Spector et al, unpublished Intron
Medical Policy An independent licensee of the Blue Cross Blue Shield Association
Cystic Fibrosis Transmembrane Page 1 of 13 Medical Policy An independent licensee of the Blue Cross Blue Shield Association Title: Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Prime Therapeutics
Personalized Healthcare Update
Dr. Kai - Oliver Wesche Market Development Manager, Personalized Healthcare QIAGEN Personalized Healthcare Update Pioneering Personalized Medicine through Partnering TOMTOVOK BKM120 Zelboraf QIAGEN partners:
Clinical Utility of Droplet ddpcr, moving to diagnostics. Koen De Gelas, PhD, CRIG ddpcr mini symposium, 15/05/2018
1 Clinical Utility of Droplet ddpcr, moving to diagnostics 2 Koen De Gelas, PhD, CRIG ddpcr mini symposium, 15/05/2018 Disclaimer Disclaimer: all consumables, instruments, applications and software covered
Development of a Multiplex CYP21A2 Genotyping Assay for Congenital Adrenal Hyperplasia Screening
Development of a Multiplex CYP21A2 Genotyping Assay for Congenital Adrenal Hyperplasia Screening Christopher N. Greene, Ph.D. Newborn Screening and Molecular Biology Branch National Center for Environmental
Symdeko. Symdeko (tezacaftor and ivacaftor) Description
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.45.10 Subject: Symdeko Page: 1 of 5 Last Review Date: June 22, 2018 Symdeko Description Symdeko (tezacaftor
The absence of the ERBB4 hotspot mutations in melanomas in patients from southern China
Brief Report The absence of the ERBB4 hotspot mutations in melanomas in patients from southern China Qi-Ming Zhou 1,2,5*, Wei Li 6*, Yuan-Xiang Guan 1,3, Xing Zhang 1,2, Xin-Chun Chen 6, Ya Ding 1,2, Xi-Zhi
CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing.
Supplementary Figure 1 CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Whole-exome sequencing of six plasmacytoid-variant bladder
Frequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R
Frequency(%) 1 a b ALK FS-indel ALK R1Q HRAS Q61R HRAS G13R IDH R17K IDH R14Q MET exon14 SS-indel KIT D8Y KIT L76P KIT exon11 NFS-indel SMAD4 R361 IDH1 R13 CTNNB1 S37 CTNNB1 S4 AKT1 E17K ERBB D769H ERBB
Genetic Analysis of Allosteric Signaling in RhaR from Escherichia coli and Characterization of the VirF Protein from Shigella flexneri
Genetic Analysis of Allosteric Signaling in RhaR from Escherichia coli and Characterization of the VirF Protein from Shigella flexneri By Bria Collette Kettle Submitted to the graduate degree program in
Support. Overview. Auditory Dys-synchrony. Auditory Brainstem Response. Potential Causes
Potential Role of Genetic Testing in Auditory Neuropathy/Dys-synchrony Christina Runge-Samuelson, Ph.D., CCC-A Associate Professor Co-Director, Koss Cochlear Implant Program Department of tolaryngology
Exon I M1V 1A>G Kolker et al, delG Spector & Sharer, unpublished /90 delc Mushimoto et al, 2011
Exon I M1V 1A>G Kolker et al, 2007 --- 11delG Spector & Sharer, unpublished 2006 --- 89/90 delc Mushimoto et al, 2011 Intron 1 IVS1+5G>T --- Greenberg et al, 1995 Exon II --- 109-110delCA Tsai et al, 2017
Supplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
Clinical and Molecular Genetic Spectrum of Slovenian Patients with CGD
Clinical and Molecular Genetic Spectrum of Slovenian Patients with CGD Avčin T, Debeljak M, Markelj G, Anderluh G*, Glavnik V, Kuhar M University Children s Hospital Ljubljana and *Biotechnical Faculty,
LE IPERCHILOMICRONEMIE FAMILIARI
LE IPERCHILOMICRONEMIE FAMILIARI Livia Pisciotta Di.M.I.-Università di Genova HYPERCHYLOMICRONEMIA SYNDROME Ø Hypertriglyceridemia (>10 mmol/l, >877 mg/dl) Ø Fasting chylomicronemia Ø Recurrent abdominal
History (August 2010) Therapy for Experienced Patients. History (September 2010) History (November 2010) 12/2/11
(August 2010) Therapy for Experienced Patients Hiroyu Hatano, MD, MHS Assistant Professor of Medicine University of California San Francisco Medical Management of AIDS December 2011 42M HIV (CD4=450, VL=6250,
MSI positive MSI negative
Pritchard et al. 2014 Supplementary Figure 1 MSI positive MSI negative Hypermutated Median: 673 Average: 659.2 Non-Hypermutated Median: 37.5 Average: 43.6 Supplementary Figure 1: Somatic Mutation Burden
LAL: significato clinico e biologico delle mutazioni di Bcr-Abl
LAL: significato clinico e biologico delle mutazioni di Bcr-Abl Simona Soverini Dipartimento di Ematologia e Scienze Oncologiche L. e A. Seràgnoli Università di Bologna The vast majority of Ph+ ALL patients
Received 21 November 2005/Returned for modification 20 January 2006/Accepted 27 March 2006
JOURNAL OF CLINICAL MICROBIOLOGY, June 2006, p. 1930 1943 Vol. 44, No. 6 0095-1137/06/$08.00 0 doi:10.1128/jcm.02415-05 Copyright 2006, American Society for Microbiology. All Rights Reserved. Evaluation
Supporting Information
Supporting Information Rampal et al. 10.1073/pnas.1407792111 Fig. S1. Genetic events in leukemic transformation of chronic-phase MPNs. (A) Survival of post-mpn AML patients according to mutational status
TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer
AD Award Number: W81XWH-04-1-0325 TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer PRINCIPAL INVESTIGATOR: Valerie Boka CONTRACTING ORGANIZATION: University of Texas Health Science
ERCC2mutations as predictors of response to cisplatinin bladder cancer
ERCC2mutations as predictors of response to cisplatinin bladder cancer Eliezer (Eli) Van Allen, MD Instructor, Harvard Medical School Dana-Farber Cancer Institute Broad Institute of MIT and Harvard August
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/7/283/283ra54/dc1 Supplementary Materials for Clonal status of actionable driver events and the timing of mutational processes in cancer evolution
Supplementary Online Content
Supplementary Online Content Ku CA, Hull S, Arno G, et al. Detailed clinical phenotype and molecular genetic findings in CLN3-associated isolated retinal degeneration. JAMA Ophthalmol. Published online
Molecular biology :- Cancer genetics lecture 11
Molecular biology :- Cancer genetics lecture 11 -We have talked about 2 group of genes that is involved in cellular transformation : proto-oncogenes and tumour suppressor genes, and it isn t enough to
Relative activity (%) SC35M
a 125 Bat (H17N) b 125 A/WSN (H1N1) Relative activity (%) 0 75 50 25 Relative activity (%) 0 75 50 25 0 Pos. Neg. PA PB1 Pos. Neg. NP PA PB1 PB2 0 Pos. Neg. NP PA PB1 PB2 SC35M Bat Supplementary Figure
A Quick Guide to the. I507del. Mutation CFTR SCIENCE
A Quick Guide to the I507del Mutation CFTR SCIENCE 2016 Vertex Pharmaceuticals Incorporated VXR-HQ-02-00045a(1) 03/2016 Loss of CFTR activity is the underlying cause of cystic fibrosis (CF) 1 Spectrum
ULTRA-DEEP SEQUENCING OF THE BCR-ABL KINASE DOMAIN FOR BETTER THERAPEUTIC TAILORING OF PHILADELPHIA CHROMOSOME-POSITIVE LEUKEMIA PATIENTS
ULTRA-DEEP SEQUENCING OF THE BCR-ABL KINASE DOMAIN FOR BETTER THERAPEUTIC TAILORING OF PHILADELPHIA CHROMOSOME-POSITIVE LEUKEMIA PATIENTS Simona Soverini, PhD Department of Experimental, Diagnostic and
Von Willebrand Disease. Alison Street Malaysia April 2010
Von Willebrand Disease Alison Street Malaysia April 2010 Physiology of VWF OUTLINE Clinical presentation of VWD Classification of VWD with emphases on Type 1, 2B and 2N disease Testing for VWD Treatment
Mutations and Disease Mutations in the Myosin Gene
Biological Sciences Initiative HHMI Mutations and Disease Mutations in the Myosin Gene Goals Explore how mutations can lead to disease using the myosin gene as a model system. Explore how changes in the
The molecular genetics of endometrial cancer
The molecular genetics of endometrial cancer Lora Hedrick Ellenson, M.D. Department of Pathology and Laboratory Medicine Weill Medical College of Cornell University Introduction Classification of endometrial
The Complexity of Simple Genetics
The Complexity of Simple Genetics? The ciliopathies: a journey into variable penetrance and expressivity Bardet-Biedl Syndrome Allelism at a single locus is insufficient to explain phenotypic variability
Quantification of early stage lesions for loss of p53 should be shown in the main figures.
Reviewer #1 (Remarks to the Author): Expert in prostate cancer The manuscript "Clonal dynamics following p53 loss of heterozygosity in Kras-driven cancers" uses a number of novel genetically engineered
Molecular Testing in Lung Cancer
Molecular Testing in Lung Cancer Pimpin Incharoen, M.D. Assistant Professor, Thoracic Pathology Department of Pathology, Ramathibodi Hospital Genetic alterations in lung cancer Source: Khono et al, Trans
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
Hands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
IVACAFTOR THE ISRAELI EXPERIENCE ADI DAGAN MD THE ISRAELI CF CENTER SHEBA MEDICAL CENTER, TEL-HASHOMER
IVACAFTOR THE ISRAELI EXPERIENCE ADI DAGAN MD THE ISRAELI CF CENTER SHEBA MEDICAL CENTER, TEL-HASHOMER February 21, 2014 U.S. Food and Drug Administration Approves KALYDECO (ivacaftor) for Use in Eight
LIPOPROTEINE ATEROGENE E ANTI-ATEROGENE ATEROGENE
LIPOPROTEINE ATEROGENE E ANTI-ATEROGENE ATEROGENE Sebastiano Calandra Dipartimento di Scienze Biomediche Università di Modena e Reggio Emilia Incidence Rate/1000 200-150 - 100-50 - Women 0 Men
Clinical Genetics. Functional validation in a diagnostic context. Robert Hofstra. Leading the way in genetic issues
Clinical Genetics Leading the way in genetic issues Functional validation in a diagnostic context Robert Hofstra Clinical Genetics Leading the way in genetic issues Future application of exome sequencing
HIV Drug Resistance among Adolescents and Young Adults Failing HIV Therapy in Zimbabwe
HIV Drug Resistance among Adolescents and Young Adults Failing HIV Therapy in Zimbabwe V Kouamou 1, J Manasa 1, D Katzenstein 1, A McGregor 1, CE Ndhlovu 1 & AT Makadzange 1. 1 University of Zimbabwe Introduction
Pharmacy Policy Bulletin
Pharmacy Policy Bulletin Title: Policy #: Cystic Fibrosis Agents (Kalydeco, Orkambi ) Rx.01.117 Application of pharmacy policy is determined by benefits and contracts. Benefits may vary based on product
Monitoring for Drug Resistance by Genotyping. Urvi M Parikh, PhD MTN Virology Core Lab
Monitoring for Drug Resistance by Genotyping Urvi M Parikh, PhD MTN Virology Core Lab Outline What is Drug Resistance? Genotyping Algorithm Standard vs Sensitive Resistance Testing Sequencing Protocols
New: P077 BRCA2. This new probemix can be used to confirm results obtained with P045 BRCA2 probemix.
SALSA MLPA KIT P045-B2 BRCA2/CHEK2 Lot 0410, 0609. As compared to version B1, four reference probes have been replaced and extra control fragments at 100 and 105 nt (X/Y specific) have been included. New:
Cooperation of germ line JAK2 mutations E846D and R1063H leads to erythroid hyperplasia with megakaryocytic atypia
Cooperation of germ line JAK2 mutations E846D and R1063H leads to erythroid hyperplasia with megakaryocytic atypia Katarina Kapralova, Ph.D. Department of Biology Faculty of Medicine and Dentistry Palacký
C) The graph should look exactly like the graph on the left (Mut1 cells + Mating Pheromone for 3 hours at 25 degrees). The cells arrest in G1.
706-2000-Exam 4 Answer Key 1) The question asks you to explain peaks A and B in the top graph. The other two graphs were there to give you hints. The question did not ask for these other two graphs to
A Genetic Approach to the Treatment of Cystic Fibrosis
A Genetic Approach to the Treatment of Cystic Fibrosis Peter Mueller, PhD Chief Scientific Officer and Executive Vice President Global Research and Development Vertex Pharmaceuticals, Incorporated March
Clinical utility of NGS for the detection of HIV and HCV resistance
18 th Annual Resistance and Antiviral Therapy Meeting v Professor Janke Schinkel Academic Medical Centre, Amsterdam, The Netherlands Thursday 18 September 2014, Royal College of Physicians, London Clinical
Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015
Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a
Alabama University at Birmingham Birmingham, AL Approved for Public Release; Distribution Unlimited
AD Award Number: W81XWH-04-1-0079 TITLE: The Role of Mutant p53 in Progression of Prostate Cancer PRINCIPAL INVESTIGATOR: Gang Liu, M.D., Ph.D. CONTRACTING ORGANIZATION: Alabama University at Birmingham
Supplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
BIOLOGY - CLUTCH CH.15 - CHROMOSOMAL THEORY OF INHERITANCE
!! www.clutchprep.com Chromosomal theory of inheritance: chromosomes are the carriers of genetic material. Independent Assortment alleles for different characters sort independently of each other during
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.
Supplementary Figure 1 Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. (a) Breeding scheme. R26-LSL-SB11 homozygous mice were bred to Trp53 LSL-R270H/+
p53 and Apoptosis: Master Guardian and Executioner Part 2
p53 and Apoptosis: Master Guardian and Executioner Part 2 p14arf in human cells is a antagonist of Mdm2. The expression of ARF causes a rapid increase in p53 levels, so what would you suggest?.. The enemy
Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
NNRTI Resistance NORTHWEST AIDS EDUCATION AND TRAINING CENTER
NORTHWEST AIDS EDUCATION AND TRAINING CENTER NNRTI Resistance Brian R. Wood, MD Medical Director, NW AETC ECHO Assistant Professor of Medicine, University of Washington Presentation prepared by: Brian
Resistencias & Epidemiología. Eva Poveda Division of Clinical Virology INIBIC-Complexo Hospitalario Universitario de A Coruña
Resistencias & Epidemiología Eva Poveda Division of Clinical Virology INIBIC-Complexo Hospitalario Universitario de A Coruña Rapid Evolution of HCV Regimens: Easier to take/tolerate, Short Duration, Pangenotypic,
PA Update: Oral Cystic Fibrosis Modulators
Copyright 2012 Oregon State University. All Rights Reserved Drug Use Research & Management Program Oregon State University, 500 Summer Street NE, E35 Salem, Oregon 97301-1079 Phone 503-947-5220 Fax 503-947-1119
Medium-Chain Acyl-CoA Dehydrogenase (MCAD) splicing mutations identified in newborns with an abnormal MS/MS profile
EURASNET Workshop on RNA splicing and genetic diagnosis, London, UK Medium-Chain Acyl-CoA Dehydrogenase (MCAD) splicing mutations identified in newborns with an abnormal MS/MS profile Brage Storstein Andresen
p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11
ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N
Supplementary Material Correlation matrices on FP and FN profiles
Supplementary Material Correlation matrices on FP and FN profiles The following two tables give the correlation coefficients for the FP profiles and the FN profiles of a single tagging solutions against
Apoptosis Oncogenes. Srbová Martina
Apoptosis Oncogenes Srbová Martina Cell Cycle Control point Cyclin B Cdk1 Cyclin D Cdk4 Cdk6 Cyclin A Cdk2 Cyclin E Cdk2 Cyclin-dependent kinase (Cdk) have to bind a cyclin to become active Regulation
Introduction to Genetics
Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist