Supplemental Information. Dual Function of p38α MAPK in Colon Cancer: Suppression of Colitis-Associated Tumor Initiation
|
|
- Thomasine Moody
- 6 years ago
- Views:
Transcription
1 Cancer Cell, Volume 25 Supplemental Information Dual Function of p38α MAPK in Colon Cancer: Suppression of Colitis-Associated Tumor Initiation but Requirement for Cancer Cell Survival Jalaj Gupta, Ivan del Barco Barrantes, Ana Igea, Stratigoula Sakellariou, Ioannis S. Pateras, Vassilis G. Gorgoulis, and Angel R. Nebreda
2 1 Supplemental Data Figure S1 (Related to Figure 1). Downregulation of p38α in IEC increases AOM/DSSinduced colon tumorigenesis
3 2 (A) Colon tumors were induced by the AOM/DSS protocol. Average tumor numbers were determined from two independent experiments. Statistical analysis was performed by Student s T-test or Mann Whitney test using GraphPad Prism 4 software. p values < 0.05 were considered statistically significant. Data represent means ± SEM. (B) Colon sections were stained for BrdU or cleaved caspase 3 to determine cell proliferation and apoptosis, respectively. Bars = 50 µm. (C) Analysis by qrt-pcr of mrna expression levels for the indicated pro-inflammatory mediators in mouse colons at the end of the AOM/DSS protocol. Data are means ± SEM (n = 4). (D) IL-6 protein levels in blood serum from mice after the AOM/DSS protocol. Data are means ± SEM (n = 4). (E) Colon tumor lysates were analyzed for p38α expression by western blotting (one mouse per lane).
4 3 Figure S2 (Related to Figure 2). Downregulation of p38α in IEC does not affect AOMinduced early DNA damage but increases inflammatory cell infiltration upon DSS treatment
5 4 (A) Mice were injected with AOM or PBS and killed 7 hr later. Colon lysates were analyzed by western blotting (one mouse per lane) using the indicated antibodies. (B) Mice were treated as in (A) and colon sections were stained for cleaved caspase 3 to detect apoptosis. Histograms represent the quantification of the average number of apoptotic cells (Cleaved caspase 3 + ) at the base of crypts in AOM-treated mice. Data are means ± SEM (n = 3). (C) CD45 + leukocytes, CD19 + B-cells and Gr1 + neutrophils in colon lamina propria and intraepithelial compartment of mice treated with 2% DSS for 5 days and analyzed at day 6. Histograms show numbers of the indicated cells per 10 3 total cells. Data represent means ± SEM. (D) Colon sections from mice either untreated or treated with DSS for 5 days were stained for F4/80 to identify macrophages. (E) Expression of inflammatory mediators in EpCAM + epithelial cells and CD45 + leukocytes from DSS-treated mice. Relative mrna expression for the indicated genes was determined by qrt-pcr. Data represent means ± SEM (n = 3). Bars = 50 µm.
6 5 Figure S3 (Related to Figure 4). Analysis of mutations in the tumors induced by treatment only with DSS in p38α- IEC mice (A) Mutations within exon 3 of the β-catenin gene, that encodes for GSK3β phosphorylation sites, was analyzed by direct sequencing on genomic DNA isolated by laser capture microdissected tumors or normal mucosa. (B) Nuclear β-catenin staining in tumors developed in p38α- IEC mice by repetitive treatment with DSS in the absence of the AOM carcinogen. Bar = 50 µm.
7 6 Figure S4 (Related to Figure 5). Downregulation of p38α in IEC affects intestinal homeostasis and tight junctions but does not affect IL-23 and IL-17 expression
8 7 (A) Colon sections from untreated mice were stained with H&E, Ki67 antibody for proliferation, Periodic acid-schiff (PAS) reagent for goblet cells and Chromogranin A (ChgA) antibody for enteroendocrine cells. Bars = 50 µm. (B) Relative mrna expression levels for the indicated genes in the distal colon of untreated mice were determined by qrt-pcr. Data are means ± SEM (n = 4)., p<0.05. (C) Electron microscope images showing colon epithelia sections where the tight-junctions depicted in Figure 5C were taken from. Bars = 200 nm. (D) Relative mrna expression levels of the indicated genes in mouse colons were determined by qrt-pcr. Data are means ± SEM (n = 4)., p<0.05. (E) Relative mrna expression levels of IL-23 and IL-17 in the colon from untreated mice or in AOM/DSS-induced colon tumors were determined by qrt-pcr. Data are means ± SEM (n = 4).
9 8 Figure S5 (Related to Figure 6). Inducible downregulation of p38α in IEC before and after AOM/DSS treatment
10 9 (A) Colon, liver, lung and spleen lysates were analyzed by western blotting (one mouse per lane) with the indicated antibodies. (B) Schematic representation of the AOM/DSS protocol used to induce colorectal tumors in p38α- IEC-ERT2 mice. (C) Average tumor number, size and load at the end of the AOM/DSS protocol. Data represent means ± SEM (n = 7). (D) Body weight loss induced by 2% DSS administered in the drinking water. Data represent means ± SEM (n 7)., p<0.05. (E) Colon tumors were induced by the AOM/DSS protocol and then 4-OHT was injected (day 66 to 70). Average tumor number and size were determined at 3 days after the last 4-OHT injection. Data represent means ± SEM (n 4). Tumor lysates were analyzed at the indicated time points by western blotting (one mouse per lane). The histograms show densitometric quantification of p38α protein expression normalized to actin. Data represent means ± SEM (n = 3). (F) Colon tumors were induced by the AOM/DSS protocol and then 4-OHT was injected (day 66 to 70). Average tumor number and size were determined at 10 days after the last 4-OHT injection. Data represent means ± SEM (n 5). Tumor lysates were analyzed at the indicated time points by western blotting (one mouse per lane). The histograms show densitometric quantification of p38α protein expression normalized to actin. Data represent means ± SEM (n = 3). (G) Colon tumors were induced by the AOM/DSS protocol and then 4-OHT was injected (day 66 to 70). At 20 days after the last 4-OHT injection, colon sections were stained with p38α antibody. N, normal tissue; T, tumor. Bars = 50 µm. (H) Laser-captured microdissected (LCM) tumor samples were obtained from mice treated as in (G). Genomic DNA was purified and analyzed by qpcr with primers specific for exon 2 and exon 12 (as a control) of the p38α gene. Relative amount of exon 2 versus exon 12 is shown. Data are means ± SEM (n 6), p<0.05. (I) EpCAM + epithelial cells and CD45 + leukocytes were isolated from colon tumors of mice treated as in (G). Genomic DNA was purified and analyzed by qpcr for the deletion of p38α as in (H). Data represent means ± SEM (n 7).
11 10
12 11 Figure S6 (Related to Figure 7). Persistent downregulation of p38α in colon tumors reduces tumor burden without affecting histological tumor grading or epithelial barrier function (A and B) Colon tumors were induced by the AOM/DSS protocol and then 4-OHT was injected (day 66 to 70). Average tumor number and size (A) and tumor grades (B) were determined 45 days after the last 4-OHT injection. Data represent means ± SEM (n = 7). (C) Tumor lysates from different mice were analyzed at 45 days after last 4-OHT injection by western blotting (one mouse per lane). The histograms show densitometric quantification of p38α protein expression normalized to actin. Data represent means ± SEM (n 6). (D) Schematic representation of the protocol used for the sustained downregulation of p38α in AOM/DSS-induced colon tumors. (E) Tumor lysates from different mice treated as in (D) were analyzed by western blotting (one mouse per lane) at 20 days after the second 4-OHT cycle of injections. The histograms show densitometric quantification of p38α protein expression normalized to tubulin. Data represent means ± SEM (n 4)., p<0.05. (F) Average tumor number, size, load and tumor size distribution in mice at the end of the experiment indicated in (D). Data represent means ± SEM (n = 6)., p<0.05. (G) Tumors from mice treated as in (D) were classified into low or high grade (n=6) based on histological analysis. All the tumors detected in WT and p38α- IEC-ERT2 mice were of high grade.
13 12 (H) Intestinal permeability was determined by measuring the concentration in blood serum of FITC-dextran that was orally administered to mice, with or without colon tumors, 20 days after the last 4-OHT injection. Data are means ± SEM (n 4). Tumor permeability was estimated as described in Supplemental Experimental Procedures by subtracting the permeability in untreated mice from the permeability in tumor-bearing mice. The values obtained for tumor permeability were 562 ( ) in WT mice and 302 ( ) in p38α- IEC-ERT2 mice. Total tumor permeability was normalized to the average tumor numbers or to the tumor burdens indicated in Figure 6D. In both cases, the normalized tumor permeability was similar in the two genotypes: (562/10.80) in WT tumors and (302/6) in p38α KO tumors, referring to tumor numbers; (562/30.4) in WT tumors and (302/14.6) in p38α KO tumors referring to tumor burdens. (I) Colon tumors were induced by the AOM/DSS protocol and then 4-OHT was injected (day 66 to 70). At 20 days after the last 4-OHT injection, colon tumor lysates were analyzed by western blotting (one mouse per lane) with the indicated antibodies. (J) Relative mrna expression levels for the indicated genes in the tumors of mice treated as in (I) were determined by qrt-pcr. Data are means ± SEM (n = 4). (K) Colon tumors from mice treated as in (I) were stained with MPO antibodies. Bars = 100 µm. Quantifications are shown in the lower panel. Data represent means ± SEM (n=4)., p<0.05.
14 13 Supplemental Experimental Procedures Western blotting Distal colon segments were lysed in buffer containing 1% NP40, 150 mm NaCl, 50 mm Tris HCl ph 7.5, 2 mm EDTA, 2 mm EGTA, 20 mm sodium fluoride, 2 mm PMSF, 2 µm microcystin, 2 mm sodium orthovanadate, 1 mm DTT and 1x EDTA-free complete protease inhibitor cocktail (Roche, # ), using Precellys homogenization and lysis instrument (Bertin technologies). Protein content was quantified using the Bradford assay with BSA as standard (Bio-Rad), and 40 µg of total protein lysate in Laemmli buffer were separated on SDS-PAGE and transferred to nitrocellulose membrane (Whatman # ). After blocking (5% non-fat milk and 1% BSA in PBS, 1 hr at RT) membranes were incubated at 4ºC overnight with primary antibodies. The following antibodies were used: p38α (#9218; 1:1000), phospho-p38 (#9211;1:1000), phospho-stat3 Tyr705 (#9145; 1:600), STAT3 (#9132; 1:1000), phospho-iκbα Ser32/36(#9246; 1:600), IκBα (#4812; 1:1000), phospho- ERK1/2 (#9101;1:1000), phospho-akt Ser473 (#9271; 1:1000), phospho-p53 Ser15 (#9284; 1:1000), p53 (#2524; 1:1000), phospho-hsp27 Ser82 (#2401; 1:700), Mcl-1(#5453; 1:600), Bcl-2 (#2870, 1:1000), Bak (#3814; 1:1000), Bax (#2772; 1:1000) from Cell Signaling; γ- H2AX (Millipore #05-636; 1:1000), ZO-1 (# ; 1:1000) and Claudin 1 (#374900; 1:500) from Invitrogen; phospho-jnk (#C12541; 1:500) from BD; JNK (#SC-571; 1:1000) and Hsp27 (#SC-1049; 1:700) and Bcl-XL (#SC-8392; 1:1000) from Santa Cruz; p85 PARP (#G734A; 1:500) from Promega. Tubulin (Sigma #T9026) was used as loading control. After washing with PBS, membranes were incubated with Alexa Fluor 680 or 800-conjugated secondary antibodies (Invitrogen; 1:5000) for 1 hr at RT and were visualized using Odyssey Infrared Imaging System (Li-Cor, Biosciences). Histopathological analysis Tumor grades were scored using a two-tiered system based on up-to-date guidelines of the WHO for tumors of the digestive system. Briefly, adenomas with low-grade dysplasia consist of stratified dysplastic epithelium retaining its columnar shape, with the nuclei in the basal part of epithelium, whereas adenomas with high-grade dysplasia have lost its columnar shape and the nuclei are mainly located in the surface of the crypts. The following scoring system was used for epithelial damage: 1- intact crypts, 2- basal one-third damaged, 3- basal two-thirds damaged, 4- damaged surface epithelium.
15 14 The severity of inflammation was scored as follows: 1- rare cells in mucosa, 2- increased cells in lamina propria, 3- confluence of cells in the submucosa, 4- transmural inflammation. Immunohistochemistry Paraffin-embedded colon sections were stained with antibodies against Ki67 (Novacastra, NCL; 1:500, 1 hr RT), F4/80 (ebiosciences # ; 1:50, 2 hr RT), MPO (Dako #A0398; 1:1000, 30 min RT), β-catenin (BD Biosciences #610153; 1:100, 1 hr RT), Chromogranin-A (Abcam #151601; 1:1000 overnight 4ºC), cleaved caspase-3 (#9661; 1:200, 1 hr RT), p38α (#9218; 1:50, 2 hr RT) and phospho-p38 (#4631; 1:50, overnight 4 C) from Cell Signaling. In some experiments BrdU (Roche # ) was intraperitoneally injected (1 mg /10 g body weight) and 2 hr later the mice were sacrificed. BrdU staining was performed using anti- BrdU antibody (BD Biosciences #347580; 1:100 1 hr RT). The secondary antibodies used were: HRP conjugated anti-rabbit (ImmunoLogic #DPVR110HRP, 45 min at RT), anti-mouse (Dako #P0447; 1:100, 30 min at RT) and anti-rat (Dako #P0450; 1:75, 30 min at RT). RNA extraction and qrt-pcr Total RNA was extracted from distal colon segments or from colon tumors using TRIzol (Invitrogen) or PureLink RNA mini kit (Ambion # A). After DNase I treatment (Roche # ), total RNA (1-2 µg) was reverse transcribed using a Super script II Reverse Transcriptase (Invitrogen # ) and Random primers (Invitrogen # ). qrt-pcr was performed in triplicates using 4 µl of 1/12 diluted cdna and SYBR green (Bio-Rad # ) in 20 µl total volume on a Bio-Rad C1000 thermal cycler machine. Relative quantities ( cycle threshold values) were obtained by normalizing against GAPDH. The primers used are listed in the Supplemental Table. Analysis of tight junctions by transmission electron microscopy Pieces of intestine were fixed overnight at 4ºC in 2% paraformaldehyde and 2.5% glutaraldehyde, postfixed in OsO4 (2%) for 2 hr and then dehydrated at 4ºC through a series of acetone concentrations (50, 70, 90, 96, 100%), prior to being progressively (25, 50, 75, 100%) embedded in Epon 812 epoxy resin. Sections with a thickness of 50 nm were cut with an ultramicrotome UCT6 (Leica Microsystems, Vienna) and placed on TEM grids (Formvar carbon-coated Cu grids). The grids were further contrasted with uranyl acetate and lead
16 15 citrate. Micrographs were obtained with a Jeol JEM 1010 MT electron microscope (Jeol, Japan) operating at 80 kv. Images were recorded with AnalySIS (SIS, Munster, Germany) on a Megaview III CCD camera. Mouse treatments Mouse genotyping was performed by PCR on genomic tail DNA. Primers and conditions are available upon request. To activate Cre-ERT2, mice were injected intraperitoneally for 5 consecutive days with 1 mg/day of 4-OHT (Sigma, H6278) dissolved in corn oil (Sigma, #C8267). The inhibitor of p38α and p38β PH (Goldstein et al., 2010) was obtained from Selleckchem (#S2726) and was dissolved in 0.5% Methyl cellulose (Sigma #M7140) and 0.025% Tween 20 (Sigma #P1379) at a concentration of 1 mg/ml. Mice were administered daily a dose of 10 mg/kg body weight by oral gavage for 12 consecutive days. Control mice were similarly administered with vehicle (0.5% Methyl cellulose and 0.025% Tween 20). Isolation of epithelial cells and leukocytes from colon Acute colitis was induced by treating mice with 2% DSS for 5 days. One day after termination of the DSS treatment, mice were sacrificed and colons were dissected, opened longitudinally and washed extensively in cold PBS. Colons were then cut into 3-4 pieces and incubated in 8 mm EDTA solution in PBS at 37ºC for 15 min. After 15 min, EDTA solution was replaced with cold PBS and shacked vigorously for 45 s. This process was repeated once more. Supernatants from both incubations were combined, centrifuged at 1200 rpm for 5 min at 4ºC, and pelleted cells were digested with Dispase II (0.5 mg/ml, Roche # ) at 37ºC for 25 min. After the incubation, the digested cell suspension was gently syringed with 18 G needle in order to get enriched single cell population and sequentially passed through 100, 70 and 40 µm mesh filters (BD Biosciences). Filtered cells contain epithelial cells and intra-epithelial leukocytes. To obtain lamina propria leukocyte, colon pieces after EDTA incubations were collected, cut into small pieces (2-3 mm) and digested with mix of collagenase A (1.75 mg/ml, Roche # ) and DNase I (0.05 mg/ml, Sigma #D4263) at 37ºC for 45 min. After digestion, the cell suspension was filtered as above to get single cell suspension containing lamina propria leukocytes. To quantify immune cell populations, single cell suspensions from both purifications were co-stained with panleukocyte antigen CD45 and for specific leukocyte population markers (CD11b, Gr1 and
17 16 CD19) and analyzed on FACS Aria 2.0 (BD Biosciences). FITC-EpCAM (Santa Cruz #sc ) staining was used to discard epithelial cells by negative selection. To get epithelial cells and total leukocytes from the colon, after induction of acute colitis whole colon tissue was digested in a mix of collagenase and DNase I, syringed and sequentially filtered as described above. Then cells were co-stained with FITC-EpCAM and APC-CD45 (BD #559864). Stained cells were analyzed and sorted for EpCAM + epithelial cells and CD45 + leukocytes. DNA or RNA was isolated from sorted cells for further analysis. Detection of tumor mutations Tumor tissues were obtained by laser capture microdissection (LCM) from paraffinembedded colons and were digested with proteinase K. Genomic DNA was purified by standard phenol-chloroform extraction. Exon 3 of the β-catenin gene was amplified by PCR using the following specific primers: 5 -GCTGACCTGATGGAGTTGGA-3 and 5 - GCTACTTGCTCTTGCGTGAA-3 (amplicon size = 227 bp). PCR products were purified and sequenced using forward and reverse primers. Mutations were detected by observing individual chromatograms. Analysis of p38α floxed exon deletion Genomic DNA was isolated using standard phenol-chloroform extraction from LCMprocessed tumor samples or from EpCAM + epithelial cells and CD45 + leukocytes isolated from tumors and then analyzed by qpcr with primers specific for exon 2 (floxed) and exon 12 (as a control) of the p38α gene. Relative amount of exon 2 versus exon 12 was determined. Primers are listed in the Supplemental Table. Determination of IL-6 in blood serum and colon tissue Blood was collected by cardiac puncture and serum samples were obtained using SST tubes (BD #365968). IL-6 protein concentration in serum was determined by the CBA mouse IL-6 flex set (BD #558301) according to manufacturer s instructions. To determine IL-6 protein levels in colonic tissue, 100 µg of freshly lysed colon tissue were analyzed by ELISA using anti-mouse IL-6 purified capture antibody (ebioscience # ) and anti-mouse IL-6 biotin detection antibody (ebioscience # ). Mouse IL-6 recombinant protein (ebioscience # ) was used to make the standard curve.
18 17 Analysis of apoptosis in human cancer cell lines Human colon cancer cell lines SW-620 and Caco-2 were grown in Dulbecco s modified Eagle s medium supplemented with 10% heat-inactivated fetal bovine serum, 1% l-glutamine, and 1% penicillin-streptomycin. The p38 MAPK inhibitors SB (10 µm), PH (1 µm) and Birb0796 (200 nm) were added every 48 hr to the cell cultures. After 96 hr, all the cells (including floating cells in the medium) were collected and lysed. Cell lysates were analyzed by western blotting using p85 PARP antibody as an apoptosis marker. Estimation of colon tumor permeability To estimate tumor permeability, we first measured intestinal permeability both in untreated mice and in tumor-bearing mice as described in Experimental Procedures. The intestinal permeability should mainly depend on epithelial barrier function in untreated mice, whereas in tumor-bearing mice both epithelial barrier function and tumorigenesis (i.e., changes in intestinal permeability due to tumor formation) should contribute to the total permeability measured. The intestinal permeability values in untreated mice were subtracted from the total permeability values in tumor-bearing mice to estimate the permeability due to tumorigenesis, which was then normalized against the average tumor numbers or the tumor burdens. Primers used for quantitative RT-PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) GAPDH CTTCACCACCATGGAGGAGGC GGCATGGACTGTGGTCATGAG IL-6 AGTTGCCTTCTTGGGACTGA CAGAATTGCCATTGCACAAC IL-1α GAGAGCCGGGTGACAGTATC TGACAAACTTCTGCCTGACG TNF-α CGTCAGCCGATTTGCTATCT CGGACTCCGCAAAGTCTAAG COX2 AAAAGCTGGGAAGCCTTCTC AAGTGCTGGGCAAAGAATGC p38α CTGACCGACGACCACGTTC CTTCGTTCACAGCTAGGTTGC Chg A AAGTGCGTCCTGGAAGTCATCTC GCTTGGCTTTTCTGGCTTGC Ki67 GTGCTGACCCTGATGGGGAAGG GCTCTTGCCCTGCCTGACACC CyclinD1 CTGCAAATGGAACTGCTTCTGGTGA AGCAGGAGAGGAAGTTGTTGGGGCT
19 18 Muc2 GCCCGTGGAGTCGTACGTGC TTGGGGCAGAGTGAGGCGGT Tff3 TAATGCTGTTGGTGGTCCTG CAGCCACGGTTGTTACACTG TGFβ1 GGAGGTACCGCCCGGCCCGC GACAGCAATGGGGGTTCGGG IL-10 CCAAGCCTTATCGGAAATGA TTTTCACAGGGGAGAAATCG IL-12p40 AGGTCACACTGGACCAAAGG TGGTTTGATGATGTCCCTGA ZO-1 GCCGCTAAGAGCACAGCAA GCCCTCCTTTTAACACATCAGA Occludin TTGAAAGTCCACCTCCTTACAGA CCGGATAAAAAGAGTACGCTGG ZO-2 ACTCCAGTCCCTATTCCTGAG GCTATTTCGATCCTCGCATTC JAM-C CTGCCTGACTTCTTCCTGCT ATGTACCACTGGGTTTCGGT IL-11 TGTTCTCCTAACCCGATCCCT CAGGAAGCTGCAAAGATCCCA CXCL-1 ACTGCACCCAAACCGAAGTC TGGGGACACCTTTTAGCATCTT CXCL-2 CCAACCACCAGGCTACAGG GCGTCACACTCAAGCTCTG IL-23p19 CCAGCGGGACATATGAATCT AGGCTCCCCTTTGAAGATGT IL-17A GCCCTCAGACTACCTCAACC ACACCCACCAGCATCTTCTC p38α (Exon 2) p38α (Exon 12) GCATCGTGTGGCAGTTAAGA GCCCTCCCTCACTTCAGGAG GTCCTTTTGGCGTGAATGAT TGTGCTCGGCACTGGAGACC
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
More informationSupplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained
1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained jejunum sections ( 200 magnification;
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationSupplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationSUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More informationSupplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
More informationProgrammed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
More informationFigure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
More informationEssential Medium, containing 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin. Huvec were cultured in
Supplemental data Methods Cell culture media formulations A-431 and U-87 MG cells were maintained in Dulbecco s Modified Eagle s Medium. FaDu cells were cultured in Eagle's Minimum Essential Medium, containing
More informationSupporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
More informationCell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
More informationProtocol for Gene Transfection & Western Blotting
The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation
More informationSUPPORTING MATREALS. Methods and Materials
SUPPORTING MATREALS Methods and Materials Cell Culture MC3T3-E1 (subclone 4) cells were maintained in -MEM with 10% FBS, 1% Pen/Strep at 37ºC in a humidified incubator with 5% CO2. MC3T3 cell differentiation
More informationSupporting Information
Supporting Information Fujishita et al. 10.1073/pnas.0800041105 SI Text Polyp Scoring. Intestinal polyps were counted as described (1). Briefly, the small and large intestines were excised, washed with
More informationPlasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis
Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG
More informationfor six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and
SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1
More informationVEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization
Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,
More informationSupplemental Experimental Procedures
Cell Stem Cell, Volume 2 Supplemental Data A Temporal Switch from Notch to Wnt Signaling in Muscle Stem Cells Is Necessary for Normal Adult Myogenesis Andrew S. Brack, Irina M. Conboy, Michael J. Conboy,
More informationSipper BK Experimental Animal Co. (Shanghai, China) and bred in a specific. pathogen-free environment. The animal study protocol was approved by the
Supplementary information, Data S1 Materials and Methods Mice, Ad vectors and reagents Female C57BL/6 mice, 8-10 weeks of age, were purchased from Joint Ventures Sipper BK Experimental Animal Co. (Shanghai,
More informationSupplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
More informationSupplementary Materials for
immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef
More informationSupplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
More informationSupplementary Figure 1
Supplementary Figure 1 Control Pancreatitis Supplementary Figure 2 A Panc Liver SI Spleen H 2 O B EZH2 fl/fl C EZH2 fl/fl 37bp EZH2 ERK2 D E 5 EZH2 fl/fl Fasting Glucose (mg/dl) 2 18 16 14 12 1 8 6 4 2
More information2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein
Supplementary Information 2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked amino-modification products by acrolein Ayumi Tsutsui and Katsunori Tanaka* Biofunctional Synthetic Chemistry Laboratory, RIKEN
More informationHIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury
J Mol Med 2015 HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury Sara Karsikas; Mikko Myllymäki; Minna Heikkilä; Raija Sormunen; Kari I Kivirikko; Johanna Myllyharju; Raisa
More informationSupporting Information
Supporting Information Franco et al. 10.1073/pnas.1015557108 SI Materials and Methods Drug Administration. PD352901 was dissolved in 0.5% (wt/vol) hydroxyl-propyl-methylcellulose, 0.2% (vol/vol) Tween
More informationSerum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationAP VP DLP H&E. p-akt DLP
A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy
More informationProtection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSupplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationPRODUCT INFORMATION & MANUAL
PRODUCT INFORMATION & MANUAL Mitochondrial Extraction Kit NBP2-29448 Research use only. Not for diagnostic or therapeutic procedures www.novusbio.com P: 303.760.1950 P: 888.506.6887 F: 303.730.1966 technical@novusbio.com
More informationFigure S1, related to Figure 1. Escaper p38a-expressing cancer cells repopulate the tumors (A) Scheme of the mt/mg reporter that expresses a
Cancer Cell, Volume 33 Supplemental Information Targeting p38a Increases DNA Damage, Chromosome Instability, and the Anti-tumoral Response to Taxanes in Breast Cancer Cells Begoña Cánovas, Ana Igea, Alessandro
More informationMANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function
MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function Authors: Richard Y. Wu 1,2, Majd Abdullah 1, Pekka Määttänen
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More informationRayBio KinaseSTAR TM Akt Activity Assay Kit
Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll
More informationSupplementary Table 1. Characterization of HNSCC PDX models established at MSKCC
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete
More informationSupplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
More informationEvaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers
Evaluation of directed and random motility in microslides Motility experiments in IBIDI microslides, image acquisition and processing were performed as described. PMN, which ended up in an angle < 180
More informationSupplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were
Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze
More informationPlasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
More informationProcaspase-3. Cleaved caspase-3. actin. Cytochrome C (10 M) Z-VAD-fmk. Procaspase-3. Cleaved caspase-3. actin. Z-VAD-fmk
A HeLa actin - + + - - + Cytochrome C (1 M) Z-VAD-fmk PMN - + + - - + actin Cytochrome C (1 M) Z-VAD-fmk Figure S1. (A) Pan-caspase inhibitor z-vad-fmk inhibits cytochrome c- mediated procaspase-3 cleavage.
More informationThe Schedule and the Manual of Basic Techniques for Cell Culture
The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293
More informationBezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-
Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells
More informationSupplementary Figure 1.
Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass
More informationSupporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3
Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Sarbassov et al. 1 Material and Methods Materials Reagents were obtained from the following sources: protein
More informationSupplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
More informationChromatin IP (Isw2) Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles.
Chromatin IP (Isw2) 7/01 Toshi last update: 06/15 Reagents Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles. 2.5 M glycine. TBS:
More informationSupplementary Figure 1.
Supplementary Figure 1. Visualization of endoplasmic reticulum-mitochondria interaction by in situ proximity ligation assay. A) Illustration of targeted proteins in mitochondria (M), endoplasmic reticulum
More informationGraveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document
Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document Wet Lab: Sara Olson and Lijun Zhan Computational Lab: Xintao Wei and Michael Duff PI: Brenton Graveley
More information(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment
SUPPLEMENTAL INFORMATION Supplemental Methods Generation of RyR2-S2808D Mice Murine genomic RyR2 clones were isolated from a 129/SvEvTacfBR λ-phage library (Stratagene, La Jolla, CA) (Supplemental Fig.
More informationNuclear Extraction Kit
Nuclear Extraction Kit Catalog Number KA1346 50 assays Version: 07 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Principle of the Assay... 3 General Information... 4
More informationExpression of acid base transporters in the kidney collecting duct in Slc2a7 -/-
Supplemental Material Results. Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- and Slc2a7 -/- mice. The expression of AE1 in the kidney was examined in Slc26a7 KO mice.
More informationSupporting Information
Supporting Information Desnues et al. 10.1073/pnas.1314121111 SI Materials and Methods Mice. Toll-like receptor (TLR)8 / and TLR9 / mice were generated as described previously (1, 2). TLR9 / mice were
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationSUPPLEMENTARY INFORMATION. Involvement of IL-21 in the epidermal hyperplasia of psoriasis
SUPPLEMENTARY INFORMATION Involvement of IL-21 in the epidermal hyperplasia of psoriasis Roberta Caruso 1, Elisabetta Botti 2, Massimiliano Sarra 1, Maria Esposito 2, Carmine Stolfi 1, Laura Diluvio 2,
More informationFormylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis
Supplementary Data Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis Keqiang Chen, Mingyong Liu, Ying Liu, Teizo Yoshimura, Wei Shen, Yingying Le, Scott
More informationPrimary Adult Naïve CD4+ CD45RA+ Cells. Prepared by: David Randolph at University of Alabama, Birmingham
Primary Adult Naïve CD4+ CD45RA+ Cells Prepared by: David Randolph (drdrdr@uab.edu) at University of Alabama, Birmingham Goal: To obtain large numbers of highly pure primary CD4+ CD45RO- CD25- cells from
More informationCOPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic
COPD lungs show an attached stratified mucus layer that separate bacteria from the epithelial cells resembling the protective colonic mucus SUPPLEMENTARY TABLES AND FIGURES Tables S1 S8, page 1 and separate
More informationSupplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization
Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationPair-fed % inkt cells 0.5. EtOH 0.0
MATERIALS AND METHODS Histopathological analysis Liver tissue was collected 9 h post-gavage, and the tissue samples were fixed in 1% formalin and paraffin-embedded following a standard procedure. The embedded
More informationSupporting Information
Supporting Information Valkenburg et al. 10.1073/pnas.1403684111 SI Materials and Methods ELISA and Microneutralization. Sera were treated with Receptor Destroying Enzyme II (RDE II, Accurate) before ELISA
More informationOnline Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2
Online Data Supplement Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Yi Lin and Zhongjie Sun Department of physiology, college of
More informationBone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by
Nakano et al. Supplementary information 1. Supplementary Figure 2. Methods 3. References Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by exosome transfer into
More informationTitle of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates
More informationTFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry
TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi
More informationBlocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-
Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone
More informationPREPARATION OF IF- ENRICHED CYTOSKELETAL PROTEINS
TMM,5-2011 PREPARATION OF IF- ENRICHED CYTOSKELETAL PROTEINS Ice-cold means cooled in ice water. In order to prevent proteolysis, make sure to perform all steps on ice. Pre-cool glass homogenizers, buffers
More informationSupporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationsequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
More informationRNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
More informationSupplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right
More informationSupplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
More informationMinute TM Plasma Membrane Protein Isolation and Cell Fractionation Kit User Manual (v5)
Minute TM Plasma Membrane Protein Isolation and Cell Fractionation Kit Catalog number: SM-005 Description Minute TM plasma membrane (PM) protein isolation kit is a novel and patented native PM protein
More informationGraveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document
Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document Wet Lab: Sara Olson and Lijun Zhan Computational Lab: Xintao Wei and Michael Duff PI: Brenton Graveley
More informationWestern Immunoblotting Preparation of Samples:
Western Immunoblotting Preparation of Samples: Total Protein Extraction from Culture Cells: Take off the medium Wash culture with 1 x PBS 1 ml hot Cell-lysis Solution into T75 flask Scrap out the cells
More informationNature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.
Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the
More informationAggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines
CORRECTION NOTICE Nat. Med. doi:10.1038/nm.3547; corrected online 25 August 2014 Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Christine Schauer, Christina
More informationReviewers' comments: Reviewer #1 Expert in EAE and IL-17a (Remarks to the Author):
Reviewers' comments: Reviewer #1 Expert in EAE and IL-17a (Remarks to the Author): This study shows that the inducible camp early repressor (ICER) is involved in development of Th17 cells that are pathogenic
More informationSupplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
More informationFigure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow
SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)
More informationSUPPLEMENT. Materials and methods
SUPPLEMENT Materials and methods Cell culture and reagents Cell media and reagents were from Invitrogen unless otherwise indicated. Antibiotics and Tet-certified serum were from Clontech. In experiments
More informationYork criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
MATERIALS AND METHODS Study population Blood samples were obtained from 15 patients with AS fulfilling the modified New York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More information