Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
|
|
|
- Scot Hall
- 5 years ago
- Views:
Transcription
1 Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null MEK cells. The isolation (fractionation) of plasma membrane, cytosol and nuclear was described in Methods section. Na/K-ATPase, -tubulin and lamin A/C were used as markers for membrane, cytosol and nuclear, respectively. Supplemental Figure 2. Treatment with ISO-1 delayed cyst growth in Pkd1 flox/flox :Ksp-Cre neonates. (A) Histologic examination of PN7 kidneys from Pkd1 flox/flox :Ksp-Cre neonates treated with vehicle (DMSO) (n = 1) or ISO-1 (n = 6), respectively. Scale bar, 1 mm. (B) Quantification of the percentage of cystic areas over total kidney section areas of PN7 kidney sections from Pkd1 flox/flox :Ksp-Cre neonates treated as in A. Shown is mean ± s.e.m. of all sections quantified for each condition. p <.1. (C and D) KW/BW ratios (C) and BUN levels (D) were decreased in Pkd1 flox/flox :Ksp-Cre PN7 neonates treated with ISO-1 compared to that treated with DMSO (control). p <.1. (E) ISO-1 treatment reduced cyst lining epithelial cell proliferation in Pkd1 flox/flox :Ksp-Cre PN7 kidneys as detected by Ki67 staining. p <.1. Scale bar, 1 µm. (F) ISO-1 treatment induced cyst lining epithelial cell apoptosis in Pkd1 flox/flox :Ksp-Cre PN7 kidneys as detected by TUNEL assay. p <.1. Scale bar, 1 µm. Supplemental Figure 3. Statistical analysis of the body weight of Pkd1 flox/flox :Ksp-Cre mice at postnatal day 7, Pkd1 flox/flox :Pkhd1-Cre mice at postnatal day 25 and Pkd1 nl/nl mice at postnatal day 28 treated with DMSO and ISO-1 respectively. Supplemental Figure 4. Western blot analysis of in two kidneys from Pkd1 flox/flox :Ksp-Cre:, Pkd1 +/+ :Ksp-Cre: and Pkd1 flox/flox :Ksp-Cre: neonates, respectively. 1
2 Supplemental Figure 5. Knockout of or inhibition of with ISO-1 leads to diminished levels of macrophages in pericystic and interstitial regions of Pkd1 conditional knockout mouse kidneys. (A) The accumulation/recruitment of macrophages to pericystic sites and interstitium in kidneys from Pkd1 flox/flox :Ksp-Cre: mice was dramatically reduced at postnatal day 7 compared to that from age matched kidneys of Pkd1 flox/flox :Ksp-Cre: mice. p <.1. Scale bar, 1 µm. (B-D) Treatment with ISO-1 dramatically reduced the accumulation/recruitment of macrophages to pericystic sites and interstitium in kidneys from Pkd1 flox/flox :Ksp-Cre mice at postnatal day 7 (B), Pkd1 flox/flox :Pkhd1-Cre mice at postnatal day 25 (C) and Pkd1 nl/nl mice at postnatal day 28 (D) compared to that from age matched kidneys of Pkd1 flox/flox :Ksp-Cre mice, Pkd1 flox/flox :Pkhd1-Cre mice and Pkd1 nl/nl mice treated with DMSO, respectively. p <.1. Scale bar, 1 µm. Supplemental Figure 6. Treatment with ISO-1 decreased the expression of in Pkd1 mutant kidneys from Pkd1 flox/flox :Ksp-Cre mice and Pkd1 flox/flox :Pkhd1-Cre mice compared to that from age matched control mice treated with DMSO. (A and B) Western blot analysis of the expression of in kidneys from three different Pkd1 flox/flox :Ksp-Cre mice (A) and Pkd1 flox/flox :Pkhd1-Cre mice (B) treated with DMSO or ISO-1, respectively. (C and D) Immunohistochemistry staining of in kidneys from Pkd1 flox/flox :Ksp-Cre mice (C) and Pkd1 flox/flox :Pkhd1-Cre mice (D) treated with DMSO or ISO-1, respectively. Scale bar, 1 µm. Supplemental Figure 7. can be secreted in cell culture media of renal epithelial cells and is highly enriched in cyst fluids and urines derived from two distinct orthologous mouse models of ADPKD. (A) Western blot analysis of the levels of in cell culture media of Pkd1 wild type (WT) and mutant (Null) MEK cells standardized to the same cell numbers of different cell types. p <.1. (B) Western blot analysis of the levels of in cyst fluids from four different Pkd1 flox/flox :Ksp-Cre mice and 2
3 Pkd1 flox/flox :Pkhd1-Cre mice, respectively. (C) Western blot analysis of the levels of in urines from Pkd1 flox/flox :Ksp-Cre mice at PN7 and PN14 as well as from Pkd1 flox/flox :Pkhd1-Cre mice at PN14 and PN25, respectively. Supplemental Figure 8. (A) Western blot analysis of the levels of in cyst fluids from five male and five female ADPKD patients, respectively. Our results indicated that might form a dimer in human cyst fluids. (B) Western blot analysis of the levels of in urines from four male ADPKD patients and four normal males (top panel) as well as from four female patients and four normal females (bottom panel), respectively. Supplemental Figure 9. promotes macrophage migration. Addition of ISO-1 (1 µm) blocked ADPKD CM-induced migration of human THP-1 monocytes. p <.1; ANOVA post hoc test. Supplemental Figure 1. (A) MCP-1 expression was increased in Pkd1 mutant mouse embryonic kidney (MEK) cells and postnatal Pkd1 homozygous PN24 cells compared to Pkd1 wild-type MEK cells and postnatal Pkd1 heterzygous PH2 cells as analyzed with western blot. (B-D) MCP-1 was elevated in kidneys from Pkd1 flox/flox :Ksp-Cre mice (B) and Pkd1 flox/flox :Pkhd1-Cre mice (C) as well as in kidneys from ADPKD patients (D) compared to that in age matched wild type mouse kidneys and normal human kidneys as analyzed with immunohistochemistry staining, respectively. Treatment with ISO-1 decreased the expression of MCP-1 in Pkd1 mutant kidneys from Pkd1 flox/flox :Ksp-Cre mice (B) and Pkd1 flox/flox :Pkhd1-Cre mice (C) compared to that in age matched control kidneys treated with DMSO, respectively. Supplemental Figure 11. Treatment with ISO-1 decreased the levels of MCP-1 mrna (A) and protein (B) in kidneys from Pkd1 flox/flox :Pkhd1-Cre mice compared with DMSO treated control mice as examined by qrt-pcr and western blot, respectively. n = 3, p <.5; ANOVA post hoc test. 3
4 Supplemental Figure 12. promotes the expression of MCP-1 and TNF- whereas TNF- also induces the expression of in renal epithelial cells. (A and B) Western blot analysis of the expression of MCP-1 and TNF- from whole cell lysates of Pkd1 mutant PN24 cells (A) and Pkd1 mutant MEK cells (B) induced with (1 ng/ml) at indicated time points. C. Western blot analysis of the expression of from whole cell lysates of Pkd1 wild type and null MEK cells induced with TNF- (5 ng/ml) at indicated time points. Supplemental Figure 13. (A and B) qrt-pcr analysis of the expression of Hk1 (A) and Ldha (B) mrna in Pkd1 wild type (WT) and mutant (Null) MEK cells untreated or treated with ISO-1 or sirna. The transcription of the key glycolytic enzymes, Hk1 and Ldha (p <.1; ANOVA post hoc test.) was significantly increased in Pkd1 mutant (Null) MEK cells compared to Pkd1 wild type MEK cells. Treatment with ISO-1 or sirna did not affect the transcription of the key glycolytic enzymes, Hk1 and Ldha, in Pkd1 wild type MEK cells. However, treatment with ISO-1 or sirna significantly decreased the transcription of Hk1 and Ldha (p <.1; ANOVA post hoc test.) in Pkd1 mutant (Null) MEK cells compared to untreated Pkd1 mutant (Null) MEK cells, respectively. Supplemental Figure 14. (A) Western blot analysis of the expression of ERK and phospho-erk from whole cell lysates of Pkd1 mutant PN24 cells treated with (1 ng/ml) or ISO-1 (1 M) at indicated time points. (B) Western blot analysis of the levels of phospho-erk in Pkd1 null cells and PN24 cells treated with conditional media collected from Pkd1 null MEK cells transfected with control sirna or sirna for 72 hours. The phosphorylation of ERK could be induced in Pkd1 null cells and PN24 cells treated with conditional media collected from cystic renal epithelial cells transfected with control sirna at indicated time points but could not be induced in these cells treated with conditional media collected from knockdown cystic renal epithelial cells. 4
5 Supplemental Figure 15. Western blot analysis of the expression of from whole cell lysates of Pkd1 mutant (Null) MEK cells treated with Hsp9 inhibitors, STA99 (1 nm) or 17-AAG (1 µm), at indicated time points. Supplemental Figure 16. (A-B) Analysis of the expression of CD74 protein (A) and mrna (B) of Pkd1 wild-type (WT) and Pkd1 null/null (Null) MEK cells as well as postnatal Pkd1 heterozygous PH2 (PH2) cells and Pkd1 homozygous PN24 (PN24) cells by Western blot and qrt-pcr, respectively. (C) CD74 was elevated in kidney sections from normal and ADPKD kidneys as examined by immunohistochemistry staining with anti-cd74 antibody. Scale bar, 1 µm. (D) Western blot analysis of the expression of phospho-erk, total ERK and MCP-1 in PN24 cells that were pretreated with normal IgG or CD74 antibody for 2 hours and then were stimulated with recombinant (1 ng/ml) at indicated time points. Treatment with CD74 antibody blocked induced the phosphorylation of ERK but did not affect induced MCP-1 expression. 5
6 Supplemental Figure 1 Na/K-ATPase (membrane marker) a-tubulin (cytosol marker) Lamin A/C (nuclear Marker)
7 Cystic index (%) KW/BW ratio (%) Ki67 positive cells TUNEL-positive cells (%) BUN (mg/dl) Supplemental Figure 2 A DMSO ISO-1 B C D mm E 8 p p.1 p.1 5 DMSO ISO-1 DMSO ISO-1 DMSO ISO p.1 5 F DMSO ISO DMSO ISO-1 p DMSO ISO-1 DMSO ISO-1
8 Body weight (g) Body weight (g) Body weight (g) Supplemental Figure 3 A B 1 p =.24 8 p = C p =.64 DMSO ISO-1 Pkd1 flox/flox :Ksp-cre DMSO ISO-1 Pkd1 flox/flox :Pkhd1-cre DMSO ISO-1 Pkd1 nl/nl
9 Supplemental Figure
10 F4/8 positive cells per high power field F4/8 positive cells per high power field Supplemental Figure 5 A p <.1 5 B Pkd1 flox/flox :Ksp-Cre: +/+ Pkd1 flox/flox :Ksp-Cre: -/- +/+ -/ p.1 5 Pkd1 flox/flox :Ksp-cre + DMSO Pkd1 flox/flox :Ksp-cre + ISO-1 DMSO ISO-1
11 F4/8 positive cells per high power field F4/8 positive cells per high power field Supplemental Figure 5 C p.1 5 DMSO ISO-1 Pkd1 flox/flox :Pkhd1-cre + DMSO Pkd1 flox/flox :Pkhd1-cre + ISO-1 D p <.1 5 DMSO ISO-1 Pkd1 nl/nl + DMSO Pkd1 nl/nl + ISO-1
12 Supplemental Figure 6 A Pkd1 flox/flox :Ksp-cre, PN7 B Pkd1 flox/flox :Pkhd1-cre, PN25 ISO ISO C Pkd1 +/+ :Ksp-Cre Pkd1 flox/flox :Ksp-Cre + DMSO Pkd1 flox/flox :Ksp-Cre + ISO-1 D Pkd1 +/+ :Pkhd1-Cre Pkd1 flox/flox :Pkhd1-Cre + DMSO Pkd1 flox/flox :Pkhd1-Cre + ISO-1
13 Relative level in medium Supplemental Figure 7 A 4 p.1 WT null WT null B Pkd1 flox/flox :Ksp-Cre Pkd1 flox/flox :Pkhd1-Cre C PN7 PN14 WT Pkd1 flox/flox :Ksp-Cre WT Pkd1 flox/flox :Ksp-Cre PN14 PN25 WT Pkd1 flox/flox :Pkhd1-Cre WT Pkd1 flox/flox :Pkhd1-Cre
14 A Cyst fluids of ADPKD males Cyst fluids of ADPKD females Supplemental Figure KD 12.5 KD B Urines of ADPKD patients Urines of normal humans 25 KD KD (male) GFR BUN Age KD 12.5 KD (female) GFR BUN Age >
15 Fluorescence units Supplemental Figure 9 p <.1 ISO-1 in insert
16 Supplemental Figure 1 A WT Null MCP-1 D PH2 PN24 MCP-1 Normal kidney ADPKD kidney B Pkd1 +/+ :Ksp-Cre Pkd1 flox/flox :Ksp-Cre + DMSO Pkd1 flox/flox :Ksp-Cre + ISO-1 C Pkd1 +/+ :Pkhd1-Cre Pkd1 flox/flox :Pkhd1-Cre + DMSO Pkd1 flox/flox :Pkhd1-Cre + ISO-1
17 MCP-1 mrna Supplemental Figure 11 A p<.1 p<.5 B Pkd1-WT ISO Pkd1 flox/flox :Pkhd1-cre, PN MCP-1 WT DMSO ISO-1 Pkd1 flox/flox :Pkhd1-cre
18 Supplemental Figure 12 A Null 1 3 2h MCP-1 TNF-a B PN h MCP-1 TNF-a C TNFa WT h 6h 12h 24h Null
19 Hk1 mrna Ldha mrna Supplemental Figure 13 A 2.5 p<.1 p<.1 B 2.5 p<.1 p<
20 Supplemental Figure 14 A ISO h 3 2h 4h 12h 24h p-erk Total ERK B si-control conditional media si- conditional media 1 3 2h 1 3 2h p-erk Null-MEK Total ERK 1 3 2h 1 3 2h PN24 p-erk Total ERK
21 Supplemental Figure 15 STA-99 h 1h 2h 4h 17-AAG h 1h 2h 4h
22 CD74 mrna Supplemental Figure 16 A WT Null PH2 PN24 C CD74 Normal kidney ADPKD kidney B p< p<.1 D Normal IgG CD74 Ab 1 3 2h 1 3 2h p-erk Total ERK WT Null PH2 PN24 MCP-1
Macrophage migration inhibitory factor promotes cyst growth in polycystic kidney disease
Macrophage migration inhibitory factor promotes cyst growth in polycystic kidney disease Li Chen,, Jared J. Grantham, Xiaogang Li J Clin Invest. 2015;125(6):2399-2412. https://doi.org/10.1172/jci80467.
Lysine methyltransferase SMYD2 promotes cyst growth in autosomal dominant polycystic kidney disease
Lysine methyltransferase SMYD2 promotes cyst growth in autosomal dominant polycystic kidney disease Linda Xiaoyan Li,, Julien Sage, Xiaogang Li J Clin Invest. 2017;127(7):2751-2764. https://doi.org/10.1172/jci90921.
Lysine methyltransferase SMYD2 promotes cyst growth in autosomal dominant polycystic kidney disease
The Journal of Clinical Investigation RESEARCH ARTICLE Lysine methyltransferase SMYD2 promotes cyst growth in autosomal dominant polycystic kidney disease Linda Xiaoyan Li, 1,2 Lucy X. Fan, 1,2 Julie Xia
Sirtuin 1 inhibition delays cyst formation in autosomal-dominant polycystic kidney disease
Sirtuin 1 inhibition delays cyst formation in autosomal-dominant polycystic kidney disease Xia Zhou,, Ellis D. Avner, Xiaogang Li J Clin Invest. 2013;123(7):3084-3098. https://doi.org/10.1172/jci64401.
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.
Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times. Western blots shown are representative results from 3 independent
Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC
A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
Supplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Supplementary Figure 1
Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
Quantitative PPARγ expression affects the balance between tolerance and immunity
Quantitative PPARγ expression affects the balance between tolerance and immunity Ya-Hui Liu 1, Yau-Sheng Tsai 1,2,3, Shih-Chieh Lin 4, Nan-Shih Liao 5, Ming-Shiou Jan 6, Chung-Tiang Liang 7, Shih-Wen Hsu
Figure S1A. Blood glucose levels in mice after glucose injection
## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose
Supplementary Figure 1
Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.
a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
Supplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya
Figure S1 Genetic or pharmacologic COX-2 inhibition led to increased kidney
SUPPLEMENTAL FIGURE LEGENDS Figure S1 Genetic or pharmacologic COX-2 inhibition led to increased kidney macrophage infiltration. Wild type or COX-2 -/- mice (2 months old, C57/Bl6 background) were treated
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%
FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence
Atg5 flox/flox ; CAG-Cre, 19M brain heart lung. spleen stomach colon. Takamura_Fig. S1
Takamura_Fig. S1 brain heart lung spleen stomach colon kidney SM Supplemental Figure 1 Histological findings of tg5 flox/flox ;CG-Cre mouse tissues. H&E staining of the brain, heart, lung, spleen, stomach,
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the cardiac glycoside target, ATP1A1. (a) The percentage
Supplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
Supplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Supplementary Information
Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1
Plasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
Figures S1-S5, Figure Legends, Table S1 List of primers used in the study
Insulin receptor alternative splicing is regulated by insulin signaling and modulates beta cell survival Pushkar Malakar,4, Lital Chartarifsky,4, Ayat Hija, Gil Leibowitz 3, Benjamin Glaser 3, Yuval Dor,
Supplementary Information
Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6
SUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing
Supplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses using an anti-cre antibody; testes at 1 week (left panel),
Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation
Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,
Supplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
Supplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
Supplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
SUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure S1: Tumor grades in Ras G12D ; p53 / lung tumors. Representative histology (H&E) of K-Ras G12D ; p53 / lung tumors 13 weeks after tumor initiation. Grade
p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.
Supplemental Materials: I. Supplemental Methods II. Supplemental Figure Legends III. Supplemental Figures Supplemental Methods Cell Culture and Transfections for Wild Type and JNK1-/-,JNK2-/- MEFs: The
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage
SUPPLEMENTARY INFORMATION
DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure
(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production
Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim
a Supplementary Figure 1 Celastrol Withaferin A Individual drugs
Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment
SUPPLEMENTARY INFORMATION
Supplementary Table 1. Cell sphingolipids and S1P bound to endogenous TRAF2. Sphingolipid Cell pmol/mg TRAF2 immunoprecipitate pmol/mg Sphingomyelin 4200 ± 250 Not detected Monohexosylceramide 311 ± 18
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao
Supplementary Information File
Supplementary Information File Supplementary Table 1. List of synthesized sirna sequences for target genes sirna Species Sequence Ctrl sirna mouse sense 5 -UUCUCCGAACGUGUCACGUTT-3 Antisense 5 -ACGUGACACGUUCGGAGAATT-3
Supplementary Figure 1
Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of
Phosphoinositides Regulate Ciliary Protein Trafficking to Modulate Hedgehog Signaling
Developmental Cell Supplemental Information Phosphoinositides Regulate Ciliary Protein Trafficking to Modulate Hedgehog Signaling Francesc R. Garcia-Gonzalo, Siew Cheng Phua, Elle C. Roberson, Galo Garcia
Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells
Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Immunofluorescence staining of H3K9me3 and 53BP1 in PH and HGADFN003 (HG003) cells at 24 h after γ-irradiation. Scale bar,
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)
Boucher et al NCOMMS B
1 Supplementary Figure 1 (linked to Figure 1). mvegfr1 constitutively internalizes in endothelial cells. (a) Immunoblot of mflt1 from undifferentiated mouse embryonic stem (ES) cells with indicated genotypes;
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western
nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering
nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering Toru Komatsu, Igor Kukelyansky, J Michael McCaffery, Tasuku Ueno, Lidenys C Varela & Takanari Inoue Supplementary
Loss of RhoA promotes skin tumor formation. Supplementary Figure 1. Loss of RhoA does not impair F-actin organization.
Supplementary Figure Legends Supplementary Figure 1. Loss of RhoA does not impair F-actin organization. a. Representative IF images of F-actin staining of big and small control (left) and RhoA ko tumors
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Supplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement
Supplementary Information Title: TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Authors: Allison R. Bialas and Beth Stevens Supplemental Figure 1. In vitro characterization
Supplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human
Supplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
Supplementary Materials and Methods
Supplementary Materials and Methods Hepatocyte toxicity assay. Freshly isolated hepatocytes were incubated for overnight with varying concentrations (-25 µm) of sodium glycochenodeoxycholate (GCDC) or
Zhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information)
BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information) David Dankort, David P. Curley, Robert A. Cartlidge, Betsy Nelson, Anthony N. Karnezis,
Adiponectin/T-cadherin system enhances exosome biogenesis and decreases cellular
Supplemental Data Adiponectin/herin system enhances exosome biogenesis and decreases cellular ceramides by exosomal release 5 Yoshinari Obata, Shunbun Kita, *,, Yoshihisa Koyama, Shiro Fukuda, Hiroaki