Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION"

Transcription

1 Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny 2, 3, Liang Cheng, Nihal Ahmad 6 and Xiaoqi Liu 1, 3 1 Department of Biochemistry, 2 Department of Biological Sciences, 3 Center for Cancer Research, 4 Department of Comparative Pathobiology, Purdue University, West Lafayette, IN 4797, U.S. Department of Pathology and Laboratory Medicine, Indiana University School of Medicine, Indianapolis, IN 462, U.S. 6 Department of Dermatology, University of Wisconsin, Madison, Wisconsin 376, U.S. To whom correspondence should be addressed: Department of Biochemistry, Purdue University, 17 S. University Street, West Lafayette, IN 4797, Tel: ; Fax: ; Supplementary Experimental Procedures Supplementary Figure Legends Supplementary Figures

2 Supplementary Experimental Procedures Cell cultures and transfection- DU14 (Pten wild-type) and (Pten null) cells were cultured in Dulbecco modified Eagle medium (DMEM) supplemented with 1% (vol/vol) fetal bovine serum, 1 units/ml penicillin, and 1 units/ml streptomycin at 37 C in % CO 2. LNCap cells were cultured in RPMI-164 medium. RWPE-1 (an immortalized cell line derived from normal human adult prostate) cells were cultured in keratinocyte Medium (Invitrogen). Plasmid DNA was transfected with MegaTran (ORIGENE) as described by the manufacturer. Construction of vectors- vector was from Addgene (Plasmid 1339). RNAi- To deplete endogenous Pten, plko.1-pten plasmids (TRCN274, TRCN2746, TRCN2748, Sigma) was transfected into cells, followed by puromycin (1 ug/ml) selection. To knock down endogenous Plk1, sirna (targeting sequence: AAGGGCGGCTTTGCCAAGTGCTT, Dharmacon) was transfected into cells. Fluorescence in site hybridization (FISH) and chromosome spreading- For FISH experiments, interphase cells were harvested by trypsinization and washed with PBS. Cells were then swollen in 6 mm KCl for min at 37 o, fixed in Carnoy s solution (3:1 of methanol: glacial acetic acid), dropped onto slides, and dried at room temperature. The slides were stained with Cytocell enumeration probes against chromosome 2 conjugated with Texas Red (LPE2R-A), according to the manufacturer s protocol. For chromosome spreading, cells were treated with nocodazole for 16h and harvested by mechanic shake-off. Cells were then swollen in 6 mm KCl for min at 37 o, and fixed in Carnoy s solution, dropped onto slides, and dried at room temperature. The slides were stained with DAPI. Immunofluorescence staining- Cells were fixed in 4% paraformaldehyde, treated with cold menthol, and stained with phospho-histone H3 (Serine 1) antibody (Millipore), followed by AlexaFluro88 anti-rabbit antibody (Invitrogen) for detection. Western blotting- Cells lysates were prepared in AMI lysis buffer (Active Motif). Equal amounts of protein were resolved on 1% polyacrylamide gels and subjected to immunoblotting with the following antibodies: anti-plk1 (Santa Cruz Biotechnology), anti-pten (Cell Signaling), anti-cleaved PARP (Millipore), and anti- (Sigma). Immunohistochemisty (IHC)- Murine or human patient tissues were fixed in 1% neutral buffered formalinand embedded in paraffin. Immunohistochemistry was accomplished with biotinylated secondary antibodies with the Elite Vectastain ABC kit and peroxidase substrate diaminobenzidine kit ( Laboratories). In brief, sections were deparaffinized, rehydrated, and antigens were retrieved using the 21-Retriever (PickCell Laboratories) and antigen unmasking solution ( Laboratories). After samples were blocked with the MOM blocking reagent ( Laboratories), samples were incubated with primary antibodies (Plk1, 1:1, sc-17783, Santa Cruz Biotechnology; p-akt, 1:, 46, Cell

3 Signaling) at 4 C overnight. The signal was visualized by diaminobenzidine (DAB) and -bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium sequential detection following the manufacturer s ( Laboratories) recommendations. Human prostate cancer tissue array slides (PR87a) were purchased from US Biomax. Cell viability assay- Cells were grown in 96-well plates. After inhibition of Plk1 by BI 36 treatment, the relative numbers of viable cells in culture were determined using the CellTiter-Glo Luminescent Cell Viability Assay kit, which evaluates the presence of ATP, an indicator of metabolically active cells (Promega). Soft agar quantitative assay- Cells were grown on soft agar in 6-well plates. After BI 36 treatment for 7 days, the colony numbers in each well were determined with the CellTiter-Glo Luminescent Cell Viability Assay kit (Promega).

4 Supplementary Figure Legends Fig S1 Generation of Pten-depleted DU14 cell line. DU14 cells were transfected with plko.1-pten or plko.1 vector as control, followed by puromycin selection. Depletion efficiency was examined by Western blotting. Fig S2 Mitotic stress of Pten-depleted cells depends on Pten nuclear function, but not its phosphatase activity. (A-B) Re-introduction of in cells attenuates the response to mitotic inhibitors. control or -expressing cells were treated with nocodazole (8 or 16 nm) in A, taxol ( or 1 nm) in B, or DMSO for 1 h, and mitotic index was determined by phospho-histone H3 staining ( p <., not significant). (C-D) cells were transfected with GFP vector, -WT, -K13, 289E, or Myc-Pten-C124S, followed by Western blotting or immunofluorescence staining. Scale bar: 1 µm. (E-F) cells were transfected with GFP vector, -K13, 289E, or Myc-Pten-C124S, and treated with nocodazole in E, or taxol in F. Mitotic index was determined by phospho-histone H3 staining ( p <., not significant). Fig S3 Hypersensitivity of Pten-depleted cells to Plk1 inhibition is independent of targeting sites of Pten RNAi. (A) DU14 cells were transfected with plko.1-pten plasmid 1 (2746), plko.1-pten plasmid 2 (2748), or plko.1 vector as control, followed by puromycin selection. Depletion efficiency was examined by Western blotting. (B) The cells as in A were treated with BI 36 for 1 h, and mitotic index was determined by phospho-histone H3 staining ( p <.). (C) The cells as in A (, cells from each cell line) were grown in 96-well plates, treated with BI 36 (, 1,,, 1 nm) for 3 days, and subjected to cell viability assay ( p <.). Fig S4 Pten-depleted DU14 cells are hypersensitive to knock-down of Plk1. (A) DU14 control and Pten-depleted cells were transfected with sirna to knock down Plk1 for 36 h, and harvested for phospho-histone H3 staining to determine mitotic index ( p <.). (B) DU14 control and Pten-depleted cells (,) were grown on 96-well plates, depleted of Plk1 by sirna, and harvested for cell viability assay in the following three days ( p <.). Fig S Generation of Pten-depleted RWPE-1 cells. RWPE-1 cells were transfected with plko.1-pten or plko.1 vector as control, followed by puromycin selection. Depletion efficiency was examined by Western blotting.

5 Fig S6 Re-introduction of Pten-wild type or Pten-C124S, but not Pten-K13, 289E, in cells attenuates the response to Plk1 inhibition. (A) cells were transfected with or GFP vector as control, followed by selection with G418. (B) The cells as in A were treated with BI 36 (1 or nm) or DMSO, and subjected to FACS analysis after 12 h treatment (left panel), or phospho-histone H3 staining to measure mitotic index after 1 h treatment (right panel). ( p <.) (C) The cells as in A were treated with BI 36 (1 or nm) or DMSO for 16 h, and analyzed by cleaved PARP Western blotting to examine apoptosis (left panel)., cells from each cell line were grown in 96-well plates, treated with BI 36 (, 1,,, 1 nm) for 3 days, and subjected to cell viability assay (right panel). ( p <.) (D-E) PC3 cells were transfected with GFP vector or different Pten constructs (-K13, 289E or Myc-Pten-C124S), treated with BI 36, and harvested for phospho-h3 staining in D, or cell viability assay in E. ( p <., not significant) Fig S7 Re-introduction of in LNCap cells attenuates the response to Plk1 inhibition. (A) LNCap cells were transfected with or GFP vector as control, followed by selection with G418. (B) The cells as in A were treated with BI 36 (1 or nm) or DMSO, and subjected to phospho-histone H3 staining to measure mitotic index after 1 h treatment ( p <.). (C), cells from each cell line as in A were grown in 96-well plates, treated with BI 36 (, 1,,, 1 nm) for 3 days, and subjected to cell viability assay ( p <.).

6 Figure S1. Generation of Pten-depleted DU14 cell line. Pten DU14 Con Pten-

7 Figure S2. Mitotic stress of Pten-depleted cell depends on Pten nuclear function, but not its phosphatase activity A C 1 Control 8 16 Nocodazole (nm) B D 1 Green Control 1 Taxol (nm) DNA Merge Mock -K13,289E Myc-Pten-C124S GFP Pten Pten-WT Pten-K13,289E E 3 1 Pten-K13,289E Pten-C124S 8 16 Nocodazole (nm) F 1 Pten-K13,289E Pten-C124S 1 Taxol (nm)

8 Figure S3. Hypersensitivity of Pten-depleted cells to Plk1 inhibitioin is independent of targeting sites by Pten RNAi A B C Pten Con Pten RNAi Con RNAi Pten RNAi-2746 Pten RNAi cell viability (%) Con RNAi Pten RNAi-2746 Pten RNAi

9 Figure S4. Pten-depleted DU14 cells are hypersensitive to knock-down of Plk1. A Plk1- Plk1- + PtenpH3-positive cells (%) 3 1 B cell viability (%) Control Pten hours after Plk1 RNAi

10 Figure S. Generation of Pten-depleted RWPE-1 cell line. Pten Plk1 RWPE-1 Con Pten-

11 Figure S6. Re-introduction of Pten-wild type or Pten-C124S, but not Pten-K13, 289E, in cells attanuates the response to Plk1 inhibition. A Control Pten B control GPF-Pten Mock 1 G2/M=3% G2/M=41% G2/M=8% G2/M=24% G2/M=28% G2/M=4% 2N 4N 2N 4N 2N 4N 3 1 Control 1 C Cleaved PARP D 3 1 Plk1 Pten-K13,289E Pten-C124S Control E cell viability (%) cell viability (%) _Control _ Pten-K13,289E Pten-C124S

12 Supplementary Figure S7. Re-introduction of in LNCap cells attanuates the response to Plk1 inhibition. A B C Pten LNCap 1 LNCap 1 cell viability (%) LNCap 1 1

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)

More information

Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival

Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Supplementary Information for Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Tatsuro Kawamura 1, Makoto Kawatani 1, Makoto Muroi, Yasumitsu Kondoh,

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal

More information

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS

Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS 3D culture and cell proliferation- MiaPaCa-2 cell culture in 3D was performed as described previously (1). Briefly, 8-well glass chamber slides were evenly coated with 50 µl/well

More information

Supporting Information

Supporting Information Supporting Information Identification of Novel ROS Inducers: Quinone Derivatives Tethered to Long Hydrocarbon Chains Yeonsun Hong,, Sandip Sengupta,, Wooyoung Hur, *, Taebo Sim,, * KU-KIST Graduate School

More information

Prolonged mitotic arrest induces a caspase-dependent DNA damage

Prolonged mitotic arrest induces a caspase-dependent DNA damage SUPPLEMENTARY INFORMATION Prolonged mitotic arrest induces a caspase-dependent DNA damage response at telomeres that determines cell survival Karolina O. Hain, Didier J. Colin, Shubhra Rastogi, Lindsey

More information

Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.

Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript. Supplemental Materials: I. Supplemental Methods II. Supplemental Figure Legends III. Supplemental Figures Supplemental Methods Cell Culture and Transfections for Wild Type and JNK1-/-,JNK2-/- MEFs: The

More information

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm) Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi

More information

Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa

Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa SUPPLEMENTARY FIGURES Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa tet-on cells that stably express HP1α-CFP, HP1β-CFP, or HP1γ-CFP were monitored with livecell

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Hopkins University, Howard Hughes Medical Institute, USA) (27). Cells were maintained in DMEM

Hopkins University, Howard Hughes Medical Institute, USA) (27). Cells were maintained in DMEM Supplementary Materials and Methods Cell Culture HCT116 (TP53 +/+ and TP53 -/- ) cells were provided by Dr. Bert Vogelstein (Johns Hopkins University, Howard Hughes Medical Institute, USA) (27). Cells

More information

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete

More information

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1

More information

SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of

SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of SUPPLEMENTAL MATERIALS AND METHODS Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of cysteine and methionine and then treated with 10 μm puromycin in depletion medium

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Reagents and antibodies was purchased from iaffin GmbH & Co KG. Cisplatin (ristol-myers Squibb Co.) and etoposide (Sandoz Pharma Ltd.) were used. Antibodies recognizing

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplementary data Supplementary Figure 1 Supplementary Figure 2 Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna

More information

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed

More information

Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen

Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen Receptor Signaling to PI3K/AKT Tiffany G. Bredfeldt, Kristen L. Greathouse, Stephen H. Safe, Mien-Chie Hung, Mark

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

SUPPLEMENTAL FIGURE LEGENDS

SUPPLEMENTAL FIGURE LEGENDS SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies

More information

Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC-

Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC- Supplemental material and methods Reagents. Hydralazine was purchased from Sigma-Aldrich. Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC- 133, human thyroid medullary

More information

Supplementary Figures

Supplementary Figures 6668 Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with

More information

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

SUPPLEMENTAL EXPERIMENTAL PROCEDURES SUPPLEMENTAL EXPERIMENTAL PROCEDURES Crystal violet assay Cells were seeded in 24-well plates and cultured in media supplemented with % FBS for 7 days. Media were then removed, plates were briefly washed

More information

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion

More information

Protocol for Gene Transfection & Western Blotting

Protocol for Gene Transfection & Western Blotting The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

Supplementary Data Table of Contents:

Supplementary Data Table of Contents: Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary

More information

Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic

Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic Reticulum Stress Lokesh Makhija, BE, Veda Krishnan, MSc, Rakhshinda Rehman, MTech, Samarpana Chakraborty, MSc, Shuvadeep Maity,

More information

Supplemental Information. Inhibition of the Proteasome b2 Site Sensitizes. Triple-Negative Breast Cancer Cells

Supplemental Information. Inhibition of the Proteasome b2 Site Sensitizes. Triple-Negative Breast Cancer Cells Cell Chemical Biology, Volume 24 Supplemental Information Inhibition of the Proteasome b2 Site Sensitizes Triple-Negative Breast Cancer Cells to b5 Inhibitors and Suppresses Nrf1 Activation Emily S. Weyburne,

More information

Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from

Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from Supplementary Methods: Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from mouse tumor samples and analyzed as

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

RayBio KinaseSTAR TM Akt Activity Assay Kit

RayBio KinaseSTAR TM Akt Activity Assay Kit Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll

More information

Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts

Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage

More information

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1

More information

Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3

Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Sarbassov et al. 1 Material and Methods Materials Reagents were obtained from the following sources: protein

More information

Supporting Information

Supporting Information Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)

More information

Acute myocardial infarction (MI) on initial presentation was diagnosed if there was 20 minutes

Acute myocardial infarction (MI) on initial presentation was diagnosed if there was 20 minutes SUPPLEMENTAL MATERIAL Supplemental Methods Diagnosis for acute myocardial infarction Acute myocardial infarction (MI) on initial presentation was diagnosed if there was 20 minutes or more of chest pain

More information

SUPPLEMENT. Materials and methods

SUPPLEMENT. Materials and methods SUPPLEMENT Materials and methods Cell culture and reagents Cell media and reagents were from Invitrogen unless otherwise indicated. Antibiotics and Tet-certified serum were from Clontech. In experiments

More information

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum

More information

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementary Figure S1 Supplementary Figure S1. PARP localization patterns using GFP-PARP and PARP-specific antibody libraries GFP-PARP localization in non-fixed (A) and formaldehyde fixed (B) GFP-PARPx

More information

a Control IgG Intestine c Testis b Thymus 1 3 2 S S 2 1 3 4 4 Figure S1 The wild-type mouse (C57BL/6J) organs (intestine, thymus and testis) were frozen in liquid nitrogen and sectioned at 5 µm on a cryostat.

More information

Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death

Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death Supplementary

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Jewell et al., http://www.jcb.org/cgi/content/full/jcb.201007176/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. IR Munc18c association is independent of IRS-1. (A and

More information

SUPPLEMENTARY INFORMATION. Involvement of IL-21 in the epidermal hyperplasia of psoriasis

SUPPLEMENTARY INFORMATION. Involvement of IL-21 in the epidermal hyperplasia of psoriasis SUPPLEMENTARY INFORMATION Involvement of IL-21 in the epidermal hyperplasia of psoriasis Roberta Caruso 1, Elisabetta Botti 2, Massimiliano Sarra 1, Maria Esposito 2, Carmine Stolfi 1, Laura Diluvio 2,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. Neither the activation nor suppression of the MAPK pathway affects the ASK1/Vif interaction. (a, b) HEK293 cells were cotransfected with plasmids encoding

More information

Protein MultiColor Stable, Low Range

Protein MultiColor Stable, Low Range Product Name: DynaMarker Protein MultiColor Stable, Low Range Code No: DM670L Lot No: ******* Size: 200 μl x 3 (DM670 x 3) (120 mini-gel lanes) Storage: 4 C Stability: 12 months at 4 C Storage Buffer:

More information

Supplementary Figure Legends Supplementary Figure S1. Aurora-A is essential for SAC establishment in early mitosis. (a-c) RPE cells were treated with DMSO (a), MLN8237 (b) or BI2536 (c) for Two hours.

More information

Tel: ; Fax: ;

Tel: ; Fax: ; Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2

More information

The Schedule and the Manual of Basic Techniques for Cell Culture

The Schedule and the Manual of Basic Techniques for Cell Culture The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293

More information

LIST OF ORGANS FOR HISTOPATHOLOGICAL ANALYSIS:!! Neural!!!!!!Respiratory:! Brain : Cerebrum,!!! Lungs and trachea! Olfactory, Cerebellum!!!!Other:!

LIST OF ORGANS FOR HISTOPATHOLOGICAL ANALYSIS:!! Neural!!!!!!Respiratory:! Brain : Cerebrum,!!! Lungs and trachea! Olfactory, Cerebellum!!!!Other:! LIST OF ORGANS FOR HISTOPATHOLOGICAL ANALYSIS:!! Neural!!!!!!Respiratory:! Brain : Cerebrum,!!! Lungs and trachea! Olfactory, Cerebellum!!!!Other:! Spinal cord and peripheral nerves! Eyes, Inner ear, nasal

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-05-1-0045 TITLE: MT 2A Phosphorylation by PKC Mu/PKD Influences Chemosensitivity to Cisplatin in Prostate Cancer PRINCIPAL INVESTIGATOR: Kethandapatti Balaji, M.D. CONTRACTING ORGANIZATION:

More information

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,

More information

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian))

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian)) Datasheet GeneTex, Inc : Toll Free 1-877-GeneTex (1-877-436-3839) Fax:1-949-309-2888 info@genetex.com GeneTex International Corporation : Tel:886-3-6208988 Fax:886-3-6208989 infoasia@genetex.com Date :

More information

Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were

Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)

More information

(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment

(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment SUPPLEMENTAL INFORMATION Supplemental Methods Generation of RyR2-S2808D Mice Murine genomic RyR2 clones were isolated from a 129/SvEvTacfBR λ-phage library (Stratagene, La Jolla, CA) (Supplemental Fig.

More information

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained

More information

Essential Medium, containing 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin. Huvec were cultured in

Essential Medium, containing 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin. Huvec were cultured in Supplemental data Methods Cell culture media formulations A-431 and U-87 MG cells were maintained in Dulbecco s Modified Eagle s Medium. FaDu cells were cultured in Eagle's Minimum Essential Medium, containing

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3076 Supplementary Figure 1 btrcp targets Cep68 for degradation during mitosis. a) Cep68 immunofluorescence in interphase and metaphase. U-2OS cells were transfected with control sirna

More information

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Dunsch et al., http://www.jcb.org/cgi/content/full/jcb.201202112/dc1 Figure S1. Characterization of HMMR and CHICA antibodies. (A) HeLa

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis

Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis 1 2 Supporting Information 3 4 5 FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce apoptosis 6 7 Kishu Ranjan and Chandramani Pathak* 8 9 Department of Cell Biology, School

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding

More information

Supporting Information

Supporting Information Supporting Information Fujishita et al. 10.1073/pnas.0800041105 SI Text Polyp Scoring. Intestinal polyps were counted as described (1). Briefly, the small and large intestines were excised, washed with

More information

STUDIES ON MUSTARD-STIMULATED PROTEASES AND INHIBITORS IN HUMAN EPIDERMAL KERATINOCYTES (HEK): DEVELOPMENT OF ANTIVESICANT DRUGS

STUDIES ON MUSTARD-STIMULATED PROTEASES AND INHIBITORS IN HUMAN EPIDERMAL KERATINOCYTES (HEK): DEVELOPMENT OF ANTIVESICANT DRUGS STUDIES ON MUSTARD-STIMULATED PROTEASES AND INHIBITORS IN HUMAN EPIDERMAL KERATINOCYTES (HEK): DEVELOPMENT OF ANTIVESICANT DRUGS Xiannu Jin 1, Radharaman Ray 2, Guang Xu 1 and Prabhati Ray 1 1 Department

More information

SUPPLEMENTARY LEGENDS...

SUPPLEMENTARY LEGENDS... TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE

More information

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis

More information

GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin

GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin Supplementary Fig. 1 a CQ treatment ScrB OGX11 MG132 I II AZD5363 I II b GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin ctrl CQ GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin rapamycin rapamycincq

More information

Immunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on

Immunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on Supplemental Methods Immunohistochemical Analyses Immunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on prostatectomy sections obtained post-study. Briefly,

More information

Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A)

Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A) Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A) Cells over-expressing hfgfr1-pcdna3 (+) or pcdna3 (-) were stimulated for 10 minutes with 50ng/ml FGF2 and lysates immunoblotted

More information

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-10-1-0246 TITLE: Therapeutic Value of PLK1 Knockdown in Combination with Prostate Cancer Drugs in PIM-1 Overexpressing Prostate Cancer Cells PRINCIPAL INVESTIGATOR: Meejeon Roh,

More information

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis

More information

Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC

Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC Supplementary Figure 1. SOD1 activity is significantly increased relative to SOD1 levels. SOD1 and SOD2 activities in the infected mork13 cells are shown normalised to their corresponding levels and relative

More information

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya

More information

Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury

Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada

More information

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details

More information

Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after

Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after photoconversion by using H2B-Dendra2. 4-5 PPs of H2B-Dendra2 BM chimeras were photoconverted and analyzed 7 days (upper panel)

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES

More information

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

More information

Supplementary Material

Supplementary Material Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Figure S1 Induction of non-apoptotic death of SV40-transformed and primary DKO MEFs, and DKO thymocytes. (A-F) STS-induced non-apoptotic death of DKO MEF. (A, B) Reduced viability of DKO MEFs after exposure

More information