The study of the oipa and dupa genes in Helicobacter pylori strains and their relationship with different gastroduodenal diseases
|
|
- Lionel Campbell
- 3 years ago
- Views:
Transcription
1 Gastroenterology and Hepatology From Bed to Bench RIGLD, Research Institute for Gastroenterology and Liver Diseases ORIGINAL ARTICLE The study of the oipa and dupa genes in Helicobacter pylori strains and their relationship with different gastroduodenal diseases Negar Souod 1, Meysam Sarshar 2, Hossein Dabiri 3, Hassan Momtaz 4, Mohammad Kargar 5, Alireza Mohammadzadeh 6, Saeed Abdi 7 1 Young Researchers club, Central Tehran Branch, Islamic Azad University, Tehran, Iran 2 Department of Public Health and Infectious Diseases, Sapienza, University of Rome, Rome, Italy 3 Department of Clinical Microbiology, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran 4 Department of Microbiology, ShahreKord Branch, Islamic Azad University, ShahreKord, Iran 5 Department of Microbiology, Jahrom Branch, Islamic Azad University, Jahrom, Iran 6 Department of Microbiology, School of Medicine, Gonabad University of Medical Sciences, Gonabad, Iran 7 Gastroenterology and Liver Diseases Research Centre, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran Iran ABSTRACT Aim: The purpose of this investigation was to determine the oipa and dupa genes of Helicobacter pylori isolates from west of Iran; Chaharmahalo Bakhtiyari region and find their relationship with the severity of the gastroduodenal diseases. Background: Helicobacter pylori is an organism responsible for many gastroduodenal diseases. Many studies suggest that genetic diversity in H. pylori virulence factors such as oipa and dupa genes is high among isolates of different geographic regions and may cause more severe diseases. Patients and methods: In this cross-sectional study, gastric biopsy specimens were taken from 150 patients suffering from gastroduodenal diseases. The presence of urec, dupa and oipa genes was tested by polymerase chain reaction (PCR). Results: Overall, 123 (82%) H. pylori strains were isolated from 150 specimens. dupa gene was detected in 41 (33.33%) H.pylori-positive specimens. There was a reverse correlation between this gene and gastric cancer. The oipa gene was found in 88 (71.54%) samples and statistically there was no association between this gene and gastric disorders. As statistical analyses revealed, the presence of the dupa was more common in isolates with the oipa negative. Conclusion: Based on our findings, the presence of dupa gene can be considered as a marker for the onset of severe diseases. However, the oipa gene cannot be regarded for prediction of gastroenterology diseases. Meanwhile, extended molecular epidemiology researches in other populations are recommended. Keywords: Helicobacter pylori, oipa, dupa, PCR, Gastric disorders. (Please cite as: Souod N, Sarshar M, Dabiri H, Momtaz M, Kargar M, Mohammadzadeh A, et al. The study of the oipa and dupa genes in Helicobacter pylori strains and their relationship with different gastroduodenal diseases. ). Introduction 1 Helicobacter pylori is a major cause of chronic gastritis and involved in the pathogenesis of Received: 21 March 2015 Accepted: 29 May 2015 Reprint or Correspondence: Saeed Abdi, MD. Gastroenterology and Liver Diseases Research Center, Research Institute for Gastroenterology and Liver Diseases, Shahid Beheshti University of Medical Sciences, Tehran Iran. several diseases like gastric and duodenal ulcer, gastric adenocarcinoma, and mucosa-associated lymphoid tissue lymphoma (1-3). This bacterium has several virulence factors which are generally classified into three categories: The first group belongs to strain-specific genes, such as a cag pathogenicity island (PAI) and Plasticity Island
2 S48 Relationship between Helicobacter pylori strains and different gastroduodenal diseases genes (e.g. jhp0947 and dupa genes) which do not exist in all H. pylori strains. The second group consists of phase-variable genes whose gene status can be changed during growth or under different conditions. Six genes encoding outer-membrane proteins (babb, oipa, hopz saba, sabb and babc) are thought to undergo phase variation. The last group consists of genes with variable genotypes or structures depending on the strain. For instance, specific vaca genotypes containing different mosaic combinations of signal regions (s), middle region (m) and intermediate region (i) allelic types have been associated with different clinical outcomes (4). Reports on the clinical predictive value of putative virulence factor status and disease outcomes are controversial based on different geographic regions (5-8). On the other hand, these factors are not independent and are often closely linked (e.g., the cag PAI, vaca s1, and the baba2 gene) making it difficult to classify which factor(s) has the most important predictor role in diseases severity and clinical manifestations (9). Several studies have provided new insights into the role of several putative virulence factors of H. pylori in gastroduodenal pathogenesis. Recently, the duodenal ulcerpromoting gene (dupa), which encompassed both jhp0917 and jhp0918 and located in the plasticity region of H. pylori genome, was identified (10). Interestingly, the dupa gene is homologous to virb4, a gene encoding a component protein of the type IV secretion system (TFSS) in Agrobacterium tumefaciens (3). The jhp0917 and jhp0918, were examined by Lu et al. in 2005 and illustrated as a risk marker for prediction of duodenal ulcer disease and a protective factor against gastric cancer in strains isolated from Japan, Korea and Colombia (11). This continuous gene as a virulence marker was found to be more prevalent in patients with duodenal ulcer while was associated with a reduced risk for development of gastric atrophy and cancer in these populations (12, 13). In contrast, the dupa genotyping in some areas showed no association of this gene with duodenal ulcer, but suggested an association with gastric cancer (10, 14). The H. pylori outer inflammatory protein, OipA, is an important virulence factor which is associated with clinically important presentation of peptic ulcer, such as enhanced interleukin-8 secretion and increased inflammation (15). H. pylori contain either a functional or non-functional oipa gene. The functional status is regulated by the slipped strand repair mechanism based on the number of CT dinucleotide repeats in the 5ʹ region of the gene (9). Considering the high prevalence of H. pylori infection in Iranian population, there are several reports about common virulence markers such as vaca and caga, however there is very limited documents about dupa and oipa. The aim of our study was to assess the distribution of dupa and oipa genes in H. pylori strains isolated from patients with gastrointestinal disorders and to determine whether, these genes are associated with different clinical outcomes. Patients and Methods Sample Sampling was performed over a year (March 2010 to February 2011) from patients with gastroduodenal diseases referred to endoscopy centre of Hagar hospital of Shahrekord city in the west of Iran. Prior to sampling the questionnaire including medical history and demographic data were recorded for each patient. Informed consent form, declaring their willingness for the application of their anonymous data for research purpose was obtained from all studied patients prior to endoscopy. The protocol was approved by the ethical committee of Shahrekord University of Medical Science. Four gastric punch biopsy specimens from antrum of the stomach of each patient were collected; two for histopathology study, one for RUT test and the other for PCR.
3 Souod N. et al S49 Rapid Urease Test (RUT) One piece of each specimen was examined by Rapid Urease Test (RUT) for detection of H. pylori. Rapid urease test was performed with a Gastro urease kit (Bahar-Afshan Co, Tehran, Iran) according to manufacturer s instruction. Preparation of genomic DNA and polymerase chain reaction: A second piece from positive samples in RUT was used in PCR. DNA was extracted from biopsy specimens using a Genomic DNA purification kit (Qiagen, Hilden, Germany) according to manufacturer s recommendations. The 16S rrna gene was amplified to confirm the presence of the isolated H. pylori strains. According to table 1, HP-1 and HP-2 primers designed and verified previously for this aim (16, 17). For analyses of the presence of target genes ( dupa and oipa), H.pylori DNA was amplified using specific oligonucleotide primers (Table 1). Primers of jhp0917 and jhp0918 yielded fragments of approximately 307 and 276 bp, respectively. The primers of the oipa gene yielded a fragment of 401 bp. DNA samples from H. pylori (D0008; Genekam, Germany) were used as a positive control of 16S rrna, dupa and oipa genes, and sterile distilled water was used as a negative control. All PCR mixtures were prepared in a volume of 25 µl containing 1X PCR buffer, 0.4 µm of each primer, 0.3 U Taq DNA polymerase (CinnaGen Co., Tehran, Iran) and 300 ng DNA sample. The mixture placed in a thermocycler (Eppendrof Mastercycler 5330; Eppendorf-Nethel- Hinz GmbH, Hamburg, Germany), and PCR products were visualized by electrophoresis in 1.5% agarose gel, stained with ethidium bromide, and examined under ultraviolet illumination. Data analysis The data were analyzed using SPSS software (Version 17.SPSS Inc, USA) and p value was calculated using Chi-square and Fisher's exact tests to find any significant relationship. P values less than 0.05 were considered statistically significant. Histopathology During endoscopy two biopsy specimens were taken from the antrum for histological evaluation. These specimens were fixed in 10% buffered formalin, embedded in paraffin, cut into sequential 4μm sections and stained with hematoxylin and eosin (H&E) and modified Giemsa stain. Multiple high-powered fields were examined by two pathologists blinded to the characteristics of H.pylori strains. Results 150 patients with mean age of 46 ± 17 years, including 71 (47%) men and 79 (53%) women, were studied. Based on RUTs, 131(87%) of patients were H.pylori positive while according to PCR assays 123 (82%) specimens were confirmed to be H.pylori positive. The patients were Table 1. Primers used for PCR analysis of urec, dupa and oipa genes Gene Primer Primer sequence (5'-3') Size (bp) of PCR product 16S rrna HP-1 HP-2 jhp0917 (virb4) JHP917 (+) JHP917 (_) jhp0918 (virb4) JHP918 (+) JHP918 (_) oipa HPO638F HPO638R CTGGAGAGACTAAGCCCTCC ATTACTGACGCTGATTGTGC TGGTTTCTACTGACAGAGCGC AACACGCTGACAGGACAATCTCCC CCTATATCGCTAACGCGCGCTC AAGCTGAAGCGTTTGTAACG GTTTTTGATGCATGGGATTT GTGCATCTCTTATGGCTTT Reference
4 S50 Relationship between Helicobacter pylori strains and different gastroduodenal diseases Table 2. The frequency of the relationship between dupa and oipa genes and gastrointestinal diseases Gene Gastric Ulcer n=18 Duodenal Ulcer n=33 Gastric Cancer n=3 Gastritis n=120 Duodenit n=6 dupa 7(38.88%) 13(39.39%) 0(0.00%) 37(30.83) 2(33.33%) oipa 14(77.77%) 27(81.81%) 1(33.33%) 88(73.33) 4(66.66%) classified at the time of endoscopy and histopathology as having gastritis ulcers (n=18), Duodenal ulcer (n=33), Gastric cancer (n=2), gastritis (n=120), and duodenitis (n=6). It should be noted that (63%) of patients had several diseases together. Individuals had some clinical symptoms such as pain (n=112), vomiting (n=43), inappetence (n=25), Acid reflux (n=41), and flatulence (n=39). Demographic factors such as gender, education, occupation and gastric drug usage, did not show any statistical correlation with H. pylori infection and clinical outcomes (P>0.05). But smoking (P<0.0001) and age (P= 0.02) were significantly associated with H. pylori infection. In this study, dupa gene was detected in 41 (33.33%) specimens. As table 2 shows, there was no significant relationship between dupa status and duodenal ulcer disease (P=0.25). However, there was a converse relationship between dupanegative strains and gastric cancer disease (P=0.02). There was a considerable correlation between the presence of this gene and patient s age (P=0.007), smoking (P=0.04) and individuals who suffer flatulence (P=0.03). The oipa genotype was detected in 88 (71.54%) of H. pylori positive samples. This gene was in relation with the age groups of patients (P=0.007) and was more common in patients with gastritis rather than other groups (P=0.001). There was a close relationship between infection with oipa positive H. pylori and the presence of vomiting (P=0.009) and stomachache (P=0.03) regardless of clinical outcomes. As statistical analyses revealed, the presence of the dupa were more common in isolates with the oipa negative (P<0.0001). Discussion H. pylori infection is very common worldwide. It is estimated that more than 50% of the world s population are infected with H. pylori (14). The rapid changes in the epidemiology of different clinical outcomes caused by H. pylori suggest an interaction between an environmental factor, host and microbes that leads to a change in prevalence of strains differing in virulence (1, 6). Several studies have been evaluated the association between different virulence factors of H. pylori and clinical manifestations in Iranian population. There is limited information about dupa and oipa to define predictive value of virulence marker for gastric disorders. In the current survey, we have examined two H. pylori virulence factors; one is located in plasticity region (dupa) and the other is a phase variable gene (oipa). We also evaluated their relationship with different gastric disorders in the west of Iran. The prevalence of H. pylori differs significantly both between and within countries, with high rates of infection being associated with low socioeconomic status and high densities of living (18, 19). For instance, in Japan, South America, Turkey and Pakistan, the prevalence is more than 80%, while in Scandinavia and England, the prevalence is between 20% and 40% (6, 7). The prevalence of this bacterium in Iran is 60-90%, indicating Iran is a high risk region for H. pylori infection. Douraghi et al and Dabiri et al, have studied these genes in Tehran, Iran (13, 15). However, no evaluation has been done in West of Iran. According to our results, the prevalence of this bacterium was 87% and 82% by RUT and
5 Souod N. et al S51 PCR, respectively which is similar to previous reports from Iran (2, 15). Lu et al. demonstrated that the existence of the jhp0917 and jhp0918 genes, which located in the plasticity region, forms one gene (dupa) (11). The correlation of the dupa with clinical outcome is still controversial. Some researchers have shown that the gene is associated with an increased risk of duodenal ulcer and protection against gastric atrophy, intestinal metaplasia and gastric carcinoma in Japan and Korea (3, 11). Likewise, the gene was shown to be protective against gastric carcinoma in Colombian patients (11). Quiroz et al. from Brazil and Imagawa et al. from Japan suggest that there is no association between dupa with duodenal diseases, but strains containing dupa without the stop codon polymorphisms were associated with lower risk for development of gastric carcinoma (20, 21). However, some groups such as Gomes et al. in Brazil and Nguyen et al. in Japan did not find any significant association between dupa gene and duodenal ulcer disease (14, 19). The prevalence of dupa (both jhp0917 and jhp918) varies from 6% to 92% according to different studies around the world (3). Our results, similar to Lu et al. from Colombia and Zheng et al. from China showed that both jhp0917 and jhp0918 genes were present in 33.33% of isolates (11, 22). However, in our study, 6% of H. pylori strains did not contain jhp0918 gene. This finding is similar to those of Archachi et al. that showed 11% of cases were negative for jhp0918. It is likely that dupa gene without jhp0918 is not functional (12). When we came to analyze association of dupa status with clinical outcomes, our results were in accordance with Queiroza et al. and Imagawa et al. (20, 21). They showed there was no association between dupa gene and duodenal ulcer disease but there was a statistical significant association between the lack of this gene in strains and development of gastric cancer (20, 21). The presence of the dupa gene prevents the development of gastric cancer. The OipA is a member of the large outer membrane protein family whose functional status is regulated by slipped-strand mispairing based on the number of CT dinucleotide repeats in the 5ʹ region of the gene (a switch status of on indicates the gene is functional, and a switch status of off indicates it is non-functional) (15, 23). Using primers for detection of oipa gene, we figured out 71.54% of isolated strains contain this gene which is in accordance with our previous study that showed the oipa prevalence varies from 33% to 71% in Iranian population based on different ethnic background (13). In contrast with Yamaoka et al. and Kudo et al. identified the oipa gene from 45.9% and 30% of studied H.pylori isolates respectively (8, 24). In majority of studies, the oipa gene was present in most strains. In contrast, there were many oipa-negative cases in the current study. We used the same PCR primers as used in previous studies, which worked well both in Asian and Western strains. Therefore, there should be two possibilities: one is the nucleotide sequences of PCR primer regions are considerably different in Iranian strains from other countries and another possibility is that there are oipa-negative strains in Iran. More studies are needed for approving which possibilities will be applied to Iranian strains. Shao et al. declared there is no correlation between oipa gene and gastric diseases (25), while similar to our previous result; we interestingly found this gene to be significantly more common in non-ulcer dyspepsia patients rather than peptic ulcer dyspepsia cases (7, 15). Previously we have reported that the presence of the oipa is equal with low risk for GC development, while in the current study we did not find the same correlation (15). Overall, the presence of the oipa gene and clinical outcomes are still unclear. In previous studies, the oipa gene was present in most strains and the oipa status was evaluated by functional status (i.e. on or off status). As the numbers of patients in the current study were relatively small, further studies with larger numbers are necessary to clarify the
6 S52 Relationship between Helicobacter pylori strains and different gastroduodenal diseases roles of oipa in clinical outcomes. As a result of our findings, there was a statistically significant relationship between the lack of oipa gene and the presence of dupa in isolated strains. This is compatible with those of Matteo et al., which suggested that these genes are present with each other only in one tenth of strains (5). In conclusion, according to the results there was a reverse correlation between the dupa gene presence and gastric cancer as well as dupa and oipa gene. While the oipa gene is only statistically associated with gastritis, which is not consider as a severe dupa gene, an important marker for more severe gastrointestinal disease prediction. However, this fact does not apply for oipa gene among patients in the west of Iran. Finally, further and extended molecular epidemiology researches in other parts of Iran are recommended. Acknowledgment The authors would like to thank Mr. M. Momeni, Dr. E. Tajbakhsh and Mr. Gh. Ramezani at the Biotechnology Research Center of the Islamic Azad University of Shahrekord and Endoscopy Unit of Hajar Hospital of Shahrekord, for their sincere technical and clinical support. Also we would like to thank Ahmad Hassani for his kind help in primer designing. References 1. Momtaz H, Souod N, Dabiri H, Sarshar M. Study of Helicobacter pylori genotype status in saliva, dental plaques, stool and gastric biopsy samples. World J Gastroenterol 2012;18: Kargar M, Souod N, Ghorbani- Dalini S, Doosti A, Rezaian A. Evaluation of caga tyrosine phosphorylation DNA motifs in Helicobacter pylori isolates from gastric disorder patients in West of Iran. Scie Res Ass 2011;6: Shiota S, Matsunari O, Watada M, Hanada K, Yamaoka Y. Systematic review and meta-analysis: the relationship between the Helicobacter pylori dupa gene and clinical outcomes. Gut Pathol 2009;2: Yamaoka Y. Roles of the plasticity regions of Helicobacter pylori in gastroduodenal pathogenesis. J Med Microbial 2008;57: Matteo M, Armitano R, Granados G, Wonaga A, Sa nches Ch, Olmos M, et al. Helicobacter pylori oipa, vaca and dupa genetic diversity in individual hosts. J Med Microbiol 2010;59: Jafari F, Shokrzadeh L, Dabiri H, Baghaei K, Yamaoka Y, Zojaji H, et al. vaca genotypes of Helicobacter pylori in relation to caga status and clinical outcomes in Iranian populations. Jpn J Infect Dis 2008;61: Dabiri H, Bolfion M, Mirsalehian A, Rezadehbashi M, Jafari F, Shokrzadeh L, et al. Analysis of Helicobacter pylori genotypes in Afghani and Iranian isolates. Pol J Microbiol 2010;59: Yamaoka Y, Reddy R, Graham DY. Helicobacter pylori Virulence Factor Genotypes in Children in the United States: Clues about Genotype and Outcome Relationships. J Clin Microbiol 2010;48: Yamaoka Y, Kikuchi Sh, El-Zimaity H, Gutierrez O, Osato M, Graham D. Importance of Helicobacter pylori oipa in Clinical Presentation, Gastric Inflammation, and Mucosal Interleukin 8 Production. Gastroentrol 2002;2: Argent RH, Burette A, Miendje Deyi VY, Atherton JC. The presence of dupa in Helicobacter pylori is not significantly associated with duodenal ulceration in Belgium, South Africa, China, or North America. Clin Infect Dis 2007;45: Lu H, Hsu P, Graham D and Yamaoka Y. Duodenal Ulcer Promoting Gene of Helicobacter pylori. Gastroentrol 2005;4: Arachchi H, Kalra V, Lal B, Bhatia V, Baba C, Chakravarthy S, et al. Prevalence of duodenal ulcerpromoting gene (dupa) of Helicobacter pylori in patients with duodenal ulcer in North Indian population. Helicobacter 2007;12: Douraghi M, Mohammadi M, Oghalaie A, Afshin Abdirad, Mohagheghi MA, Eshagh Hosseini M, et al. dupa as a risk determinant in Helicobacter pylori infection. J Med Microbiol 2008;57: Gomes LI, Rocha GA, Rocha AM, Soares TF, Oliveira CA, Bittencourt PF, et al. Lack of association between Helicobacter pylori infection with dupapositive strains and gastroduodenal diseases in Brazilian patients. Int J Med Microbiol 2008;298:
7 Souod N. et al S Dabiri H, Maleknejad P, Yamaoka Y, Feizabadi MM, Jafari F, Rezadehbashi M, et al. Distribution of Helicobacter pylori caga, cage, oipa and vaca in different major ethnic groups in Tehran, Iran. J Gastroenterol Hepatol 2009;24: Kargar M, Ghorbani-Dalini S, Doosti A, Souod N. Real-time PCR for Helicobacter pylori quantification and detection of clarithromycin resistance in gastric tissue from patients with gastrointestinal disorders. Res Microbiol 2012;163: Kargar M, Ghorbani-Dalini S, Doosti A, Baghernejad M. Molecular assessment of clarithromycin resistant Helicobacter pylori strains using rapid and accurate PCR-RFLP method in gastric specimens in Iran. Afr J Biotechnol 2011;10: Salih BA. Helicobacter pylori infection in developing countries: the burden for how long? Saudi J Gastroenterol 2009;15: Nguyen LT, Uchida T, Tsukamoto Y, Kuroda A, Okimoto T, Kodama M, et al. Helicobacter pylori dupa gene is not associated with clinical outcomes in the Japanese population. Clin Microbiol Infect 2010;16: Queiroza DM, Rochaa GA, Rochaa AM, Mourab SB, Saraivaa I E, Gomesa LI, et al. dupa polymorphisms and risk of Helicobacter pyloriassociated diseases. Int J Med Microbiol 2011;301: Imagawa S, Ito M, Yoshihara M, Eguchi H, Tanaka S, Chayama K. Helicobacter pylori dupa and gastric acid secretion are negatively associated with gastric cancer development. J Med Microbiol 2010;59: Zhang Z, Zheng Q, Chen X, Xiao S, Liu W, Lu H. The Helicobacter pylori duodenal ulcer promoting gene, dupa in China. BMC Gastroenterol 2008;8: Mansour Kh, Fendri Ch, Zribi M, Masmoudi A, Labbene M, Fillali A, et al. Prevalence of Helicobacter pylori vaca, caga, icea and oipa genotypes in Tunisian patients. Ann Clin Microbiol Antimicrobiol 2010;9: Kudo T, Nurgalieva ZZ, Conner ME, Crawford S, Odenbreit S, Haas R, et al. Correlation between Helicobacter pylori OipA Protein Expression and oipa Gene Switch Status. J Clin Microbiol 2004;42: Shao Sh, Wang H, Chai Sh, Liu L. Research progress on Helicobacter pylori outer membrane protein. World J Gastroenterol 2005;11:
The association of and -related gastroduodenal diseases
The association of and -related gastroduodenal diseases N. R. Hussein To cite this version: N. R. Hussein. The association of and -related gastroduodenal diseases. European Journal of Clinical Microbiology
Helicobacter pylori dupa gene is not associated with clinical outcomes in the Japanese population
ORIGINAL ARTICLE INFECTIOUS DISEASES Helicobacter pylori dupa gene is not associated with clinical outcomes in the Japanese population L. T. Nguyen 1,2, T. Uchida 1,3, Y. Tsukamoto 1, A. Kuroda 1,2, T.
Association between Helicobacter pylori, caga, and vaca Status and Clinical Presentation in Iranian Children
Original Article Iran J Pediatr Oct 2013; Vol 23 (No 5), Pp: 551-556 Association between Helicobacter pylori, caga, and vaca Status and Clinical Presentation in Iranian Children Mandana Rafeey, MD; Reza
Comparative study of invasive methods for diagnosis of Helicobacter pylori in humans
ISSN: 2319-7706 Volume 2 Number 7 (2013) pp. 63-68 http://www.ijcmas.com Original Research Article Comparative study of invasive methods for diagnosis of Helicobacter pylori in humans V.Subbukesavaraja
Determination of the Status of Helicobacter pylori saba Gene in Relation to Clinical Findings
J Med Bacteriol. Vol. 1, No. 1, 2 (2012): pp. 3-8 jmb.tums.ac.ir ISMB TUMS Determination of the Status of Helicobacter pylori saba Gene in Relation to Clinical Findings Hossein Goudarzi 1, Hanieh Rezaee
Gastric atrophy: use of OLGA staging system in practice
Gastroenterology and Hepatology From Bed to Bench. 2016 RIGLD, Research Institute for Gastroenterology and Liver Diseases ORIGINAL ARTICLE Gastric atrophy: use of OLGA staging system in practice Mahsa
Research Article Determination of Helicobacter pylori Virulence Genes in Gastric Biopsies by PCR
ISRN Gastroenterology Volume 2013, Article ID 606258, 4 pages http://dx.doi.org/10.1155/2013/606258 Research Article Determination of Helicobacter pylori Virulence Genes in Gastric Biopsies by PCR Tamer
Helicobacter pylori dupa and gastric acid secretion are negatively associated with gastric cancer development
Journal of Medical Microbiology (2010), 59, 1484 1489 DOI 10.1099/jmm.0.021816-0 Helicobacter pylori dupa and gastric acid secretion are negatively associated with gastric cancer development Shinobu Imagawa,
Helicobacter pylori and Its Virulence Factors' Effect on Serum Oxidative DNA Damages in Adults With Dyspepsia
ORIGINAL ARTICLE Helicobacter pylori and Its Virulence Factors' Effect on Serum Oxidative DNA Damages in Adults With Dyspepsia Heshmat Shahi 1, Rasoul Bahreiny 2, and Somayeh Reiisi 3 1 Department of Immunology,
Association of Helicobacter pylori infection with Atrophic gastritis in patients with Dyspepsia
ADVANCES IN BIORESEARCH Adv. Biores., Vol 8 [3] May 2017: 137-141 2017 Society of Education, India Print ISSN 0976-4585; Online ISSN 2277-1573 Journal s URL:http://www.soeagra.com/abr.html CODEN: ABRDC3
Work interest: Reviewer in the journals: Editorial board:
Name: Amin Last name: Talebi Bezmin Abadi Email: Amin.talebi@modares.ac.ir; Amin.talebi@gmail.com Birthday: 4 th December 1983 Birth Place: Sari, Mazandaran Province, Iran B.S: Biology, University of Golestan,
Association of Intact dupa (dupa1) rather than dupa1 cluster with duodenal ulcer in Indian population
Alam et al. Gut Pathogens (2015) 7:9 DOI 10.1186/s13099-015-0056-2 RESEARCH Open Access Association of Intact dupa (dupa1) rather than dupa1 cluster with duodenal ulcer in Indian population Jawed Alam,
Anti-CagA IgG Antibody Is Independent from Helicobacter pylori VacA and CagA Genotypes
Anti-CagA IgG Antibody Is Independent from Helicobacter pylori VacA and CagA Genotypes Hashem Fakhre Yaseri 1, 2*, Mehdi Shekaraby 3, Hamid Reza Baradaran 4, Seyed Kamran Soltani Arabshahi 5 1 Gastroenterology,
Index. Note: Page numbers of article titles are in boldface type.
Note: Page numbers of article titles are in boldface type. A Adherence, to bismuth quadruple therapy, 543 546 Adjuvant therapy, probiotics as, 567 569 Age factors, in gastric cancer, 611 612, 616 AID protein,
Rates of clarithromycin resistance in Helicobacter pylori sampled from healthy subjects in Cheonan, Korea
Rates of clarithromycin resistance in Helicobacter pylori sampled from healthy subjects in Cheonan, Korea Young Sam Yuk 1, Ga-Yeon Kim 2 1. Department of Biomedical Laboratory Science, Dankook University
Associations between the Plasticity Region Genes of Helicobacter pylori and Gastroduodenal Diseases in a High-Prevalence Area
Gut and Liver, Vol. 4, No. 3, September 2010, pp. 345-350 original article Associations between the Plasticity Region Genes of Helicobacter pylori and Gastroduodenal Diseases in a High-Prevalence Area
International Journal of Research in Pharmacy and Life Sciences. International Journal of Research in Pharmacy and Life Sciences
G. Renuga et al, IJRPLS, 2015, 3(1): 260 264 ISSN: 2321 5038 International Journal of Research in Pharmacy and Life Sciences Journal Home Page: www.pharmaresearchlibrary.com/ijrpls Research Article Open
Genotype Variation in H. Pylori Isolates from Iranian Patients by RAPD-PCR
Genotype Variation in H. Pylori Isolates by RAPD-PCR Genotype Variation in H. Pylori Isolates from Iranian Patients by RAPD-PCR Siavoshi F Department of Microbiology, Faculty of Science, Tehran University
Correlation Between Endoscopic and Histological Findings in Different Gastroduodenal Lesion and its Association with Helicobacter Pylori
ORIGINAL ARTICLE Correlation Between Endoscopic and Histological Findings in Different Gastroduodenal Lesion and its Association with Helicobacter Pylori *A. Sultana 1, SM Badruddoza 2, F Rahman 3 1 Dr.
What is the status of Sequential Therapy Versus Standard Triple- Drug Therapy in peptic ulcer disease in eradicating H pylori?
What is the status of Sequential Therapy Versus Standard Triple- Drug Therapy in peptic ulcer disease in eradicating H pylori? Sequential Therapy Versus Standard Triple- Drug Therapy for Helicobacter pylori
Original Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk in a Chinese Han population
Int J Clin Exp Med 2014;7(12):5832-5836 www.ijcem.com /ISSN:1940-5901/IJCEM0002117 Original Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk
Helicobacter and gastritis
1 Helicobacter and gastritis Dr. Hala Al Daghistani Helicobacter pylori is a spiral-shaped gram-negative rod. H. pylori is associated with antral gastritis, duodenal (peptic) ulcer disease, gastric ulcers,
Research Article Concomitant Colonization of Helicobacter pylori in Dental Plaque and Gastric Biopsy
Pathogens, Article ID 871601, 4 pages http://dx.doi.org/10.1155/2014/871601 Research Article Concomitant Colonization of Helicobacter pylori in Dental Plaque and Gastric Biopsy Amin Talebi Bezmin Abadi,
Table 2.9. Case control studies of helicobacter pylori infection and oesophageal adenocarcinoma
Characteristics of Characteristics of controls Detection Chow et al (1998) 1993-1995 129 of newly diagnosed oesophageal/gastric cardia (OGC) adenocarcinoma. 224 population controls selected by random digit
Helicobacter pylori: Diagnosis, treatment and risks of untreated infection
Helicobacter pylori: Diagnosis, treatment and risks of untreated infection Klaus Mönkemüller Department of Gastroenterology, Hepatology und Infectius Diseases Otto-von-Guericke University, Magdeburg bb
Relationship between Helicobacter pylori icea, caga, and vaca Status and Clinical Outcome: Studies in Four Different Countries
JOURNAL OF CLINICAL MICROBIOLOGY, July 1999, p. 2274 2279 Vol. 37, No. 7 0095-1137/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. Relationship between Helicobacter
Helicobacter pylori homb, but Not caga, Is Associated with Gastric Cancer in Iran
JOURNAL OF CLINICAL MICROBIOLOGY, Sept. 2011, p. 3191 3197 Vol. 49, No. 9 0095-1137/11/$12.00 doi:10.1128/jcm.00947-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Helicobacter
Maastricht Ⅴ /Florence
2016 21 10 577 Maastricht Ⅴ /Florence 200001 2015 10 8 9 Maastricht V 1 / 2 3 4 / 5 Maastricht Ⅴ Interpretation of Management of Helicobacter pylori Infection the Maastricht Ⅴ / Florence Consensus Report
Histopathological study of Helicobacter Pylori bearing Gastric Biopsies for Gastric Lesions
ORIGINAL ARTICLE Histopathological study of Helicobacter Pylori bearing Gastric Biopsies for Gastric Lesions MULAZIM HUSSAIN BUKHARI, SAMINA QAMAR*, SHAHBAZ AHMAD QURESHI*, MALIK MAQSOOD ANWAR** ABSTRACT
Role of dupa in virulence of Helicobacter pylori
Submit a Manuscript: http://www.wjgnet.com/esps/ Help Desk: http://www.wjgnet.com/esps/helpdesk.aspx DOI: 10.3748/wjg.v22.i46.10118 World J Gastroenterol 2016 December 14; 22(46): 10118-10123 ISSN 1007-9327
PDF hosted at the Radboud Repository of the Radboud University Nijmegen
PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publication click this link. http://hdl.handle.net/2066/48400
Research Article Correlation between the Intensity of Helicobacter pylori Colonization and Severity of Gastritis
Hindawi Gastroenterology Research and Practice Volume 2017, Article ID 8320496, 5 pages https://doi.org/10.1155/2017/8320496 Research Article Correlation between the Intensity of Helicobacter pylori Colonization
Helicobacter Pylor infection in Iranian
Association of Myeloperoxidase -463 G/A Polymorphism with Clinical Outcome of Helicobacter Pylor infection in Iranian Patients with Gastrointestinal Diseases Eskandar Kamali-Sarvestani 1,2*, Hadi Farsiani
Histopathological Characteristics of Atrophic Gastritis in Adult Population
Journal of Pharmacy and Pharmacology 3 (2015) 133-138 doi: 10.17265/2328-2150/2015.03.004 D DAVID PUBLISHING Histopathological Characteristics of Atrophic Gastritis in Adult Population Marija Milićević,
Relation of alcohol to Helicobacter pylori infection: A cross sectional study
Original Research Article DOI: 10.18231/2581-3706.2018.0031 Rakshitha HB 1, Amita K 2,*, Mangala Gouri 3, Avinash Balekuduru 4 1 Assistant Professor, 2 Professor, Dept. of Pathology, Adichunchanagiri Institute
caga Positive Helicobacter pylori in Brazilian Children Related to Chronic Gastritis
254 BJID 2006; 10 (August) caga Positive Helicobacter pylori in Brazilian Children Related to Chronic Gastritis Luciano Lobo Gatti 1,2, Roger de Lábio¹, Luiz Carlos da Silva 3, Marília de Arruda Cardoso
The Association of CagA + Helicobacter pylori Infection and Gastric Carcinoma
The Association of CagA + Helicobacter pylori Infection and Gastric Carcinoma PRESENTER: Dr. Md. Khalilur Rahman Student of M.D.(Internal Medicine) Sylhet MAG Osmani Medical College Gastric Cancer- ranked
Functional dyspepsia: relationship between clinical subgroups and Helicobacter pylori status in Western Turkey
Brazilian Journal of Medical and Biological Research (2003) 36: 747-751 Dyspepsia and Helicobacter pylori ISSN 0100-879X 747 Functional dyspepsia: relationship between clinical subgroups and Helicobacter
KEYWORDS Dyspepsia, Acid Peptic Disease, Helicobacter Pylori, Urease, Giemsa, Peptic Ulcer, Non-Ulcer Dyspepsia.
INCIDENCE OF HELICOBACTER PYLORI WITH ACID PEPTIC DISEASE AND MALIGNANT CONDITIONS OF UPPER GASTROINTESTINAL TRACT IN A TERTIARY CENTRE - A PROSPECTIVE STUDY Karunamoorthy Rajachidambaram 1, Dinkaran Kaarthesan
Conservation of the cag pathogenicity island is associated with vaca alleles and gastroduodenal disease in South African Helicobacter pylori isolates
Gut 2001;49:11 17 11 PAPERS GI Clinic and Department of Medicine, University of Cape Town and Groote Schuur Hospital, Cape Town, South Africa M Kidd J A Louw Department of Medical Microbiology, University
The Nobel Prize in Physiology or Medicine for 2005
The Nobel Prize in Physiology or Medicine for 2005 jointly to Barry J. Marshall and J. Robin Warren for their discovery of "the bacterium Helicobacter pylori and its role in gastritis and peptic ulcer
Comparative study of rapid urease test and histopathological examination for detection of H. pylori infection
International Surgery Journal Athavale VS et al. Int Surg J. 2017 Dec;4(12):4071-4075 http://www.ijsurgery.com pissn 2349-3305 eissn 2349-2902 Original Research Article DOI: http://dx.doi.org/10.18203/2349-2902.isj20175413
Bcl-2 Expression in CagA Strain H. Pylori Gastritis (Immunohistochemical and Insitu Hybridization Study)
CAGA THE IRAQI STRAIN POSTGRADUATE H. PYLORI MEDICAL GASTRITIS JOURNAL Bcl- Expression in CagA Strain H. Pylori Gastritis (Immunohistochemical and Insitu Hybridization Study) Hussam Hasson Ali *, Hassan
Helicobacter pylori Improved Detection of Helicobacter pylori
DOI:http://dx.doi.org/10.7314/APJCP.2016.17.4.2099 RESEARCH ARTICLE Improved Detection of Helicobacter pylori Infection and Premalignant Gastric Mucosa Using Conventional White Light Source Gastroscopy
Research Article Performance of Routine Helicobacter pylori Invasive Tests in Patients with Dyspepsia
Gastroenterology Research and Practice Volume 2013, Article ID 184806, 5 pages http://dx.doi.org/10.1155/2013/184806 Research Article Performance of Routine Helicobacter pylori Invasive Tests in Patients
Relation between clinical presentation, Helicobacter pylori density, interleukin 1β and 8 production, and caga status
84 Department of Medicine, Veterans AVairs Medical Centre and Baylor College of Medicine, Houston, Texas, USA Y Yamaoka D Y Graham Third Department of Internal Medicine, Kyoto Prefectural University of
the pathology of chronic gastritis
Original Article Singapore Med12007,48(5):447 Cytokine gene polymorphisms and the pathology of chronic gastritis Moorchung N, Srivastava A N, Gupta N K, Ghoshal U C, Achyut B R, Mittal B Department of
Gastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR
Gastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR Pages with reference to book, From 305 To 307 Irshad N. Soomro,Samina Noorali,Syed Abdul Aziz,Suhail Muzaffar,Shahid
Association between the pre-mir-196a2 rs polymorphism and gastric cancer susceptibility in a Chinese population
Association between the pre-mir-196a2 rs11614913 polymorphism and gastric cancer susceptibility in a Chinese population M. Li, R.J. Li, H. Bai, P. Xiao, G.J. Liu, Y.W. Guo and J.Z. Mei Department of Medical
Multi-clonal origin of macrolide-resistant Mycoplasma pneumoniae isolates. determined by multiple-locus variable-number tandem-repeat analysis
JCM Accepts, published online ahead of print on 30 May 2012 J. Clin. Microbiol. doi:10.1128/jcm.00678-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Multi-clonal origin
Endoscopic atrophic classification before and after H. pylori eradication is closely associated with histological atrophy and intestinal metaplasia
E311 before and after H. pylori eradication is closely associated with histological atrophy and intestinal metaplasia Authors Institution Masaaki Kodama, Tadayoshi Okimoto, Ryo Ogawa, Kazuhiro Mizukami,
Utility of In House made Rapid Urease Broth Test for Detection of Helicobacter pylori Infection in Resource Constraint Settings
Original article: Utility of In House made Rapid Urease Broth Test for Detection of Helicobacter pylori Infection in Resource Constraint Settings 1.Dr. Swati Rahul Dhope, 2. Dr. Sachinkumar Vasantrao Wankhede
Detection of Helicobacter pylori Gastritis by PCR Correlation With Inflammation Scores and Immunohistochemical and CLOtest Findings
Anatomic Pathology / HELICOBACTER PYLORI GASTRITIS Detection of Helicobacter pylori Gastritis by PCR Correlation With Inflammation Scores and Immunohistochemical and CLOtest Findings Jason Weiss, DO, 1,2
Functional Dyspepsia. Norbert Welkovics Heine van der Walt
Norbert Welkovics Heine van der Walt Characteristics: Central abdomen Pain or discomfort Not associated with bowel movements No structural or biochemical abnormalty Definition Part of Gastroduodenal disorders
SURVEY IN IRAN OF CLARITHROMYCIN RESISTANCE IN HELICOBACTER PYLORI ISOLATES BY PCR-RFLP
SURVEY IN IRAN OF CLARITHROMYCIN RESISTANCE IN HELICOBACTER PYLORI ISOLATES BY PCR-RFLP Nourkhoda Sadeghifard 1, Teimour Seidnazari 1, Sobhan Ghafourian 1,3, Mohammad Soleimani 2, Abbas Maleki 1, Mostafa
RESEARCH ARTICLE. Seroreactivity to Helicobacter pylori Antigens as a Risk Indicator of Gastric Cancer
RESEARCH ARTICLE Seroreactivity to Helicobacter pylori Antigens as a Risk Indicator of Gastric Cancer Najmeh Karami, Yeganeh Talebkhan, Samaneh Saberi, Maryam Esmaeili, Akbar Oghalaie, Afshin Abdirad 2,
Breastfeeding and Helicobacter Pylori Infection in Children with Digestive Symptoms
Original Article Iran J Pediatr Sep 2010; Vol 20 (No 3), Pp: 330-334 Breastfeeding and Helicobacter Pylori Infection in Children with Digestive Symptoms Maryam Monajemzadeh 1, MD; Fatemeh Farahmand 2,3,
Ethnic Distribution of Atrophic Autoimmune Gastritis in the United States
Ethnic Distribution of Atrophic Autoimmune Gastritis in the United States Robert M. Genta, Regan Allen, Massimo Rugge Miraca Life Sciences Research Institute, Miraca Life Sciences, Irving, Texas UTSW University
The significance of Helicobacter pylori in the approach of dyspepsia in primary care Arents, Nicolaas Lodevikus Augustinus
University of Groningen The significance of Helicobacter pylori in the approach of dyspepsia in primary care Arents, Nicolaas Lodevikus Augustinus IMPORTANT NOTE: You are advised to consult the publisher's
pylori according to cagpai components and vaca genotypes and clinical out
Biomedical Research 2017; 28 (4): 1743-1748 Determination of correlation between principal genotypes of Helicobacter pylori according to cagpai components and vaca genotypes and clinical out come in patients
Original Article. Is There Any Association between Helicobacter pylori CagA Status and Patient's Habits with Gastric Carcinoma
Faridpur Med. Coll. J. 2015;10(1):09-13 Original Article Is There Any Association between Helicobacter pylori CagA Status and Patient's Habits with Gastric Carcinoma MA Hassan 1, MA Ahad 2, MH Rahman 3,
HISTOPATHOLOGICAL STUDY OF ENDOSCOPIC BIOPSIES OF STOMACH
HISTOPATHOLOGICAL STUDY OF ENDOSCOPIC BIOPSIES OF STOMACH Pages with reference to book, From 177 To 179 Javed Iqbal Kazi, Syed Mahmood Alam ( Departments of Pathology, Jinnah Postgraduate Medical Centre,
THE PREVALENCE OF HELICBACTER PYLORI AMONG PATIENTS COMPLAINING FROM ABDOMINAL PAIN
THE PREVALENCE OF HELICBACTER PYLORI AMONG PATIENTS COMPLAINING FROM ABDOMINAL PAIN Ahed J. Al-Khatib Jordan University of Science and Technology, Jordan Ahmed Saber Abu-zaiton Al-albayt University Abstract
Original article J Bas Res Med Sci 2015; 2(4):45-50.
Comparison between the effectiveness of Furazolidone and Clarithromycin on eradication of helicobacter pylori among patients with peptic ulcer Asghar Rahmani 1, Ali Jafari Haidarloo 2, Hoda Mabrokzadeh
H. pylori Stool Rapid Test (Cassette)
H. pylori Stool Rapid Test (Cassette) Cat. No.:DTS590 Pkg.Size: Intended use The H. pylori Stool Cassette is an immunochromatographic screening assay for the qualitative detectionof Helicobacter pylori
Analysis of Helicobacter pylori vaca and caga genotypes and serum antibody profile in benign and malignant gastroduodenal diseases
182 Department of Laboratory Medicine D Basso F Navaglia L Brigato M G Piva A Toma E Greco G Roveroni M Plebani Department of Gastroenterology F Di Mario II Divisione Chirurgica, University Hospital of
The role of adenotonsillar tissues as a reservoir for Helicobacter pylori and Helicobacter hepaticus
Gastroenterology and Hepatology From Bed to Bench. 2011;4(3): 153-158 2011 RIGLD, Research Institute for Gastroenterology and Liver Diseases ORIGINAL ARTICLE The role of adenotonsillar tissues as a reservoir
Corporate Medical Policy
Corporate Medical Policy File Name: Origination: Last CAP Review: Next CAP Review: Last Review: helicobacter_pylori_testing 01/01/2019 N/A 01/01/2020 01/01/2019 Policy Effective April 1, 2019 Description
Helicobacter pylori:an Emerging Pathogen
Bacteriology at UW-Madison Bacteriology 330 Home Page Helicobacter pylori:an Emerging Pathogen by Karrie Holston, Department of Bacteriology University of Wisconsin-Madison Description of Helicobacter
Helicobacter pylori infection: several studies on epidemiology, eradication and gastric epithelial cell turnover Liu, W.
UvA-DARE (Digital Academic Repository) Helicobacter pylori infection: several studies on epidemiology, eradication and gastric epithelial cell turnover Liu, W. Link to publication Citation for published
Variants of the 3 Region of the caga Gene in Helicobacter pylori Isolates from Patients with Different H. pylori-associated Diseases
JOURNAL OF CLINICAL MICROBIOLOGY, Aug. 1998, p. 2258 2263 Vol. 36, No. 8 0095-1137/98/$04.00 0 Copyright 1998, American Society for Microbiology. All Rights Reserved. Variants of the 3 Region of the caga
New developments in pathogenesis, gastric cancer. Matthias Ebert. II. Medizinische Klinik Klinikum rechts der Isar TU München
New developments in pathogenesis, diagnosis, therapy and prevention of gastric cancer Matthias Ebert II. Medizinische Klinik Klinikum rechts der Isar TU München Gastric Cancer Pathogenesis Diagnosis Treatment
(Received September 12, Accepted April 23, 1997) Jpn. J. Med. Sci. Biol., 50, 55-62, 1997.
Jpn. J. Med. Sci. Biol., 50, 55-62, 1997. EVALUATION OF CULTURE, HISTOLOGICAL EXAMINATION, SEROLOGY AND THE RAPID UREASE TEST FOR DIAGNOSIS OF HELICOBACTER PYLORI IN PATIENTS WITH DYSPEPSIA IN BANGLADESH
HLA-A*26 and Susceptibility of Iranian Patients with Non-Hodgkin Lymphoma
HLA-A*26 and Susceptibility of Iranian Patients with Non-Hodgkin Lymphoma Arezou Sayad 1, Mohammad Taghi Akbari 2**, Mahshid Mehdizadeh 3,4, Mohammad Taheri 1, Abbas Hajifathali 3* 1 Department of Medical
Original Article. Abstract
Original Article Association of helicobacter pylori with carcinoma of stomach Muhammad Arif, Serajuddaula Syed Department of Pathology, Sindh Medical College, Karachi Abstract Objective: To note the association
Prevalence of Helicobacter Pylori Infection Among Patients Undergoing Upper Gastrointestinal Endoscopy in a Medical College Hospital in Kerala, India
Original Article Prevalence of Helicobacter Pylori Infection Among Patients Undergoing Upper Gastrointestinal Endoscopy in a Medical College Hospital in Kerala, India Adlekha S, Chadha T 1, Krishnan P
Original Policy Date
MP 2.04.38 Genetic Testing for Helicobacter pylori Treatment Medical Policy Section Medicine Issue 12:2013 Original Policy Date 12:2013 Last Review Status/Date Reviewed with literature search/12:2013 Return
Association between Helicobacter Pylori Infection and Barrett s Esophagus in Patients with Gastro-Esophageal Reflux Symptoms and Erosive Esophagitis
Med. J. Cairo Univ., Vol. 82, No. 2, September: 169-174, 2014 www.medicaljournalofcairouniversity.net Association between Helicobacter Pylori Infection and Barrett s Esophagus in Patients with Gastro-Esophageal
Epidemiology of Gastric Cancer in Northwest Iran:
Middle East Special Report Middle East Journal of Cancer; July 2015; 6(3): 189-193 Epidemiology of Gastric Cancer in Northwest Iran: 2003-2011 Firouz Amani*, Mohammad Sadrkabir*, Saeid Sadeghieh Ahari*,
Title: DNA repair gene polymorphisms and risk of chronic atrophic gastritis: a case-control study
Author's response to reviews Title: DNA repair gene polymorphisms and risk of chronic atrophic gastritis: a case-control study Authors: Bernd Frank (b.frank@dkfz.de) Heiko Müller (h.mueller@dkfz.de) Melanie
UvA-DARE (Digital Academic Repository) Genetic variation in Helicobacter pylori Pan, Z. Link to publication
UvA-DARE (Digital Academic Repository) Genetic variation in Helicobacter pylori Pan, Z. Link to publication Citation for published version (APA): Pan, Z. (1999). Genetic variation in Helicobacter pylori
A PLACEBO CONTROLLED TRIAL OF BISMUTH SALICYLATE IN HELICOBACTER PYLORI ASSOCIATED GASTRITIS
A PLACEBO CONTROLLED TRIAL OF BISMUTH SALICYLATE IN HELICOBACTER PYLORI ASSOCIATED GASTRITIS Pages with reference to book, From 154 To 156 Javed Iqbal Kazi, Naeem Aon Jafarey, Syed Mahmood Alam ( Department
JMSCR Vol 05 Issue 08 Page August 2017
www.jmscr.igmpublication.org Impact Factor 5.84 Index Copernicus Value: 83.27 ISSN (e)-2347-176x ISSN (p) 2455-0450 DOI: https://dx.doi.org/10.18535/jmscr/v5i8.83 Role of Special Stain Giemsa in Demonstration
Prevalence of gastroduodenal lesions in chronic nonsteroidal anti-inflammatory drug users presenting with dyspepsia at the Kenyatta National Hospital
Research Article Department of Clinical Medicine and Therapeutics, University of Nairobi, Kenya Corresponding author: Dr. G O Oyoo. Email: geomondi@hotmail. com Prevalence of gastroduodenal lesions in
H. pylori Antigen ELISA Kit
H. pylori Antigen ELISA Kit Catalog Number KA3142 96 assays Version: 04 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle of
Correlation between Gastric Mucosal Morphologic Patterns and Histopathological Severity of
Hindawi Publishing Corporation BioMed Research International Volume 2015, Article ID 808505, 7 pages http://dx.doi.org/10.1155/2015/808505 Research Article Correlation between Gastric Mucosal Morphologic
TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer
AD Award Number: W81XWH-04-1-0579 TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer PRINCIPAL INVESTIGATOR: Yuichiro Tanaka, Ph.D. CONTRACTING ORGANIZATION: Northern California
Helicobacter Pylori Testing HELICOBACTER PYLORI TESTING HS-131. Policy Number: HS-131. Original Effective Date: 9/17/2009
Easy Choice Health Plan, Inc. Harmony Health Plan of Illinois, Inc. Missouri Care, Inc. Ohana Health Plan, a plan offered by WellCare Health Insurance of Arizona, Inc. WellCare Health Insurance of Illinois,
Helicobacter 2008;13:1-6. Am J Gastroent 2007;102: Am J of Med 2004;117:31-35.
An Update on Helicobacter pylori and Its Treatment Trenika Mitchell, PharmD, BCPS Clinical Assistant Professor University of Kentucky College of Pharmacy October 18, 2008 Objectives Review the epidemiology
Helicobacter pylori Infection in Children: A New Focus
Helicobacter pylori Infection in Children: A New Focus John KC Yee Research Lab of Oral H. pylori USA Background Helicobacter pylori (H. pylori) infection places a heavy burden on medical and economic
Detection and Genotyping of Helicobacter pylori among Gastric ulcer and Cancer Patients from Saudi Arabia
Open Access Original Article Detection and Genotyping of Helicobacter pylori among Gastric ulcer and Cancer Patients from Saudi Arabia Fehmida Bibi 1, Sana Akhtar Alvi 2, Sara Ali Sawan 3, Muhammad Yasir
RESEARCH ARTICLE. Abstract. Introduction
DOI:10.22034/APJCP.2017.18.4.927 Outcomes of a Randomized Controlled Trial Comparing Modified High Dose Omeprazole RESEARCH ARTICLE Outcomes of a Randomized Controlled Trial Comparing Modified High Dose
Fecoprevalence and determinants of Helicobacter pylor infection among asymptomatic children in Myanmar
International Journal of Gastroenterology, Hepatology, Transplant & Nutrition Original Article Fecoprevalence and determinants of Helicobacter pylor infection among asymptomatic children in Myanmar Hnin
IgE levels are increased in patients with Helicobacter pylori infection
International Journal of Research in Applied and Basic Medical Sciences 2015; 1(1):51-55 IgE levels are increased in patients with Helicobacter pylori infection Rasmi Y 1, Hasani R 2, Sayyadi H 3, Sadreddini
Genetic variability of genes involved in DNA repair influence treatment outcome in osteosarcoma
Genetic variability of genes involved in DNA repair influence treatment outcome in osteosarcoma M.J. Wang, Y. Zhu, X.J. Guo and Z.Z. Tian Department of Orthopaedics, Xinxiang Central Hospital, Xinxiang,
IL10 rs polymorphism is associated with liver cirrhosis and chronic hepatitis B
IL10 rs1800896 polymorphism is associated with liver cirrhosis and chronic hepatitis B L.N. Cao 1, S.L. Cheng 2 and W. Liu 3 1 Kidney Disease Department of Internal Medicine, Xianyang Central Hospital,
Gastrointestinal pathology 2018 lecture 4. Dr Heyam Awad FRCPath
Gastrointestinal pathology 2018 lecture 4 Dr Heyam Awad FRCPath Topics to be covered Peptic ulcer disease Hiatal hernia Gastric neoplasms Peptic ulcer disease (PUD)= chronic gastric ulcer Causes H pylori
The impacts of H. pylori virulence factors on the development of gastroduodenal diseases
Chang et al. Journal of Biomedical Science (2018) 25:68 https://doi.org/10.1186/s12929-018-0466-9 REVIEW The impacts of H. pylori virulence factors on the development of gastroduodenal diseases Wei-Lun
instrument. When 13C-UBT positive value is greater than or equal to / - 0.4, the the subject can be 1. Data and methods details are as follows:
Application of 13 C-urea breath test in screening helicobacter pylori infection during health examination in Chengdu, Sichuan YANG Yan-hua. LIU Yu-ping. CHENG You-fu, SHUAI Ping. LU Qiao. ZHENG Xiao-xia,
A COMPARATIVE STUDY BETWEEN IMMUNOHISTOCHEMISTRY, HEMATOXYLIN & EOSIN AND GEIMSA STAIN FOR HELICOBACTER PYLORI DETECTION IN CHRONIC GASTRITIS
Original Research Article Pathology International Journal of Pharma and Bio Sciences ISSN 0975-6299 A COMPARATIVE STUDY BETWEEN IMMUNOHISTOCHEMISTRY, HEMATOXYLIN & EOSIN AND GEIMSA STAIN FOR HELICOBACTER