Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION"

Transcription

1 Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny 2, 3, Liang Cheng, Nihal Ahmad 6 and Xiaoqi Liu 1, 3 1 Department of Biochemistry, 2 Department of Biological Sciences, 3 Center for Cancer Research, 4 Department of Comparative Pathobiology, Purdue University, West Lafayette, IN 4797, U.S. Department of Pathology and Laboratory Medicine, Indiana University School of Medicine, Indianapolis, IN 462, U.S. 6 Department of Dermatology, University of Wisconsin, Madison, Wisconsin 376, U.S. To whom correspondence should be addressed: Department of Biochemistry, Purdue University, 17 S. University Street, West Lafayette, IN 4797, Tel: ; Fax: ; Supplementary Experimental Procedures Supplementary Figure Legends Supplementary Figures

2 Supplementary Experimental Procedures Cell cultures and transfection- DU14 (Pten wild-type) and (Pten null) cells were cultured in Dulbecco modified Eagle medium (DMEM) supplemented with 1% (vol/vol) fetal bovine serum, 1 units/ml penicillin, and 1 units/ml streptomycin at 37 C in % CO 2. LNCap cells were cultured in RPMI-164 medium. RWPE-1 (an immortalized cell line derived from normal human adult prostate) cells were cultured in keratinocyte Medium (Invitrogen). Plasmid DNA was transfected with MegaTran (ORIGENE) as described by the manufacturer. Construction of vectors- vector was from Addgene (Plasmid 1339). RNAi- To deplete endogenous Pten, plko.1-pten plasmids (TRCN274, TRCN2746, TRCN2748, Sigma) was transfected into cells, followed by puromycin (1 ug/ml) selection. To knock down endogenous Plk1, sirna (targeting sequence: AAGGGCGGCTTTGCCAAGTGCTT, Dharmacon) was transfected into cells. Fluorescence in site hybridization (FISH) and chromosome spreading- For FISH experiments, interphase cells were harvested by trypsinization and washed with PBS. Cells were then swollen in 6 mm KCl for min at 37 o, fixed in Carnoy s solution (3:1 of methanol: glacial acetic acid), dropped onto slides, and dried at room temperature. The slides were stained with Cytocell enumeration probes against chromosome 2 conjugated with Texas Red (LPE2R-A), according to the manufacturer s protocol. For chromosome spreading, cells were treated with nocodazole for 16h and harvested by mechanic shake-off. Cells were then swollen in 6 mm KCl for min at 37 o, and fixed in Carnoy s solution, dropped onto slides, and dried at room temperature. The slides were stained with DAPI. Immunofluorescence staining- Cells were fixed in 4% paraformaldehyde, treated with cold menthol, and stained with phospho-histone H3 (Serine 1) antibody (Millipore), followed by AlexaFluro88 anti-rabbit antibody (Invitrogen) for detection. Western blotting- Cells lysates were prepared in AMI lysis buffer (Active Motif). Equal amounts of protein were resolved on 1% polyacrylamide gels and subjected to immunoblotting with the following antibodies: anti-plk1 (Santa Cruz Biotechnology), anti-pten (Cell Signaling), anti-cleaved PARP (Millipore), and anti- (Sigma). Immunohistochemisty (IHC)- Murine or human patient tissues were fixed in 1% neutral buffered formalinand embedded in paraffin. Immunohistochemistry was accomplished with biotinylated secondary antibodies with the Elite Vectastain ABC kit and peroxidase substrate diaminobenzidine kit ( Laboratories). In brief, sections were deparaffinized, rehydrated, and antigens were retrieved using the 21-Retriever (PickCell Laboratories) and antigen unmasking solution ( Laboratories). After samples were blocked with the MOM blocking reagent ( Laboratories), samples were incubated with primary antibodies (Plk1, 1:1, sc-17783, Santa Cruz Biotechnology; p-akt, 1:, 46, Cell

3 Signaling) at 4 C overnight. The signal was visualized by diaminobenzidine (DAB) and -bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium sequential detection following the manufacturer s ( Laboratories) recommendations. Human prostate cancer tissue array slides (PR87a) were purchased from US Biomax. Cell viability assay- Cells were grown in 96-well plates. After inhibition of Plk1 by BI 36 treatment, the relative numbers of viable cells in culture were determined using the CellTiter-Glo Luminescent Cell Viability Assay kit, which evaluates the presence of ATP, an indicator of metabolically active cells (Promega). Soft agar quantitative assay- Cells were grown on soft agar in 6-well plates. After BI 36 treatment for 7 days, the colony numbers in each well were determined with the CellTiter-Glo Luminescent Cell Viability Assay kit (Promega).

4 Supplementary Figure Legends Fig S1 Generation of Pten-depleted DU14 cell line. DU14 cells were transfected with plko.1-pten or plko.1 vector as control, followed by puromycin selection. Depletion efficiency was examined by Western blotting. Fig S2 Mitotic stress of Pten-depleted cells depends on Pten nuclear function, but not its phosphatase activity. (A-B) Re-introduction of in cells attenuates the response to mitotic inhibitors. control or -expressing cells were treated with nocodazole (8 or 16 nm) in A, taxol ( or 1 nm) in B, or DMSO for 1 h, and mitotic index was determined by phospho-histone H3 staining ( p <., not significant). (C-D) cells were transfected with GFP vector, -WT, -K13, 289E, or Myc-Pten-C124S, followed by Western blotting or immunofluorescence staining. Scale bar: 1 µm. (E-F) cells were transfected with GFP vector, -K13, 289E, or Myc-Pten-C124S, and treated with nocodazole in E, or taxol in F. Mitotic index was determined by phospho-histone H3 staining ( p <., not significant). Fig S3 Hypersensitivity of Pten-depleted cells to Plk1 inhibition is independent of targeting sites of Pten RNAi. (A) DU14 cells were transfected with plko.1-pten plasmid 1 (2746), plko.1-pten plasmid 2 (2748), or plko.1 vector as control, followed by puromycin selection. Depletion efficiency was examined by Western blotting. (B) The cells as in A were treated with BI 36 for 1 h, and mitotic index was determined by phospho-histone H3 staining ( p <.). (C) The cells as in A (, cells from each cell line) were grown in 96-well plates, treated with BI 36 (, 1,,, 1 nm) for 3 days, and subjected to cell viability assay ( p <.). Fig S4 Pten-depleted DU14 cells are hypersensitive to knock-down of Plk1. (A) DU14 control and Pten-depleted cells were transfected with sirna to knock down Plk1 for 36 h, and harvested for phospho-histone H3 staining to determine mitotic index ( p <.). (B) DU14 control and Pten-depleted cells (,) were grown on 96-well plates, depleted of Plk1 by sirna, and harvested for cell viability assay in the following three days ( p <.). Fig S Generation of Pten-depleted RWPE-1 cells. RWPE-1 cells were transfected with plko.1-pten or plko.1 vector as control, followed by puromycin selection. Depletion efficiency was examined by Western blotting.

5 Fig S6 Re-introduction of Pten-wild type or Pten-C124S, but not Pten-K13, 289E, in cells attenuates the response to Plk1 inhibition. (A) cells were transfected with or GFP vector as control, followed by selection with G418. (B) The cells as in A were treated with BI 36 (1 or nm) or DMSO, and subjected to FACS analysis after 12 h treatment (left panel), or phospho-histone H3 staining to measure mitotic index after 1 h treatment (right panel). ( p <.) (C) The cells as in A were treated with BI 36 (1 or nm) or DMSO for 16 h, and analyzed by cleaved PARP Western blotting to examine apoptosis (left panel)., cells from each cell line were grown in 96-well plates, treated with BI 36 (, 1,,, 1 nm) for 3 days, and subjected to cell viability assay (right panel). ( p <.) (D-E) PC3 cells were transfected with GFP vector or different Pten constructs (-K13, 289E or Myc-Pten-C124S), treated with BI 36, and harvested for phospho-h3 staining in D, or cell viability assay in E. ( p <., not significant) Fig S7 Re-introduction of in LNCap cells attenuates the response to Plk1 inhibition. (A) LNCap cells were transfected with or GFP vector as control, followed by selection with G418. (B) The cells as in A were treated with BI 36 (1 or nm) or DMSO, and subjected to phospho-histone H3 staining to measure mitotic index after 1 h treatment ( p <.). (C), cells from each cell line as in A were grown in 96-well plates, treated with BI 36 (, 1,,, 1 nm) for 3 days, and subjected to cell viability assay ( p <.).

6 Figure S1. Generation of Pten-depleted DU14 cell line. Pten DU14 Con Pten-

7 Figure S2. Mitotic stress of Pten-depleted cell depends on Pten nuclear function, but not its phosphatase activity A C 1 Control 8 16 Nocodazole (nm) B D 1 Green Control 1 Taxol (nm) DNA Merge Mock -K13,289E Myc-Pten-C124S GFP Pten Pten-WT Pten-K13,289E E 3 1 Pten-K13,289E Pten-C124S 8 16 Nocodazole (nm) F 1 Pten-K13,289E Pten-C124S 1 Taxol (nm)

8 Figure S3. Hypersensitivity of Pten-depleted cells to Plk1 inhibitioin is independent of targeting sites by Pten RNAi A B C Pten Con Pten RNAi Con RNAi Pten RNAi-2746 Pten RNAi cell viability (%) Con RNAi Pten RNAi-2746 Pten RNAi

9 Figure S4. Pten-depleted DU14 cells are hypersensitive to knock-down of Plk1. A Plk1- Plk1- + PtenpH3-positive cells (%) 3 1 B cell viability (%) Control Pten hours after Plk1 RNAi

10 Figure S. Generation of Pten-depleted RWPE-1 cell line. Pten Plk1 RWPE-1 Con Pten-

11 Figure S6. Re-introduction of Pten-wild type or Pten-C124S, but not Pten-K13, 289E, in cells attanuates the response to Plk1 inhibition. A Control Pten B control GPF-Pten Mock 1 G2/M=3% G2/M=41% G2/M=8% G2/M=24% G2/M=28% G2/M=4% 2N 4N 2N 4N 2N 4N 3 1 Control 1 C Cleaved PARP D 3 1 Plk1 Pten-K13,289E Pten-C124S Control E cell viability (%) cell viability (%) _Control _ Pten-K13,289E Pten-C124S

12 Supplementary Figure S7. Re-introduction of in LNCap cells attanuates the response to Plk1 inhibition. A B C Pten LNCap 1 LNCap 1 cell viability (%) LNCap 1 1

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi

More information

Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa

Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa SUPPLEMENTARY FIGURES Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa tet-on cells that stably express HP1α-CFP, HP1β-CFP, or HP1γ-CFP were monitored with livecell

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Reagents and antibodies was purchased from iaffin GmbH & Co KG. Cisplatin (ristol-myers Squibb Co.) and etoposide (Sandoz Pharma Ltd.) were used. Antibodies recognizing

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells

More information

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian))

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian)) Datasheet GeneTex, Inc : Toll Free 1-877-GeneTex (1-877-436-3839) Fax:1-949-309-2888 info@genetex.com GeneTex International Corporation : Tel:886-3-6208988 Fax:886-3-6208989 infoasia@genetex.com Date :

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details

More information

GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin

GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin Supplementary Fig. 1 a CQ treatment ScrB OGX11 MG132 I II AZD5363 I II b GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin ctrl CQ GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin rapamycin rapamycincq

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function

MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function Authors: Richard Y. Wu 1,2, Majd Abdullah 1, Pekka Määttänen

More information

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha

More information

Apoptosis Mediated Cytotoxicity of Curcumin Analogues PGV-0 and PGV-1 in WiDr Cell Line

Apoptosis Mediated Cytotoxicity of Curcumin Analogues PGV-0 and PGV-1 in WiDr Cell Line Apoptosis Mediated Cytotoxicity of Curcumin Analogues PGV-0 and PGV-1 in WiDr Cell Line Endah Puji Septisetyani, Muthi Ikawati, Barinta Widaryanti and Edy Meiyanto* ) Cancer Chemoprevention Research Center,

More information

Instructions for Use. APO-AB Annexin V-Biotin Apoptosis Detection Kit 100 tests

Instructions for Use. APO-AB Annexin V-Biotin Apoptosis Detection Kit 100 tests 3URGXFW,QIRUPDWLRQ Sigma TACS Annexin V Apoptosis Detection Kits Instructions for Use APO-AB Annexin V-Biotin Apoptosis Detection Kit 100 tests For Research Use Only. Not for use in diagnostic procedures.

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document

Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document Wet Lab: Sara Olson and Lijun Zhan Computational Lab: Xintao Wei and Michael Duff PI: Brenton Graveley

More information

NF-κB p65 (Phospho-Thr254)

NF-κB p65 (Phospho-Thr254) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 NF-κB p65 (Phospho-Thr254) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02015 Please read the provided manual

More information

Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen,

Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen, Cell Stem Cell, Volume 7 Supplemental Information Adult SVZ Lineage Cells Home to and Leave the Vascular Niche via Differential Responses to SDF1/CXCR4 Signaling Erzsebet Kokovay, Susan Goderie, Yue Wang,

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/2/43/43ra55/dc1 Supplementary Materials for Pathway-Based Identification of Biomarkers for Targeted Therapeutics: Personalized Oncology with PI3K Pathway

More information

CONTRACTING ORGANIZATION: University of Southern California Los Angeles, CA 90033

CONTRACTING ORGANIZATION: University of Southern California Los Angeles, CA 90033 AD Award Number: W81XWH-07-01-0264 TITLE: Function of Klotho and is MicroRNA in Prostate Cancer and Aging PRINCIPAL INVESTIGATOR: Shao-Yao Ying, Ph.D. CONTRACTING ORGANIZATION: University of Southern California

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

INTRODUCTION. Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells

INTRODUCTION. Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells Galina Chipitsyna, Qiaoke Gong, Chance F. Gray et al. Endocrinology,

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

Effective Targeting of Quiescent Chronic Myelogenous

Effective Targeting of Quiescent Chronic Myelogenous Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,

More information

Human recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z.

Human recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z. Intensity % Intensity % A Human recombinat MIF protein (hrmif), MW: 12428.31 Da m/z hrmif (12428.31 Da) + 4-IPP (282 Da) MWtot ~ 12715.21 Da m/z B HTC/C3 DAPI phistone-h3 Merge HTC/C3 DAPI phistone-h3

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,

More information

TECHNICAL BULLETIN. Phospho-Akt (pser 473 ) ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) in cell and tissue lysates

TECHNICAL BULLETIN. Phospho-Akt (pser 473 ) ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) in cell and tissue lysates Phospho-Akt (pser 473 ) ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) in cell and tissue lysates Catalog Number RAB0011 Storage Temperature 20 C TECHNICAL BULLETIN Product Description

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Control Pancreatitis Supplementary Figure 2 A Panc Liver SI Spleen H 2 O B EZH2 fl/fl C EZH2 fl/fl 37bp EZH2 ERK2 D E 5 EZH2 fl/fl Fasting Glucose (mg/dl) 2 18 16 14 12 1 8 6 4 2

More information

SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.

SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences. Supplementary Table 2. Antibodies used for Immunofluoresence. Antibody Dilution Source Goat anti-pdx1 1:100 R&D Systems Rabbit anti-hnf6 1:100 Santa Cruz Biotechnology Mouse anti-nkx6.1 1:200 Developmental

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Lu et al., http://www.jcb.org/cgi/content/full/jcb.201012063/dc1 Figure S1. Kinetics of nuclear envelope assembly, recruitment of Nup133

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Edens and Levy, http://www.jcb.org/cgi/content/full/jcb.201406004/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Nuclear shrinking does not depend on the cytoskeleton

More information

Supplemental Information. 3D-CLEM Reveals that a Major Portion. of Mitotic Chromosomes Is Not Chromatin

Supplemental Information. 3D-CLEM Reveals that a Major Portion. of Mitotic Chromosomes Is Not Chromatin Molecular Cell, Volume 64 Supplemental Information 3D-CLEM Reveals that a Major Portion of Mitotic Chromosomes Is Not Chromatin Daniel G. Booth, Alison J. Beckett, Oscar Molina, Itaru Samejima, Hiroshi

More information

Multiple mechanisms underlying acquired resistance to taxanes in selected docetaxelresistant MCF-7 breast cancer cells

Multiple mechanisms underlying acquired resistance to taxanes in selected docetaxelresistant MCF-7 breast cancer cells Wang et al. BMC Cancer 2014, 14:37 RESEARCH ARTICLE Multiple mechanisms underlying acquired resistance to taxanes in selected docetaxelresistant MCF-7 breast cancer cells Harris Wang 1, The Vo 1, Ali Hajar

More information

Metformin enhances cisplatin cytotoxicity by suppressing Stat3 activity. Chien-Chung Lin, Hsuan-Heng Yeh, Wei-Lun Huang, Jing-Jou Yan, Wu-Wei Lai,

Metformin enhances cisplatin cytotoxicity by suppressing Stat3 activity. Chien-Chung Lin, Hsuan-Heng Yeh, Wei-Lun Huang, Jing-Jou Yan, Wu-Wei Lai, Metformin enhances cisplatin cytotoxicity by suppressing Stat3 activity independently of the LKB1 AMPK pathway Chien-Chung Lin, Hsuan-Heng Yeh, Wei-Lun Huang, Jing-Jou Yan, Wu-Wei Lai, Wen-Pin Su, Helen

More information

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue

More information

Glucose Uptake-Glo Assay

Glucose Uptake-Glo Assay TECHNICAL MANUAL Glucose Uptake-Glo Assay Instructions for Use of Products J1341, J1342, and J1343 Revised 2/17 TM467 Glucose Uptake-Glo Assay All technical literature is available at: www.promega.com/protocols/

More information

Validation & Assay Performance Summary

Validation & Assay Performance Summary Validation & Assay Performance Summary LanthaScreen IGF-1R GripTite Cells Cat. no. K1834 Modification Detected: Phosphorylation of Multiple Tyr Residues on IGF-1R LanthaScreen Cellular Assay Validation

More information

TECHNICAL BULLETIN. Catalog Number RAB0447 Storage Temperature 20 C

TECHNICAL BULLETIN. Catalog Number RAB0447 Storage Temperature 20 C Phospho-Stat3 (ptyr 705 ) and pan-stat3 ELISA Kit for detection of human, mouse, or rat phospho-stat3 (ptyr 705 ) and pan-stat3 in cell and tissue lysates Catalog Number RAB0447 Storage Temperature 20

More information

TRACP & ALP double-stain Kit

TRACP & ALP double-stain Kit Table of Content I. Description... 2 II. Introduction... 2 III. Principles... 2 IV. Kit components... 3 V. Storage... 3 VI. Preparation of reagents... 3 VII. Methods... 4-7 Cell fixation... 4 Activity

More information

Supplementary figure legends

Supplementary figure legends Supplementary figure legends Supplementary Figure 1. Exposure of CRT occurs independently from the apoptosisassociated loss of the mitochondrial membrane potential (MMP). (A) HeLa cells treated with MTX

More information

Supplementary Materials for

Supplementary Materials for immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef

More information

A dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma

A dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma Supplemental data A dual PI3 kinase/mtor inhibitor reveals emergent efficacy in glioma Qi-Wen Fan, Zachary A. Knight, David D. Goldenberg, Wei Yu, Keith E. Mostov, David Stokoe, Kevan M. Shokat, and William

More information

STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit

STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit Catalog Number KA2176 96 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Principle of the Assay...

More information

Differential Requirements for Ras and the Retinoblastoma Tumor Suppressor Protein in the Androgen Dependence of Prostatic Adenocarcinoma Cells 1

Differential Requirements for Ras and the Retinoblastoma Tumor Suppressor Protein in the Androgen Dependence of Prostatic Adenocarcinoma Cells 1 Vol. 11, 361 372, July 2000 Cell Growth & Differentiation 361 Differential Requirements for Ras and the Retinoblastoma Tumor Suppressor Protein in the Androgen Dependence of Prostatic Adenocarcinoma Cells

More information

RayBio Human Phospho-DDR2 (Tyr740) and Total DDR2 ELISA Kit

RayBio Human Phospho-DDR2 (Tyr740) and Total DDR2 ELISA Kit RayBio Human Phospho-DDR2 (Tyr740) and Total DDR2 ELISA Kit Catalog #: PEL-DDR2-Y740-T User Manual Last revised March 22, 2018 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607

More information

DEVELOPMENTAL VALIDATION OF SPERM HY-LITER EXPRESS Jennifer Old, Chris Martersteck, Anna Kalinina, Independent Forensics, Lombard IL

DEVELOPMENTAL VALIDATION OF SPERM HY-LITER EXPRESS Jennifer Old, Chris Martersteck, Anna Kalinina, Independent Forensics, Lombard IL DEVELOPMENTAL VALIDATION OF SPERM HY-LITER EXPRESS Jennifer Old, Chris Martersteck, Anna Kalinina, Independent Forensics, Lombard IL Background and Introduction SPERM HY-LITER is the first immunofluorescent

More information

RayBio Human Phosphotyrosine BTK ELISA Kit

RayBio Human Phosphotyrosine BTK ELISA Kit RayBio Human Phosphotyrosine BTK ELISA Kit Catalog #: PEL-BTK-Y User Manual Last revised August 10, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite

More information

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana

More information

Nimbolide inhibits pancreatic cancer growth and metastasis through ROS-mediated

Nimbolide inhibits pancreatic cancer growth and metastasis through ROS-mediated Nimbolide inhibits pancreatic cancer growth and metastasis through ROS-mediated apoptosis and inhibition of epithelial-to-mesenchymal transition Ramadevi Subramani a, Ph.D., Elizabeth Gonzalez b, MS.,

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines CORRECTION NOTICE Nat. Med. doi:10.1038/nm.3547; corrected online 25 August 2014 Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Christine Schauer, Christina

More information

microrna Presented for: Presented by: Date:

microrna Presented for: Presented by: Date: microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions

More information

Supplementary material. Supplementary Figure legends

Supplementary material. Supplementary Figure legends Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)

More information

Human Apolipoprotein A1 EIA Kit

Human Apolipoprotein A1 EIA Kit A helping hand for your research Product Manual Human Apolipoprotein A1 EIA Kit Catalog Number: 83901 96 assays 1 Table of Content Product Description 3 Assay Principle 3 Kit Components 3 Storage 4 Reagent

More information

Supplemental Information. Supernumerary Centrosomes. Nucleate Extra Cilia and Compromise. Primary Cilium Signaling. Current Biology, Volume 22

Supplemental Information. Supernumerary Centrosomes. Nucleate Extra Cilia and Compromise. Primary Cilium Signaling. Current Biology, Volume 22 Current Biology, Volume 22 Supplemental Information Supernumerary Centrosomes Nucleate Extra Cilia and Compromise Primary Cilium Signaling Moe R. Mahjoub and Tim Stearns Supplemental Inventory 1. Supplemental

More information

PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells

PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells C.-G. Sun 1 *, J. Zhuang 1 *, W.-J. Teng 1, Z. Wang 2 and S.-S. Du 3 1 Department of Oncology,

More information

In Vitro Studies of the Aurora-Kinase Inhibitor MLN8237 in Prostate Cancer Cell Lines

In Vitro Studies of the Aurora-Kinase Inhibitor MLN8237 in Prostate Cancer Cell Lines In Vitro Studies of the Aurora-Kinase Inhibitor MLN837 in Prostate Cancer Cell Lines Nicole V. Julian Mentor: Ana Aparicio, M.D. Special Thanks to Brittany Kleb Department of Genitourinary Medical Oncology

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Mapping the Ligand-binding Site on a GPCR Using Genetically-encoded Photocrosslinkers

Mapping the Ligand-binding Site on a GPCR Using Genetically-encoded Photocrosslinkers Mapping the Ligand-binding Site on a GPCR Using Genetically-encoded Photocrosslinkers Amy Grunbeck, Thomas Huber, Pallavi Sachdev, Thomas P. Sakmar Laboratory of Molecular Biology and Biochemistry, The

More information

STAT1 (ps727) (Human/Mouse) ELISA Kit

STAT1 (ps727) (Human/Mouse) ELISA Kit STAT1 (ps727) (Human/Mouse) ELISA Kit Catalog Number KA2171 96 assays Version: 01 Intended for research use only www.abnova.com I. INTRODUCTION STAT1 (ps727) (Human/Mouse) ELISA (Enzyme-Linked Immunosorbent

More information

SHORT COMMUNICATION. Human Papillomavirus Type 11 E1 Ú E4 and L1 Proteins Colocalize in the Mouse Xenograft System at Multiple Time Points

SHORT COMMUNICATION. Human Papillomavirus Type 11 E1 Ú E4 and L1 Proteins Colocalize in the Mouse Xenograft System at Multiple Time Points VIROLOGY 214, 259 263 (1995) SHORT COMMUNICATION Human Papillomavirus Type 11 E1 Ú E4 and L1 Proteins Colocalize in the Mouse Xenograft System at Multiple Time Points DARRON R. BROWN,*,,1 JANINE T. BRYAN,

More information

B. SDS-PAGE. Western blot MW (kda) Supplementary Information. Supplementary Figure 1. MW (kda) Glutelin. Prolamin. 3 E.coli. 3 E.

B. SDS-PAGE. Western blot MW (kda) Supplementary Information. Supplementary Figure 1. MW (kda) Glutelin. Prolamin. 3 E.coli. 3 E. Supplementary Information Supplementary Figure 1. A. MW (kda) B. SDS-PAGE Western blot MW (kda) 50 40 100 75 50 37 30 Glutelin 25 20 15 20 Prolamin 10 ARP1 1 2 3 E.coli MucoRice ARP1 (RNAi +) 4 5 ARP1

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

HiPer Western Blotting Teaching Kit

HiPer Western Blotting Teaching Kit HiPer Western Blotting Teaching Kit Product Code: HTI009 Number of experiments that can be performed: 5/20 Duration of Experiment: ~ 2 days Day 1: 6-8 hours (SDS- PAGE and Electroblotting) Day 2: 3 hours

More information

Pepsin Solution ready-to-use

Pepsin Solution ready-to-use SIE HABEN DIE VISION, WIR HABEN DIE SUBSTANZ. Pepsin Solution Single component Pepsin Solution: only one component refrigerator stable Pepsin is a commonly used digestive enzyme for immunohistochemical

More information

STAT3 (py705) (Human/Mouse/Rat) ELISA Kit

STAT3 (py705) (Human/Mouse/Rat) ELISA Kit STAT3 (py705) (Human/Mouse/Rat) ELISA Kit Catalog Number KA2175 96 assays Version: 01 Intended for research use only www.abnova.com I. INTRODUCTION STAT3 (py705) (Human/Mouse/Rat) ELISA (Enzyme-Linked

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee

More information

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + +

IP: anti-gfp VPS29-GFP. IP: anti-vps26. IP: anti-gfp - + + FAM21 Strump. WASH1 IP: anti- 1 2 3 4 5 6 FAM21 Strump. FKBP IP: anti-gfp VPS29- GFP GFP-FAM21 tail H H/P P H H/P P c FAM21 FKBP Strump. VPS29-GFP IP: anti-gfp 1 2 3 FKBP VPS VPS VPS VPS29 1 = VPS29-GFP

More information

ab E3 Ligase Auto- Ubiquitilylation Assay Kit

ab E3 Ligase Auto- Ubiquitilylation Assay Kit ab139469 E3 Ligase Auto- Ubiquitilylation Assay Kit Instructions for Use For testing ubiquitin E3 ligase activity through assessment of their ability to undergo auto-ubiquitinylation This product is for

More information

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG

More information

Linli Yao 1,3, Enci Mary Kan 2, Jia Lu 2, Aijun Hao 1, S Thameem Dheen 3, Charanjit Kaur 3* and Eng-Ang Ling 3* JOURNAL OF NEUROINFLAMMATION

Linli Yao 1,3, Enci Mary Kan 2, Jia Lu 2, Aijun Hao 1, S Thameem Dheen 3, Charanjit Kaur 3* and Eng-Ang Ling 3* JOURNAL OF NEUROINFLAMMATION Yao et al. Journal of Neuroinflammation 2013, 10:23 JOURNAL OF NEUROINFLAMMATION RESEARCH Open Access Toll-like receptor 4 mediates microglial activation and production of inflammatory mediators in neonatal

More information

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description: File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'

More information

Supplemental information contains 7 movies and 4 supplemental Figures

Supplemental information contains 7 movies and 4 supplemental Figures 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV

More information

Comparison of primary tumor sections from MMTV-PyMT or MTLn3-ErbB3-

Comparison of primary tumor sections from MMTV-PyMT or MTLn3-ErbB3- Supplemental Data Comparison of primary tumor sections from MMTV-PyMT or MTLn3-ErbB3- GFP tumors in mice either injected with control or clodronate-containing liposomes and stained for macrophages using

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

BacPAK Baculovirus Rapid Titer Kit

BacPAK Baculovirus Rapid Titer Kit BacPAK Baculovirus Rapid Titer Kit United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Cat. No. 631406 PT3153-1 (072213) Clontech Laboratories,

More information

A Microfluidic ExoSearch Chip for Multiplexed Exosome Detection Towards Bloodbased Ovarian Cancer Diagnosis

A Microfluidic ExoSearch Chip for Multiplexed Exosome Detection Towards Bloodbased Ovarian Cancer Diagnosis Electronic Supplementary Material (ESI) for Lab on a Chip. This journal is The Royal Society of Chemistry 2015 Supplementary Information A Microfluidic ExoSearch Chip for Multiplexed Exosome Detection

More information

Focus Application. Compound-Induced Cytotoxicity

Focus Application. Compound-Induced Cytotoxicity xcelligence System Real-Time Cell Analyzer Focus Application Compound-Induced Cytotoxicity For life science research only. Not for use in diagnostic procedures. Featured Study: Using the Time Resolving

More information

Supplementary Material and Methods

Supplementary Material and Methods Online Supplement Kockx et al, Secretion of Apolipoprotein E from Macrophages 1 Supplementary Material and Methods Cloning of ApoE-GFP Full-length human apoe3 cdna (pcdna3.1/zeo + -apoe) was kindly provided

More information

Exo-Glow TM Exosome Labeling Kits

Exo-Glow TM Exosome Labeling Kits Exo-Glow TM Exosome Labeling Kits Cat# EXOR100A-1 Cat# EXOG200A-1 Cat# EXOC300A-1 User Manual Store kit at -20 o C on receipt Version 8 3/10/2017 A limited-use label license covers this product. By use

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis SUPPLEMENTARY MATERIAL Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis Wen-An Wang 1, Wen-Xin Liu 1, Serpen Durnaoglu 2, Sun-Kyung Lee 2, Jihong Lian

More information

Detection of Circulating Tumor Cells Harboring a Unique ALK-Rearrangement in ALK- Positive Non-Small-Cell Lung Cancer.

Detection of Circulating Tumor Cells Harboring a Unique ALK-Rearrangement in ALK- Positive Non-Small-Cell Lung Cancer. Detection of Circulating Tumor Cells Harboring a Unique ALK-Rearrangement in ALK- Positive Non-Small-Cell Lung Cancer Pailler, et al Data Supplement Table S1. Numbers and Percentages of ALK-Rearranged

More information

Validation & Assay Performance Summary

Validation & Assay Performance Summary Validation & Assay Performance Summary CellSensor DBE-bla MDA-MB-468 Cell Line Cat. no. K1814 Pathway Description The phosphatidylinositol-3-kinase (PI3K) signaling cascade is essential for cell growth

More information

The role of the scaffolding protein Tks5 in EGF signaling

The role of the scaffolding protein Tks5 in EGF signaling The role of the scaffolding protein Tks5 in EGF signaling PhD Thesis Anna Fekete Doctoral School in Biology Head of the School: Dr. Anna Erdei Structural Biochemistry Doctoral Program Head of the Program:

More information

WNT5A enhances resistance of melanoma cells to targeted BRAF inhibitors

WNT5A enhances resistance of melanoma cells to targeted BRAF inhibitors Research article WNT5A enhances resistance of melanoma cells to targeted BRAF inhibitors Jamie N. Anastas, 1,2 Rima M. Kulikauskas, 3 Tigist Tamir, 4 Helen Rizos, 5 Georgina V. Long, 5 Erika M. von Euw,

More information

ab LDL Uptake Assay Kit (Cell-Based)

ab LDL Uptake Assay Kit (Cell-Based) ab133127 LDL Uptake Assay Kit (Cell-Based) Instructions for Use For the detection of LDL uptake into cultured cells. This product is for research use only and is not intended for diagnostic use. Version

More information

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive Online Data Supplement: Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive asthma Dan Cheng, Zheng Xue, Lingling Yi, Huimin Shi, Kan Zhang, Xiaorong Huo, Luke R. Bonser,

More information

Supplementary Information

Supplementary Information Supplementary Information Recruitment of Mesenchymal Stem Cells Into Prostate Tumours Promotes Metastasis Younghun Jung 1, Jin Koo Kim 1, Yusuke Shiozawa 1, Jingcheng Wang 1, Anjali Mishra 1, Jeena Joseph

More information

Report on the Development of HP8 a Natural Herbal Formulation for Prostate Health

Report on the Development of HP8 a Natural Herbal Formulation for Prostate Health P. G. Waterman Product Development Report for HP8 page 1 Report on the Development of HP8 a Natural Herbal Formulation for Prostate Health Prepared for InterHealth Biosciences Australia (IBA) by Professor

More information

Supplementary table 1

Supplementary table 1 Supplementary table 1 S. pombe strain list Fig. 1A JX38 h + ade6-m216 nda3-km311 PX476 PW775 PX545 PX546 h- ade6-m216 sgo2::ura4 + nda3-km311 h 9 mad2::ura4 + nda3-km311 h + ade6-m21 nda3-km311 rad21 +

More information

Influenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set

Influenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set Influenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set Catalog Number : SEK001 To achieve the best assay results, this manual must be read carefully before using this product and the assay

More information

The Annexin V Apoptosis Assay

The Annexin V Apoptosis Assay The Annexin V Apoptosis Assay Development of the Annexin V Apoptosis Assay: 1990 Andree at al. found that a protein, Vascular Anticoagulant α, bound to phospholipid bilayers in a calcium dependent manner.

More information