The Role of CCR9 and Melanoma Metastasis to Small Intestine. Farin Amersi, MD Samuel Oschin Comprehensive Cancer Center Cedar Sinai Medical Center
|
|
- Jayson Flynn
- 6 years ago
- Views:
Transcription
1 The Role of CCR9 and Melanoma Metastasis to Small Intestine Farin Amersi, MD Samuel Oschin Comprehensive Cancer Center Cedar Sinai Medical Center
2 BACKGROUND Melanoma is the fifth most common cancer. Estimated that 67,190 cases (5% cancer cases) will be diagnosed this year. (Am. Cancer Soc, 2007) Postmortem specimens 50-60% metastases to GI tract
3 BACKGROUND Melanoma metastatic to GI tract in only % of all pts 1/3 of all metastatic disease of the GI tract is from melanoma Postmortem specimens 50-60% metastases to GI tract
4
5 CHEMOKINES -RECEPTORS
6
7 Chemokines and their receptors determine the metastatic destination of tumor cells. Final distribution of metastases reflects relative abundance of chemokines in different organs Neutralizing the interaction of chemokines and their receptors impairs metastasis of cancer cells
8 THE MECHANISM DETERMINING THE DIRECTIONAL MIGRATION AND INVASION OF MELANOMA CELLS INTO SPECIFIC ORGANS IN THE GASTROINTESTINAL TRACT NEEDS TO BE ESTABLISHED
9 OVERVIEW BACKGROUND HYPOTHESIS METHODS RESULTS PLANNED STUDIES
10 TECK / CCL25 Thymus expressed chemokine (TECK) initially reported to be expressed by thymic cells TECK expression recently localized to epithelium of small intestine but not colon or stomach CCR9 is the only known receptor for TECK; expressed at high levels by CD4+ and CD8+ lymphocytes in small bowel
11 Zabel et al, JEM 1999, 190(9):
12 The Role of Thymus-Expressed Chemokine and its Receptor CCR9 on Lymphocytes in the Regional Specialization of the Mucosal Immune System K. Papadakis,, J. Prehn,, V. Nelson, A. Cheng, S.W. Binder, P.D. Ponath,, D.P. Andrew, and S.T. Targan Journal of Immunology, 2000; 165(9):
13
14
15 CCR9 and Immune Diseases In PBL, CCR9+ lymphocytes markedly elevated in small bowel Crohn s,, but not in pure colonic Crohn s TECK expression intensely expressed in small bowel but was not expressed in either normal or inflamed colon. Gastroenterology, 2001; 121:
16 QUESTIONS Is CCR9 expressed in melanoma cell lines generated from metastases to the small intestine Are there differences in CCR9 expression in melanoma cell lines derived from small intestinal metastases when compared to cell lines derived from metastases to other GI organs
17 QUESTIONS If CCR9 is expressed only in melanoma cell lines derived from small intestinal metastases, will these findings correlate with our analysis using paraffin embedded tissue. Is CCR9 expressed in the primary or regional lymph nodes
18 QUESTIONS If CCR9 is expressed only in small intestinal metastases, will these findings correlate with overall survival If CCR9 is expressed in the primary tumor or lymph nodes, can it be utilized as a prognostic indicator for future metastatic progression
19 HYPOTHESIS CCR9 is expressed in melanoma cell lines derived from small bowel Melanoma cells that express CCR9 functionally, respond to TECK in a manner that facilitates metastases of these cells from the primary site or lymph nodes to small bowel
20 METHODS: CELL LINES RNA extraction Reverse transcription Real Time PCR Cell migration/invasion assay
21 CELL LINES Eight cell lines from melanoma metastasis to small bowel from JWCI tissue repository Fifteen cell lines from melanoma metastasis to other distant organs Liver- 4 Pancreas-1 Lung- 3 Adrenal- 2 Kidney- 2 Colon- 2 Gastric- 1
22 RESULTS CCR9 expressed in 8/8 (100%) small bowel cell lines CCR9 not expressed in 15/15 metastatic cell lines to other distant organs
23 CCR9/GAPDH mrna CCR9 Expression FL UK PC DM MG HC MP SJ MOLT4 SMALL BOWEL MELANOMA CELL LINES
24 CCR9 Expression CCR9/GAPDH mrna liver adrenal colon kidney pancreas stomach small bowel Cell lines lung MOLT
25 Further Studies Complete analysis of paraffin specimens from small bowel metastasis/distant organs Validate CCR9 Expression by flow cytometry TECK expression in paraffin tissue from small bowel metastasis/distant organs Immunohistochemistry Migration/Invasion Assay in SB cell lines
26 METHODS PARAFFIN EMBEDDED TISSSUE 198 STAGE 4 MELANOMA PATIENTS Small bowel resections - 96 Surgical resection to other distant sites 23 STAGE 1 PRIMARY MELANOMA PATIENTS - 7 matched pairs to stage IV pts with small bowel metastasis - 16 stage 1 primary
Functional CCR9 Expression Is Associated with Small Intestinal Metastasis
Functional CCR9 Expression Is Associated with Small Intestinal Metastasis Anne Letsch, Ulrich Keilholz, Dirk Schadendorf,w Geraldine Assfalg, Anne Marie Asemissen, Eckhard Thiel, and Carmen Scheibenbogen
More informationIMPC phenotyping SOPs in JMC
IMPC phenotyping SOPs in JMC Tissue Embedding and Block Banking IMPC_BLK_001 Purpose Collect and fix a standard list of tissues from the complete necropsy (see IMPC Gross Pathology & Tissue Collection
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationCharacteristics, treatment patterns, and survival outcomes of primary GI melanoma cases compared to cutaneous melanoma, SEER:
Characteristics, treatment patterns, and survival outcomes of primary GI melanoma cases compared to cutaneous melanoma, SEER:1973-2015 Amanda Kahl, MPH Mary E. Charlton, PhD, Imran Hassan, MD, Paolo Goffredo,
More informationMEDICAL POLICY Gene Expression Profiling for Cancers of Unknown Primary Site
POLICY: PG0364 ORIGINAL EFFECTIVE: 04/22/16 LAST REVIEW: 07/26/18 MEDICAL POLICY Gene Expression Profiling for Cancers of Unknown Primary Site GUIDELINES This policy does not certify benefits or authorization
More informationcame from a carcinoma and in 12 from a sarcoma. Ninety lesions were intrapulmonary and the as the chest wall and pleura. Details of the primary
Thorax 1982;37:366-370 Thoracic metastases MARY P SHEPHERD From the Thoracic Surgical Unit, Harefield Hospital, Harefield ABSTRACI One hundred and four patients are reviewed who were found to have thoracic
More informationGreater Manchester and Cheshire HPB Unit Guidelines for the Assessment & Management of Hepatobiliary and Pancreatic Disease Chapter 14
Greater Manchester and Cheshire HPB Unit Guidelines for the Assessment & Management of Hepatobiliary and Pancreatic Disease Chapter 14 Contents 14. Neuroendocrine Tumours 161 14.1. Diagnostic algorithm
More informationcategory cm0. Category will ensure it T1 melanoma. 68 Retinoblastoma
AJCC 8 th Edition Chapter 1 Principles of Cancer Staging: Node Status Not Required in Rare Circumstances Clinical Staging, cn Category For some cancer sites in which lymph node involvement is rare, patients
More informationGastric Cancer Histopathology Reporting Proforma
Gastric Cancer Histopathology Reporting Proforma Mandatory questions (i.e. protocol standards) are in bold (e.g. S1.01). S1.01 Identification Family name Given name(s) Date of birth Sex Male Female Intersex/indeterminate
More informationMelanoma gene expression profiles to identify mechanisms of tumor resistance
Melanoma gene expression profiles to identify mechanisms of tumor resistance Helena Harlin Human Immunologic Monitoring Facility University of Chicago Introduction High frequencies of melanoma antigen-specific
More informationAJCC 7th Edition Handbook Errata as of 9/21/10
5 81 Larynx ICD-O-3 Topography Codes Delete C32.3 Laryngeal cartilage 5 81 Larynx ICD-O-3 Topography Codes Add an asterisk after C32.8 5 81 Larynx ICD-O-3 Topography Codes Add an asterisk after C32.9 5
More informationSupplemental materials
Supplemental materials 1 Supplemental Fig. 1 Immunogram This immunogram summarizes patient clinical data and immune parameters at corresponding time points for Patient IMF-32. The top panel illustrates
More informationCarcinoembryonic Antigen
Other Names/Abbreviations CEA 190.26 - Carcinoembryonic Antigen Carcinoembryonic antigen (CEA) is a protein polysaccharide found in some carcinomas. It is effective as a biochemical marker for monitoring
More informationCommonly Encountered Neuro-Endocrine Tumors of the Gut
Commonly Encountered Neuro-Endocrine Tumors of the Gut Moderators: Giuseppe Aliperti, MD Steven Edmundowicz, MD Panelists Douglas O. Faigel, MD Professor of Medicine Department of Gastroenterology Oregon
More informationDIVISION OF GASTROENTEROLOGY
DR. Lloyd Mayer T H E H E N R Y D. J A N O W I T Z DIVISION OF GASTROENTEROLOGY Mount Sinai is consistently ranked among the top five gastroenterology centers in the nation. The irresistible combination
More informationWendy L Frankel. Chair and Distinguished Professor
1 Wendy L Frankel Chair and Distinguished Professor Case 1 59 y/o woman Abdominal pain No personal or family history of cancer History of colon polyps Colonoscopy Polypoid rectosigmoid mass Biopsy 3 4
More informationCASE DISCUSSION ON GASTRIC CANCER BASED ON ESMO GUIDELINES
ESMO Preceptorship GI Tumours Singapore 20-22 nd October CASE DISCUSSION ON GASTRIC CANCER BASED ON ESMO GUIDELINES Professor. J-Y. Douillard MD PhD ESMO Chief Medical Officer CLINICAL PRACTICE GUIDELINES
More information5/8/2014. AJCC Stage Introduction and General Rules. Acknowledgements* Introduction. Melissa Pearson, CTR North Carolina Central Cancer Registry
AJCC Stage Introduction and General Rules Linda Mulvihill Public Health Advisor NCRA Annual Meeting May 2014 National Center for Chronic Disease Prevention and Health Promotion Division of Cancer Prevention
More informationHistological and immunological characteristics of colitis associated with anti-ctla 4 antibody therapy
Histological and immunological characteristics of colitis associated with anti-ctla 4 antibody therapy M. Perdiki 2, G. Bamias 1, D. Pouloudi 2, H. Gogas 3, I. Delladetsima 2 1 Academic Dpt. of Gastroenterology,
More informationSurgical Issues in Melanoma
Surgical Issues in Melanoma Mark B. Faries, MD, FACS Director, Donald L. Morton Melanoma Research Program Director, Surgical Oncology Training Program Professor of Surgery John Wayne Cancer Institute Surgical
More informationMacmillan Publications
S1 S2 S3 S3 S3 S4 S5 S6 S7 S8 S8 S9 S10 S11 S11 S12 S13 S14 S15 S17 S18 S19 Bladder Cancer: Non-Invasive, Invasive and Advanced Bone Cancer: Primary, Secondary Colon Cancer, Anal Cancer, Rectal Cancer
More informationGreater Manchester & Cheshire Guidelines for Pathology Reporting for Oesophageal and Gastric Malignancy
Greater Manchester & Cheshire Guidelines for Pathology Reporting for Oesophageal and Gastric Malignancy Authors: Dr Gordon Armstrong, Dr Sue Pritchard 1. General Comments 1.1 Cancer reporting: Biopsies
More informationPancreatic Adenocarcinoma: What`s hot
Pancreatic Adenocarcinoma: What`s hot Eva Karamitopoulou-Diamantis Institute of Pathology University of Bern 11.09.2018, 30th ECP, Bilbao Pancreatic Cancer and the Microbiome The Pancreatic Cancer Microbiome
More informationHigh expression of fibroblast activation protein is an adverse prognosticator in gastric cancer.
Biomedical Research 2017; 28 (18): 7779-7783 ISSN 0970-938X www.biomedres.info High expression of fibroblast activation protein is an adverse prognosticator in gastric cancer. Hu Song 1, Qi-yu Liu 2, Zhi-wei
More informationGastroenterology Tutorial
Gastroenterology Tutorial Gastritis Poorly defined term that refers to inflammation of the stomach. Infection with H. pylori is the most common cause of gastritis. Most patients remain asymptomatic Some
More informationLiver Cancer. Su Jong Yu, M.D. Department of Internal Medicine, Liver Research Institute, Seoul National University College of Medicine
Liver Cancer Su Jong Yu, M.D. Department of Internal Medicine, Liver Research Institute, Seoul National University College of Medicine Primary Liver Cancer Hepatocellular carcinoma (HCC) : > 80% Derived
More informationCOLORECTAL CANCER CASES
COLORECTAL CANCER CASES Case #1 Case #2 Colorectal Cancer Case 1 A 52 year-old female attends her family physician for her yearly complete physical examination. Her past medical history is significant
More informationCancers of unknown primary : Knowing the unknown. Prof. Ahmed Hossain Professor of Medicine SSMC
Cancers of unknown primary : Knowing the unknown Prof. Ahmed Hossain Professor of Medicine SSMC Definition Cancers of unknown primary site (CUPs) Represent a heterogeneous group of metastatic tumours,
More informationSurgical Management of Neuroendocrine Tumors of the Gut. Richard Hodin MD Professor of Surgery Massachusetts General Hospital Harvard Medical School
Surgical Management of Neuroendocrine Tumors of the Gut Richard Hodin MD Professor of Surgery Massachusetts General Hospital Harvard Medical School Sites of GI Carcinoid Tumors Small intestine 44% Rectum
More informationT of patients with malignant melanoma
~~ RADIOGRAPHIC: EVALUATION OF METASTATIC MELANOMA JACK E. MEYER, MD*+$ Malignant melanoma can potentially involve any organ system in the body once it metastasizes beyond the regional lymph nodes. A survey
More informationMetastatic Colorectal Cancer
Helpful Information for People With Metastatic Colorectal Cancer and Their Families What you should know about Metastatic Colorectal Cancer Learning the basics of metastatic colorectal cancer If you or
More informationGastrointestinal Neuroendocrine Tumors: A Closer Look at the Characteristics of These Diverse Tumors
Gastrointestinal Neuroendocrine Tumors: A Closer Look at the Characteristics of These Diverse Tumors Jaume Capdevila, MD, PhD Vall d'hebron University Hospital Vall d'hebron Institute of Oncology (VHIO)
More informationQuiz Adenocarcinoma of the distal stomach has been increasing in the last 20 years. a. True b. False
Quiz 1 1. Which of the following are risk factors for esophagus cancer. a. Obesity b. Gastroesophageal reflux c. Smoking and Alcohol d. All of the above 2. Adenocarcinoma of the distal stomach has been
More informationSMALL BOWEL ADENOCARCINOMA. Dr. C. Jeske
SMALL BOWEL ADENOCARCINOMA Dr. C. Jeske Case presentation 54 year old female. Presents with OJ and weight loss. Abdominal examination only reveals a palpable gallbladder. ERCP reveals a circumferential
More informationSurgical Therapy of GEP-NET: An Overview
Surgical Therapy of GEP-NET: An Overview Pierce K.H Chow MBBS, MMed, FRCSE, FAMS, PhD Professor, Duke-NUS Graduate School of Medicine Senior Consultant Surgeon, Singapore General Hospital Visiting Senior
More informationStaging for Residents, Nurses, and Multidisciplinary Health Care Team
Staging for Residents, Nurses, and Multidisciplinary Health Care Team Donna M. Gress, RHIT, CTR Validating science. Improving patient care. Learning Objectives Introduce the concept and history of stage
More informationSpecies Tumor Type Comment for in vivo work Lead Time for in vivo studies [weeks] MB-49-luc-2 Mouse urinary bladder carcinoma C57BL/6 2
America, Hershey, PA Australia, Melbourne, VIC Europe, Munich info@vivopharm.com www.vivopharm.com Tissue Bladder Species Tumor Type Comment for in vivo work Lead Time for in vivo studies [weeks] MB-49-luc-
More informationEndoscopic Ultrasonography Assessment for Ampullary and Bile Duct Malignancy
Diagnostic and Therapeutic Endoscopy, Vol. 3, pp. 35-40 Reprints available directly from the publisher Photocopying permitted by license only (C) 1996 OPA (Overseas Publishers Association) Amsterdam B.V.
More informationImages In Gastroenterology
Images In Gastroenterology Thong-Ngam D, et al. THAI J GASTROENTEROL 2005 Vol. 6 No. 2 May - Aug. 2005 105 Imaging of Gastrointestinal Stromal Tumors Pornpim Fuangtharnthip, M.D. Narumol Hargroove, M.D.
More informationOFCCR CLINICAL DIAGNOSIS AND TREATMENT FORM
OFCCR CLINICAL DIAGNOSIS AND TREATMENT FORM Name: _, OFCCR # _ OCGN # _ OCR Group # _ HIN# Sex: MALE FEMALE UNKNOWN Date of Birth: DD MMM YYYY BASELINE DIAGNOSIS & TREATMENT 1. Place of Diagnosis: Name
More informationSmall Intestine. Protocol revision date: January 2005 Based on AJCC/UICC TNM, 6 th edition
Small Intestine Protocol applies to all invasive carcinomas of the small intestine, including those with focal endocrine differentiation. Excludes carcinoid tumors, lymphomas, and stromal tumors (sarcomas).
More informationBirthday: 1952/07/31 Date of admission:1999/12/30 Age:48 y/o Past medication:esrd under regular HD for 5+ years; denied DM and HTN
Birthday: 1952/07/31 Date of admission:1999/12/30 Age:48 y/o Past medication:esrd under regular HD for 5+ years; denied DM and HTN Chief Complaint : 1)intermittent LLQ cramping pain for 2 months 2) LGI
More informationAdenocarcinoma of gastro-esophageal junction - Case report
Case Report denocarcinoma of gastro-esophageal junction - Case report nupsingh Dhakre 1*, Ibethoi Yengkhom 2, Harshin Nagori 1, nup Kurele 1, Shreedevi. Patel 3 1 2 nd year Resident, 2 3rd year Resident,
More informationNET und NEC. Endoscopic and oncologic therapy
NET und NEC Endoscopic and oncologic therapy Classification well-differentiated NET - G1 and G2 - carcinoid poorly-differentiated NEC - G3 - like SCLC well differentiated NET G3 -> elevated proliferation
More informationMetastatic Colorectal Cancer
Helpful Information for People With Metastatic Colorectal Cancer and Their Families WHAT YOU SHOULD KNOW ABOUT Metastatic Colorectal Cancer Learning the basics of metastatic colorectal cancer If you or
More informationA LEADER IN ADVANCED ENDOSCOPY AND HEPATOBILIARY SURGERY
A LEADER IN ADVANCED ENDOSCOPY AND HEPATOBILIARY SURGERY St. Peter s Hospital Advanced Endoscopy & Hepatobiliary Center Welcome The St. Peter s Hospital Advanced Endoscopy & Hepatobiliary Center is a leader
More informationHistopathology of Endoscopic Resection Specimens from Barrett's Esophagus
Histopathology of Endoscopic Resection Specimens from Barrett's Esophagus Br J Surg 38 oct. 1950 Definition of Barrett's esophagus A change in the esophageal epithelium of any length that can be recognized
More informationCase Scenario year-old white male presented to personal physician with dyspepsia with reflux.
Case Scenario 1 57-year-old white male presented to personal physician with dyspepsia with reflux. 7/12 EGD: In the gastroesophageal junction we found an exophytic tumor. The tumor occupies approximately
More informationCODING STAGE: TNM AND OTHER STAGING SYSTEMS. Liesbet Van Eycken Otto Visser
CODING STAGE: TNM AND OTHER STAGING SYSTEMS Liesbet Van Eycken Otto Visser OVERVIEW PART I Introduction What is stage? Why stage? History and publications of TNM Classification Clinical and pathologic
More informationGenetic Testing: When should it be ordered? Julie Schloemer, MD Dermatology
Genetic Testing: When should it be ordered? Julie Schloemer, MD Dermatology Outline Germline testing CDKN2A BRCA2 BAP1 Somatic testing Gene expression profiling (GEP) BRAF Germline vs Somatic testing
More informationEarlyoesophagealcancer. dr. Nina Zidar Institute of Pathology Faculty ofmedicine University of Ljubljana Slovenia
Earlyoesophagealcancer dr. Nina Zidar Institute of Pathology Faculty ofmedicine University of Ljubljana Slovenia Early carcinoma of oesophagus = tumor limited to mucosa or submucosa, not extending into
More informationLatest Press Release. woman roasted over fireoman roasted
corp@stantec.com Latest Press Release woman roasted over fireoman roasted S So, if your cancer started in your lung and has spread to your bones, the areas of cancer in the bone are made up of lung cancer
More informationThe Immune System: The Mind Body Connection. Presented by Margaret Kemeny, Ph.D. Department of Psychiatry, University of California, San Francisco
The Immune System: The Mind Body Connection Presented by Margaret Kemeny, Ph.D. Department of Psychiatry, University of California, San Francisco Psychoneuroimmunology Investigation of the bidirectional
More informationSAM PROVIDER TOOLKIT
THE AMERICAN BOARD OF PATHOLOGY Maintenance of Certification (MOC) Program SAM PROVIDER TOOLKIT Developing Self-Assessment Modules (SAMs) www.abpath.org The American Board of Pathology (ABP) approves educational
More informationRegistrar s Guide to Chapter 1, AJCC Seventh Edition. Overview. Learning Objectives. Describe intent and purpose of AJCC staging
Registrar s Guide to Donna M. Gress, RHIT, CTR Validating science. Improving patient care. This presentation was supported by the Cooperative Agreement Number DP13-1310 from The Centers for Disease Control
More informationCS 6824: Tissue-Based Map of the Human Proteome
CS 6824: Tissue-Based Map of the Human Proteome T. M. Murali November 17, 2016 Human Protein Atlas Measure protein and gene expression using tissue microarrays and deep sequencing, respectively. Alternative
More informationAnaplastic A term used to describe cancer cells that divide rapidly and have little or no resemblance to normal cells.
Oncology Terminology A Adenocarcinoma A cancerous tumor that arises in or resembles glandular tissue. Adjunct agent In cancer therapy, a drug or substance used in addition to the primary therapy. Adjuvant
More informationis time consuming and expensive. An intra-operative assessment is not going to be helpful if there is no more tissue that can be taken to improve the
My name is Barry Feig. I am a Professor of Surgical Oncology at The University of Texas MD Anderson Cancer Center in Houston, Texas. I am going to talk to you today about the role for surgery in the treatment
More informationImaging in gastric cancer
Imaging in gastric cancer Gastric cancer remains a deadly disease because of late diagnosis. Adenocarcinoma represents 90% of malignant tumors. Diagnosis is based on endoscopic examination with biopsies.
More informationperformed to help sway the clinician in what the appropriate diagnosis is, which can substantially alter the treatment of management.
Hello, I am Maura Polansky at the University of Texas MD Anderson Cancer Center. I am a Physician Assistant in the Department of Gastrointestinal Medical Oncology and the Program Director for Physician
More informationGreater Manchester & Cheshire Guidelines for Pathology Reporting of Oesophageal and Gastric Malignancy
Greater Manchester & Cheshire Guidelines for Pathology Reporting of Oesophageal and Gastric Malignancy Authors: Dr Stephen Hayes, Dr David Bisset, Dr Gordon Armstrong, Dr Sue Pritchard 1. General Comments
More informationCANCER REPORTING IN CALIFORNIA: ABSTRACTING AND CODING PROCEDURES California Cancer Reporting System Standards, Volume I
CANCER REPORTING IN CALIFORNIA: ABSTRACTING AND CODING PROCEDURES California Cancer Reporting System Standards, Volume I Changes and Clarifications 16 th Edition April 15, 2016 Quick Look- Updates to Volume
More informationDefinition of Synoptic Reporting
Definition of Synoptic Reporting The CAP has developed this list of specific features that define synoptic reporting formatting: 1. All required cancer data from an applicable cancer protocol that are
More informationProsigna BREAST CANCER PROGNOSTIC GENE SIGNATURE ASSAY
Prosigna BREAST CANCER PROGNOSTIC GENE SIGNATURE ASSAY Methodology The test is based on the reported 50-gene classifier algorithm originally named PAM50 and is performed on the ncounter Dx Analysis System
More informationProsigna BREAST CANCER PROGNOSTIC GENE SIGNATURE ASSAY
Prosigna BREAST CANCER PROGNOSTIC GENE SIGNATURE ASSAY GENE EXPRESSION PROFILING WITH PROSIGNA What is Prosigna? Prosigna Breast Cancer Prognostic Gene Signature Assay is an FDA-approved assay which provides
More informationGASTROINTESTINAL METASTASES FROM LOBULAR BREAST CANCER
42. 1,. 1,. 2,. 2. 1 1, 2, GASTROINTESTINAL METASTASES FROM LOBULAR BREAST CANCER V. Gerova 1, L. Tankova 1, A. Mihova 2, I. Drandarsk 2 and H. Kadian 1 1 Clinic of Gastroenterology, University Hospital
More informationMultiorgan Resection (Including the Pancreas) for Metastasis of Cutaneous Malignant Melanoma
MULTIMEDIA ARTICLE - Clinical Imaging Multiorgan Resection (Including the Pancreas) for Metastasis of Cutaneous Malignant Melanoma Tibor Belágyi, Péter Zsoldos, Roland Makay, Ákos Issekutz, Attila Oláh
More informationImaging of Neuroendocrine Metastases
Imaging of Neuroendocrine Metastases Aoife Kilcoyne, Shaunagh McDermott, Colin McCarthy,Manuel Patino, Dushyant Sahani, Michael Blake Abdominal Imaging Division Massachusetts General Hospital Disclosure
More informationThe Lymphoid System Pearson Education, Inc.
23 The Lymphoid System Introduction The lymphoid system consists of: Lymph Lymphatic vessels Lymphoid organs An Overview of the Lymphoid System Lymph consists of: Interstitial fluid Lymphocytes Macrophages
More informationStudy of expression of P53 in Gastric Carcinoma As a prognostic indicator
Original Research Article Study of expression of P53 in Gastric Carcinoma As a prognostic indicator K. Padma Malini 1*, Srivani 2, O. Shravan Kumar 3 1 Assistant Professor, 2 Associate Professor, 3 Professor
More informationGastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR
Gastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR Pages with reference to book, From 305 To 307 Irshad N. Soomro,Samina Noorali,Syed Abdul Aziz,Suhail Muzaffar,Shahid
More informationApplications of IHC. Determination of the primary site in metastatic tumors of unknown origin
Applications of IHC Determination of the primary site in metastatic tumors of unknown origin Classification of tumors that appear 'undifferentiated' by standard light microscopy Precise classification
More informationComprehensive cancer cover
Retirement Investments Insurance Health Comprehensive cancer cover Life Insurance+ with critical illness and Critical Illness+ Cancer is one of the biggest fears for the British public This is why our
More informationANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
More informationUnexpected Findings at Endoscopy
The Endoscopic Incidentaloma: What to Tell Your Patient t with Unexpected Endoscopic Findings: Gastric Intestinal Metaplasia, Silent Ileitis, Carcinoid David Greenwald, MD Montefiore Medical Center Albert
More informationTargeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018
Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,
More informationRegression of Advanced Gastric MALT Lymphoma after the Eradication of Helicobacter pylori
Gut and Liver, Vol. 6, No. 2, April 2012, pp. 270-274 CASE REPORT Regression of Advanced Gastric MALT Lymphoma after the Eradication of Helicobacter pylori Soo-Kyung Park, Hwoon-Yong Jung, Do Hoon Kim,
More informationGastrinoma: Medical Management. Haley Gallup
Gastrinoma: Medical Management Haley Gallup Also known as When to put your knife down Gastrinoma Definition and History Diagnosis Historic Management Sporadic vs MEN-1 Defining surgical candidates Nonsurgical
More information1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications
Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the
More informationMedical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University
Medical Virology Immunology Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Human blood cells Phases of immune responses Microbe Naïve
More informationComprehensive cancer cover
Retirement Investments Insurance Health Comprehensive cancer cover Life Insurance+ with critical illness and Critical Illness+ Cancer is one of the biggest fears for the British public This is why our
More informationCLINICAL EFFECTIVENESS
Re-audit of gastrointestinal tract specimens with respect to compliance with RCPath guidelines Dr Manisha Ram Dr Moina Kadri Background epidemiology and aetiology Over the past 20 years there has been
More informationPeritoneal Involvement in Stage II Colon Cancer
Anatomic Pathology / PERITONEAL INVOLVEMENT IN STAGE II COLON CANCER Peritoneal Involvement in Stage II Colon Cancer A.M. Lennon, MB, MRCPI, H.E. Mulcahy, MD, MRCPI, J.M.P. Hyland, MCh, FRCS, FRCSI, C.
More informationOncology General Principles L A U R I E S I M A R D B R E A S T S U R G I C A L O N C O L O G Y F E L L O W D E C E M B E R
Oncology General Principles L A U R I E S I M A R D B R E A S T S U R G I C A L O N C O L O G Y F E L L O W D E C E M B E R 2 0 1 2 Objectives Discuss Diagnostic and staging strategies in oncology Know
More informationStage 4 gastric adenocarcinoma icd 10
> Stage 4 gastric adenocarcinoma icd 10 stage iii; Carcinoma of colon, stage iv; Colon cancer metastatic to unspecified site; Hereditary nonpolyposis colon cancer; Malignant tumor of colon; Metastasis.
More informationCD4+ T Helper T Cells, and their Cytokines in Immune Defense and Disease
CD4+ T Helper T Cells, and their Cytokines in Immune Defense and Disease Andrew Lichtman M.D., Ph.D. Brigham and Women s Hospital Harvard Medical School Lecture outline Intro to T cell mediated immunity
More informationNeoplasia part I. Dr. Mohsen Dashti. Clinical Medicine & Pathology nd Lecture
Neoplasia part I By Dr. Mohsen Dashti Clinical Medicine & Pathology 316 2 nd Lecture Lecture outline Review of structure & function. Basic definitions. Classification of neoplasms. Morphologic features.
More informationSCOPE OF PRACTICE PGY-5
Recognize normal cytomorphology of cells derived from the respiratory, gastrointestinal, and genitourinary tracts, and body fluid (Cerebrospinal fluid, pleural and peritoneal fluid) Recognize normal cytomorphology
More informationValidation of QClamp as Next Generation Liquid Biopsy Technique for Colorectal Cancer He James Zhu M.D. Ph.D
Validation of QClamp as Next Generation Liquid Biopsy Technique for Colorectal Cancer He James Zhu M.D. Ph.D Department of Radiation Oncology University of Florida College of Medicine Outline Objective
More informationCorporate Medical Policy
Corporate Medical Policy Microarray-based Gene Expression Testing for Cancers of Unknown File Name: Origination: Last CAP Review: Next CAP Review: Last Review: microarray-based_gene_expression_testing_for_cancers_of_unknown_primary
More informationAn epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
More information1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?
1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature09626 Suppl. Table 1. Sequencing primers. B-RAF Forward Reverse Exon1 CGGCGACTTCTCGTCGTCTC CTGCATGACGGAGAGGGACA Exon2 CTGGCAGTTACTGTGATGTAGTTG CTTCCCAAATCTATTCCTAATCCCACC Exon3 GGACCATCTAGATATCACATATG
More informationAnimal Models to Understand Immunity
Animal Models to Understand Immunity Hussein El Saghire hesaghir@sckcen.be Innate Adaptive immunity Immunity MAPK and NF-kB TLR pathways receptors Fast Slow Non-specific Specific NOD-like receptors T-cell
More information2014 International Journal of Medical Science Research and Practice available on
International Journal of Medical Science Research and Practice available on www.ijmsrp.com INTERNATIONAL JOURNAL OF MEDICAL SCIENCE RESEARCH AND PRACTICE Print ISSN: 349-3178 Online ISSN: 349-3186 UNIT
More informationNeuroendocrine Tumors
Neuroendocrine Tumors Neuroendocrine tumors arise from cells that release a hormone in response to a signal from the nervous system. Neuro refers to the nervous system. Endocrine refers to the hormones.
More informationClinicopathologic Spectrum of Gastrointestinal Stromal Tumours; Six Years Experience at King Hussein Medical Center
Clinicopathologic Spectrum of Gastrointestinal Stromal Tumours; Six Years Experience at King Hussein Medical Center Sahem T. Alqusous MD*, Osama J. Rabadi MD, MRCS*, Ala D. Al Omari MD*, Nabeeha N.Abbasi
More informationCOLORECTAL CARCINOMA
QUICK REFERENCE FOR HEALTHCARE PROVIDERS MANAGEMENT OF COLORECTAL CARCINOMA Ministry of Health Malaysia Malaysian Society of Colorectal Surgeons Malaysian Society of Gastroenterology & Hepatology Malaysian
More informationModulation of upa, MMPs and their inhibitors by a novel nutrient mixture in human colorectal, pancreatic and hepatic carcinoma cell lines
Modulation of upa, MMPs and their inhibitors by a novel nutrient mixture in human colorectal, pancreatic and hepatic carcinoma cell lines Publication from the Dr. Rath Research Institute International
More information