Molecular genetic studies in epithelial cells of lung cancer and COPD patients Boelens, Mirjam Catharina
|
|
- Solomon Skinner
- 6 years ago
- Views:
Transcription
1 University of Groningen Molecular genetic studies in epithelial cells of lung cancer and COPD patients Boelens, Mirjam Catharina IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document version below. Document Version Publisher's PDF, also known as Version of record Publication date: 2008 Link to publication in University of Groningen/UMCG research database Citation for published version (APA): Boelens, M. C. (2008). Molecular genetic studies in epithelial cells of lung cancer and COPD patients s.n. Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons). Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. Downloaded from the University of Groningen/UMCG research database (Pure): For technical reasons the number of authors shown on this cover page is limited to 10 maximum. Download date:
2 Specific genomic aberrations in primary squamous cell lung carcinoma with lymph node or distant me tastasis 6 Mirjam C Boelens 1,2, Klaas Kok 3, Pieter van der Vlies 3, Gerben van der Vries 3, Hannie Sietsma 1, Wim Timens 1, Dirkje S Postma 2, Harry J M Groen 2, Anke van den Berg 1 1 Department of Pathology, 2 Department of Pulmonology, 3 Department of Genetics, University Medical Center Groningen, University of Groningen, Groningen, the Netherlands Submitted CHAPTER
3 chapter 6 Abstract Lung cancer is the most common type of cancer with the highest mortality worldwide. After surgical resection of the primary tumor, survival is especially low in patients presenting with distant metastases within the first two years after diagnosis. We analyzed a cohort of patients with primary squamous cell carcinoma (SCC) using array-based comparative genomic hybridization (acgh) to identify chromosomal aberrations that are related to development of metastases. The cohort consisted of 34 patients with a follow-up of at least 5 years, including 15 without any metastases, 8 with metastases in regional lymph nodes only, and 11 with metastases exclusively in distant organs within two years after diagnosis. In the total group, several chromosomal aberrations were observed in at least 40%, i.e. genomic gains of 3q13-q29, 5p11-p15, 8q24, 19q13, 20p12-p13, and 22q11-q13, and losses of 3p12-p14, 3p24, 4p15, 4q33-q35, 5q14-q23, 5q31-q35, 8p21-p22, and 9p21-p24. Amplifications were observed at chromosomal regions 2p15-p16, 3q24-q29, 8p11-p12, 8q23-q24, and 12p12. These regions contain candidate oncogenes such as BCL11A, REL, ECT2, PIK3CA, ADAM9, MYC, and KRAS. Three out of eight SCC derived from patients with lymph node metastases showed a homozygously deleted region at 4q33-q34.1 in contrast to none of the 15 SCC derived from patients without metastases. In addition, SCC from patients with lymph node metastases had a significantly higher frequency of gains at 7q36, 8p12, 10q22, and 12p12, and loss at 4p14. Patients with SCC and distant metastases showed a significantly higher frequency of gain at 8q22-q24, and loss of 8p23 and 13q21. Significantly lower frequencies of gain at 2p12 and 2p16 and loss of 11q25 were observed in this patient group as compared to SCC from patients without metastases. In this study, we identified specific genomic aberrations in primary SCC that are related to lymph node and distant metastases. These loci can be further explored for their potential use as predictive or prognostic markers for patients with SCC. 100
4 metastasis-specific acgh profiles in scc Introduction Lung cancer is the most common type of cancer with the highest mortality worldwide and a 5-year overall survival of 15%. About 60 to 70% of lung cancer patients present with metastases at time of diagnosis. Furthermore, about 50% of the patients who present with resectable disease will develop metastases within 5 years. Squamous cell lung carcinoma (SCC) is one of the most common histological types of lung cancer. SCC patients may present already with regional lymph node metastases at the time of diagnosis and the risk of developing metastases in distant organs is particularly high in the first two years after diagnosis. Many patients develop metastases in bone, brains, contralateral lung, liver, and adrenal glands. It is generally assumed that disseminated lung tumor cells invade into regional lymph nodes via the lymphatic vessels and spread to distant organs via blood vessels. This difference in metastatic behavior may be caused by differences in genetic alterations in the primary SCC. An increasing number of genomic aberrations has been observed in the progression from normal bronchial epithelium to invasive SCC 1,2. Several recurrent chromosomal aberrations have been identified in SCC by CGH or array-based CGH (acgh), including gains of 3q, 5p, and 8q and loss of 3p, 5q and 8p 3-8. At the time of surgery, it is impossible to predict which primary tumor will develop metastases. Some (a)cgh-based studies investigated whether there is an association between genomic alterations in the primary lung tumor and its metastatic potential. In non-small cell lung cancer (NSCLC), associations were identified between gain on 1q and recurrence within 1 year 5 and between gain on 7q and positive lymph nodes 6. In SCC, associations were identified between gains on 2p, 7p, 7q, 20p, losses on 2q, 4q, 6p, 16p, 18q, 20q, 21q and metastases 9. In most of these studies, no discrimination was made between adenocarcinoma (AC) and SCC or between lymph node and distant metastases. To characterize genomic alterations in SCC associated with metastatic potential, we generated acgh profiles from primary SCC obtained from patients with or without metastases. We selected SCC patients without any metastases and those with only lymph node metastases; both remained without distant metastases for at least 5 years. We also selected SCC patients who only developed metastases in distant organs within two years after diagnosis. The most common genomic aberrations in the total group and aberrations that were associated with metastatic potential were assessed
5 chapter 6 Methods Patients and tissue specimens Patients were selected based on clinical follow-up data for at least 5 years and availability of frozen tissue. Patients who were treated with chemotherapy before or directly after surgery were excluded. We selected a total of 34 patients who presented with centrally located primary squamous cell lung carcinoma (SCC) (Table 1, Supplementary table 1), including 15 patients without lymph node or distant organ metastases within 5 years after surgery; 8 patients with lymph node metastases at the time of surgery, but no distant metastases within 5 years after surgery; 11 patients presenting with distant metastases within 2 years after surgery (median 10 months, range 2-19) but without lymph node metastases. One patient of the no metastases group died 3 years after surgery. In one patient of the distant metastases group, distant metastases presented at 28 months. Patients with both lymph node and distant metastases were excluded. As a control for the qrt-pcr experiments we also collected bronchial tissues of the larger airways (bronchus diameter > 2 mm, surrounded by cartilage) from 15 patients during thoracotomy for NSCLC or lung transplantation. All tissue samples were snap frozen in liquid isopentane, and stored at -80 ºC until further processing. The study protocol was consistent with national ethical and professional guidelines ( Code of Good Conduct; Dutch Federation of Biomedical Scientific Societies ). Laser microdissection microscopy For SCC samples with more than 80% tumor cells in the tissue section, genomic DNA was isolated from the total tissue, in all other cases laser microdissection microscopy Table 1. Patients characteristics no lymph node distant sex male/female 15/0 5/3 11/0 age (years) median (range) 67 (47-83) 62 (51-76) 69 (48-75) tumor status T1/T2/T3 2/13/0 1/5/2 0/7/4 stage I/II/III 15/0/0 0/5/3 8/3/0 survival (months) median (95% CI) 116 (80-152) 91 (80-126) 23 (11-35) no, no lymph node metastases at time of surgery and no distant metastases developed within 5 years after surgery; lymph node, lymph node metastases at time of surgery, but no distant metastases developed within 5 years after surgery; distant, distant metastasis within 2 years after surgery, but no lymph node metastases. Characteristics per patient are listed in Supplementary table
6 metastasis-specific acgh profiles in scc (LDM) was performed to obtain pure cell populations 10. Only vital tumor cells without apparent admixture of inflammatory cells through the tumor fields were selected for laser microdissection. An area of approximately 25 x10 6 μm 2 was microdissected from frozen sections of 8 μm by the P.A.L.M. Microlaser Technology system, according to the manufacturer s instructions (P.A.L.M., Bernried, Germany). Microdissected cells were immediately collected in SE buffer (75 mm NaCl, 0.1 mm EDTA) for DNA isolation. For qrt-pcr, LDM was applied on 25 SCC samples and on 15 bronchus samples to isolate pure tumor cell populations and histologically normal epithelial cells. All cells were harvested directly in lysis buffer (Macherey-Nagel, Düren, Germany) for RNA isolation. DNA isolation Genomic DNA was isolated and purified from the (laser-microdissected) cells using a standard salt-chloroform extraction protocol. The DNA concentration was measured using a Nanodrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE). 100 ng DNA was used for whole genome amplification using the BioScore FFPE screening and amplification kit according to the manufacturer s instructions (Enzo Life Sciences Inc., Farmingdale, NY) to yield sufficient DNA for hybridization on the arrays. Only SCC cases for which a high yield of amplified DNA was obtained in the amplification reaction were used for acgh experiments, as recommended by the manufacturer. Array-based Comparative Genomic Hybridization (acgh) We started with a number of test hybridizations to determine if acgh profiles of amplified DNA were comparable to those of non-amplified total DNA. We observed consistent profiles for amplified and non-amplified DNA indicating that amplification does not affect the acgh results (data not shown). An amount of 600 ng of (amplified) genomic DNA was labeled with Cy3-dUTP (Perkin Elmer, Langen, Germany) using the BioPrima DNA labeling System (Invitrogen Inc., Carlsbad, CA) 11. Samples were inversely sex-matched with a normal reference DNA (labeled with Cy5-dUTP) as an internal control for gain or loss at the X chromosome. Hybridizations were included for further analysis only if the calculated ratio for the X-chromosomal BACs were as expected. The design and construction of the BAC-microarray, containing 6465 BACs, has been previously described 11. The array slides were processed according to the manufacturer s instructions and as described previously 12. Arrays were scanned using an Agilent scanner (Agilent, Santa Clara, CA)
7 chapter 6 Table 2 Common gains and losses in SCC Cytoband Region start (Mb) Length (Mb) Event Number of genes Frequency (%) 3q13.2-q Gain p15.33-p Gain q Gain q Gain p13-p Gain q11.21-q Gain p14.2-p Loss p24.3-p Loss p Loss q33-q Loss q34.3-q Loss q14.2-q Loss q31.1-q Loss p22-p Loss p21.2-p Loss p24.2-p Loss p24.3-p Loss acgh analysis The scanned images were processed with Bluefuse v3.5 (BlueGnomeLtd, Cambridge, UK). A block-median normalization excluding controls was applied to the 2 log-transformed Cy3/Cy5 ratios. Subsequent exclusion criteria were: confidence < 0.3, quality < 1 and SD of replicates > 0.5. Finally, the log-ratios of the replicates were combined using the fusion algorithm. The resulting log-ratio files were imported into Nexus-CGH software (BioDiscovery, US) to visualize and analyze copy number changes within or between subsets of SCC. Thresholds for gains and losses were set at 2 log-ratios of 0.3 (gain) and -0.3 (loss), respectively. Thresholds for amplifications were set at 2 log-ratios of 0.8 and thresholds for homozygous deletions were set at Threshold for assessment of a cluster of (high copy) gains or homozygous deletions were set at a p-value of 0.01 and maximal contiguous probe spacing of 4,000 Kb. A threshold of 35% difference in frequency with a p 0.05 (Fisher exact test) was used to define significant differences in the number of aberrations for a specific chromosomal region in SCC samples between patients with or without metastases. Since SCC samples are often triploid, we decided to consider two as well as three copies of a chromosomal region as normal and set the threshold of a gain in such a way that we could identify only four copies or more. 104
8 metastasis-specific acgh profiles in scc RNA isolation Total RNA was isolated and purified from the laser-dissected cells with a Nucleospin RNA II kit (Macherey-Nagel), according to the manufacturer s instructions, including DNase treatment. The quantity of DNA-free total RNA was measured using a Nanodrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE). RNA quality was assessed with RNA 6000 PicoChip (Agilent, Palo Alto, CA) on the 2100 bioanalyzer (Agilent) by the ratio of the 18S and 28S rrna bands combined with a low baseline. Quantitative RT-PCR Quantitative RT-PCR (qrt-pcr) was used to assess whether amplification of genomic DNA correlates with increased gene expression levels comparing SCC with and without amplification to normal bronchus epithelium. Low density arrays were used in duplicate for a selection of genes located on amplified regions and RPII was selected as a housekeeping gene (Applied Biosystems, Foster City, CA). Assays for the low density array were chosen in such a way that the primers span exon junctions and were located close to the poly(a)-tail to enable efficient amplification. Sufficient quality RNA was obtained from 25 SCC and 15 normal bronchial epithelium samples. cdna was synthesized using Superscript II Reverse Transcriptase (Invitrogen, Carlsbad, CA) with random primers (Invitrogen) according to the manufacturer s instructions. Low density arrays were loaded according to the manufacturer s instructions and measured using TaqMan (Applied Biosystems). The relative number of transcripts was calculated by subtracting the average Ct value of the reference A 100% 50% 0% 50% 6 B 40% 20% 10% 0% 10% 20% Figure 1. Frequency plot of chromosomal aberrations in SCC samples. A. Schematic presentation of the chromosomal aberrations in SCC. Gains and losses are shown in green en red colors, respectively, as percentage of the total group of 34 SCC cases. Dark green and dark red colors represent high copy amplification and homozygous deletions, respectively. B. Schematic overview of the high copy amplifications and homozygous deletions are shown in green and red colors, respectively. Regions present in at least 10% of the SCC samples are indicated by an arrow, together with a number of candidate (onco)genes located on these regions. 105
9 chapter 6 gene RPII from the average Ct value of the individual selected genes (ΔCt). Next, relative expression levels were defined as 2 ΔCt, resulting in the factor of up- or downregulation between specific samples. Mann-Whitney test was used to assess significant differences in expression levels. Results Common genomic regions in SCC with gain or loss We isolated an LDM area of approximately μm 2 for each SCC case, yielding an average of ~500 ng genomic DNA. We analyzed 34 SCC samples using whole-genome array CGH containing 6,465 BACs to identify copy number aberrations. We found an average number of chromosomal arms presenting with copy number changes of 20.6 ± 6.3. Figure 1A gives a schematic presentation of the chromosomal regions involved in gains and losses. The copy number changes detected in at least 40% of the SCC cases included 6 regions with a gain and 11 regions with a loss (Table 2). Peak incidences were observed in a smaller subregion for some of these regions; i.e. gains of 3q26.2-q27.3 (94%), 5p15.33-p15.2 (53%), 5p14.1-p14.3 (53%), 8q24.3 (44%), 22q11.22-q11.23 (47%), and losses of 3p14.2 (53%), 3p24.3 (47%), 5q14.3-q15 (68%), 5q34 (53%), 9p24.1-p22.3 (44%). Amplifications and homozygous deletions were assessed by those copy number changes that exceeded the thresholds of 0.8 or -0.8, respectively (Figure 1B). Amplifications that were present in at least 10% of SCC samples were located on chromosomal regions 2p15-p16, 3q24-q29, 8p11-p12, 8q23-q24, and 12p12 (Table 3). These regions included several genes, e.g. BCL11A, REL, ECT2, PIK3CA, ADAM9, MYC, and KRAS that might be associated with oncogenesis. A homozygous deletion of 4q33-q34.1 was present in 4 of the 34 cases, but harbored no known genes (Table 3). Table 3. Common (>10%) high copy number amplifications and homozygous deletions in the 34 SCC samples Cytoband Region start (Mb) Length (Mb) Event Number of genes Frequency (%) 2p16.1-p Amplification q25.32-q Amplification p12-p Amplification q23.3-q Amplification p Amplification q33-q Homozygous deletion
10 metastasis-specific acgh profiles in scc For 6 genes (BCL11A, REL, ECT2, PIK3CA, ADAM9, and MYC) we performed qrt-pcr using total RNA from laser microdissected SCC cells to assess if the amplifications were associated with increased expression levels in comparison to SCC without amplification and normal bronchus epithelium (Figure 2). A significantly higher average expression level was observed for four genes (BCL11A, ECT2, PIK3CA, and MYC) in the SCC samples with amplifications as compared to SCC without amplifications. The average expression level was also higher for the other two genes, but this did not reach significance. The expression level was significantly increased for all six genes when compared to normal bronchial epithelial cells. Chromosomal aberrations related to lymph node metastases The average number of chromosomal arms presenting with copy number changes was not significantly different between SCC samples from patients with lymph node metastases (22.9 ± 7.0) and SCC samples from patients without metastases (21.4 ± 6.1). To assess whether there are differences in specific regions with chromosomal aberrations in the primary SCC that are related to the metastatic potential, we compared the acgh profiles (Figure 3A). We observed significant differences in the prevalence of gains at 7q36, 8p12, 10q22 and 12p12. Gains at 7q36, 8p12, 10q22 were restricted to SCC from patients with lymph node metastases, whereas gain at 12p12 was not restricted, but more frequent (13 vs 63%) in SCC from patients with lymph node metastases (Table 4). Loss of 4p14 was observed significantly more frequent in SCC from patients with than without lymph node metastases. There was no significant difference in the prevalence of high copy number amplifications between the groups, whereas homozygous deletions of 4q33-q34.1 occurred in SCC samples of three out of eight patients with lymph node metastases and not in SCC without metastases (Table 5). Chromosomal aberrations related to distant metastasis The average number of chromosomal arms presenting with copy number changes was not significant different between SCC samples from patients with distant metastases (17.7 ± 4.8) and SCC samples from patients without metastases (21.4 ± 6.1). A schematic overview of the chromosomal aberrations related to distant metastases is given in Figure 3B. Significant differences in frequency are observed for gains at 2p16, which is more frequently observed in SCC samples from patients without metastases, 2p12, which is restricted to SCC samples from patients without metastases, and 8q22-q24, which is more frequent in SCC from patients with distant metastases (Table 6). Loss of 11q25 was restricted to SCC from patients without metastases and loss of 8p23 and 13q21 occurred significantly more frequent in 6 107
11 chapter 6 BCL11A (2p16.1) REL (2p13-p12) < Ct 2 - Ct Bronch Epith SCC - ampl SCC + ampl Bronch Epith SCC - ampl SCC + ampl ECT2 (3q26.1-q26.2) PIK3CA (3q26.3) 2 - Ct < Ct < Bronch Epith SCC - ampl SCC + ampl Bronch Epith SCC - ampl SCC + ampl ADAM9 (8p11.23) MYC (8q24.21) Ct Ct Bronch Epith SCC - ampl SCC + ampl 0 + Bronch Epith SCC - ampl SCC + ampl Figure 2. Expression levels of genes in frequently amplified regions. qrt-pcr is used to determine expression levels of a selection of genes located in frequently amplified chromosomal regions. Expression levels were compared between normal bronchial epithelium (Bronch Epith), SCC samples without amplification (SCC - ampl) and SCC with amplification (SCC + ampl) of the region for the specific gene (Mann-Whitney test). 108
12 metastasis-specific acgh profiles in scc SCC from patients with distant metastases. No significant differences were observed when comparing frequencies of amplifications and homozygous deletions. Discussion Generally, patients with lung cancer have a very bad prognosis and many patients will die of metastases to distant organs. In this study, we investigated the presence of chromosomal aberrations in primary SCC in relation to its metastatic potential by using acgh. We selected SCC patients who presented with either exclusively regional lymph node metastases at the time of surgery or who developed exclusively metastases in distant organs within two years after surgery. Several genomic aberrations were observed and, interestingly, some aberrations were significantly restricted to SCC of patients with lymph node metastases only or distant metastases exclusively as compared to SCC samples from patients without metastases. These chromosomal differences may be predictive for metastatic potential and may harbor genes involved in metastatic progression of SCC. Previously, CGH based studies reported common aberration in SCC including gains of chromosomal arms 3q, 5p and 8q and losses of 3p, 5q and 8p 3-7,13. These aberrations were also detected in our study, but at a much higher resolution by using acgh thereby allowing direct identification of the candidate oncogenetic or tumor suppressor genes mapping to these regions 12. Gains on 20p, 22q and losses on 4p, 4q, 9p were previously observed in part of these studies albeit at lower frequencies than in our study. The most likely explanation for this difference is that these in general smaller chromosomal aberrations (< 1 Mb) may have been missed in the studies that applied CGH which has a lower resolution. The fact that we found copy number changes in almost twice as much chromosomal arms as compared to previous studies is in agreement with the much higher resolution of the acgh technique. Furthermore, laser microdissection applied for the vast majority of cases in our study results in a much higher percentage of tumor cells allowing a more reliable detection of copy number changes. So far, only one other acgh study has been reported investigating specifically the SCC subtype 8. The most striking difference is the relative high number of chromosomal arms presenting with copy number changes in our study as compared to the almost completely normal acgh profiles in 7 out of 14 cases in their study. Besides the advantage of the use of LDM in our study, our acgh has a higher resolution, i.e. over 6,000 BACs, in comparison with less than 1,500 BACs in their array. We found several common high copy amplifications (2p15-p16, 3q24-q29, 8p11-p12, 8q23-q24, and 12p12) and one region that was homozygously deleted (4q33-q34.1) in SCC 6 109
13 chapter 6 Table 4. Chromosomal aberrations occurring at significantly different frequencies between SCC from patients without and with lymph node metastases Cytoband Region start (Mb) Length (Mb) Event Number of genes % in no % in lymph node p-value 7q36.2-q Gain p Gain q22.1-q Gain p12.3-p Gain p14.3-p Loss (Figure 1B, Table 3). Several amplifications have been described previously in NSCLC including amplifications on 3q, 8p12, 8q24, and 12p12 6,14. Although previously found as a genomic region with either gain or loss, amplification of 2p15-p16 and homozygous deletion at 4q33-q34.1 as observed in our study have not been reported previously in SCC. This may be related to the fact that most studies do not use LDM to enrich their samples for tumor cells. Admixture of normal cells will lead to less pronounced aberrations in the CGH profile leading to miss interpretation of amplifications or homozygous deletions as regular gain or loss. Furthermore, amplifications and homozygous deletions are relatively small regions, which may be missed by CGH techniques. Homozygous deletions on 3p14.2 and 3p21.3 as observed in several lung cancer derived cell lines and a low percentage of SCC samples were, however, not observed in our study 15,16. Candidate (onco)genes located on the amplicons identified in our study include BCL11A (2p16.1), REL (2p15-2p16.1), epithelial cell transforming sequence 2 oncogene (ECT2) (3q26.31), PIK3CA (3q26.32), ADAM9 (8p11.23), MYC (8q24.21), and KRAS (12p12.1). A strength of our study is that we demonstrated a clear association between overexpression of six of these genes with high copy number amplifications of their corresponding genomic loci. Amplification and overexpression of PIK3CA and MYC has been reported previously in SCC, and of BCL11A and REL in lymphomas Demonstration of a significant association for ECT2 and a trend for ADAM9 between amplification and overexpression has not been reported previously in any type of cancer. Based on the significant association observed in SCC it seems plausible that ECT2 is an interesting candidate in SCC oncogenesis. Previous studies described a higher number of chromosomal arms with copy number changes for SCC that developed lymph node metastases 7,9. In our study, we did not observe significant differences in average number of altered chromosomal arms between SCC groups with lymph node metastasis and the group without any metastasis (22.9 versus 21.4). A possible explanation may be related to the fact that at least in one of these studies the 110
14 metastasis-specific acgh profiles in scc majority of the patients had a N2 stage, whereas in our SCC group most patients had a N1 stage 7. The distribution of N-stages in the other study is unfortunately not clear 9. One of those studies reported loci to be significantly associated with metastases (i.e. gains at 2p, 7p, 20p and losses at 2q, 6p, 16p, 18q, 20q, 21q). These loci were not observed in our study, which may also be related to the previous explanation. We found a significantly higher frequency of gain of 7q36, 8p12, 10q22, and 12p12, loss of 4p14 and homozygous loss of 4q33-q34.1 in SCC from patients with lymph node metastases. These chromosomal regions harbor several genes for which a high expression A 100% 50% 0% 50% significant no lymph node B 100% 50% 0% 50% significant no 6 distant Figure 3. Significant differences in frequency of copy number gains or losses related to metastatic behavior of SCC. A, Comparison plot of frequencies of copy number gains and losses in SCC of patients without metastases versus SCC from patients with lymph node metastases; B, Comparison plot of frequencies of copy number gains and losses in SCC from patients without metastases versus SCC from patients with distant metastases. Gains are shown in green and losses are shown in red. The plots of the frequency differences for the two SCC groups are shown at the top of both figures. Green arrows indicate significant differences in gains between the two SCC groups, red arrows significant differences in losses between the two SCC groups. When the frequency of the gain or loss is higher in the SCC group without metastases, the green and red lines are depicted above the 0% baseline and in case the frequency is higher in the SCC group with metastases the lines are depicted above the 0% baseline. The horizontal bars below the frequency difference plots indicate the significantly different regions. In the lower part of both figures, the frequency plots are shown. Frequency in gains and losses are shown in vertical green en red bars, respectively. Dark green and dark red bars represent high copy amplification and homozygous deletions, respectively. 111
15 chapter 6 has been correlated with general metastatic potential, i.e. SHH (7q36), PSAP (10q22), and PLAU (10q22) Gains on 7q have been described previously in relation to positive lymph nodes in NSCLC and gain of 7q and loss of 4q have been reported to be associated with general metastatic behavior of SCC 6,9. Gains on 8p12, 10q22, and 12p12, and loss on 4p14 are novel genomic aberrations for SCC samples from patients presenting with lymph node metastases. Although loss on 4q has been described previously in relation to metastases in a CGH study, the homozygous loss on 4q33-q34.1 is a new observation in SCC samples from patients presenting with lymph node metastases 9. The pathogenetic significance of this deletion remains uncertain since there are no currently known genes or micrornas located in this region. Table 5. Homozygous deletion occurring at significantly different frequencies between SCC from patients without and with lymph node metastases Cytoband Region start (Mb) Length (Mb) Event Number of genes % in no % in lymph node p-value 4q33-q Homozygous deletion We found a significantly higher frequency of gains of 8q22-q24 and losses of 8p23 and 13q21 in SCC samples of patients developing metastases in distant organs within 2.5 years after resection. Gains of the 8q region have been described in several types of cancer in relation to metastasis, progression, poor prognosis, or survival In NSCLC, gains on 8q have been described to be related to a higher tumor stage which is generally associated with a poorer prognosis 6. However, the primary SCC samples in our study obtained from patients who developed distant metastases have a similar tumor stage as the SCC samples from patients without metastases (Table 1), indicating that 8q is more directly related to the metastatic potential of the primary SCC. Overexpression of potential target genes on the 8q22-q24 region have been reported in several types of epithelial cancers in relation to metastatic potential (CDH17, SPAG1, RAD21, MTBP, and HAS2) and in relation to poor prognosis (LAPTM4B, RPL30, CCNE2, SPAG1, BAALC, WDSOF1, DCC1, and HAS2) 27,30, For 4 genes, POLR2K, PABPC1, YWHA2 and LRP12, gain on 8q has been associated with overexpression Another potentially interesting gene in relation to an increased risk of distant metastases may be angiopoietin (ANGPT1), which is a positive regulator of angiogenesis. Although MYC expression has been previously described in relation to NSCLC metastatic potential, MYC is located just outside the 8q22-q24 region that is significantly related to distant metastases 21,28. Losses of 8p23 and 13q21 have not been reported previously in relation to development of distant metastases in SCC. However, loss 112
16 metastasis-specific acgh profiles in scc Table 6. Chromosomal aberrations occurring at a significantly different frequency between SCC from patients with distant metastases and SCC without metastases Cytoband Region start (Mb) Length (Mb) Event Number of genes % in no % in distant p-value 2p16.2-p Gain p Gain p Gain q Gain q22.1-q Gain q22.2-q Gain q Gain q23.2-q Gain q Gain q23.3-q Gain p ,8 Loss q Loss q21.32-q Loss of 8p is associated with the metastatic phenotype of AC of the lung 41 and correlates with poor prognosis in head and neck SCC, which is closely related to SCC of the lung with respect to etiology and pathogenesis 42. Previously described candidate metastasis suppressor genes on the 8p23 locus are PSD3 and LPL, both showing a reduced expression in breast cancers samples of patients with metastases 43. Whether or not one of the two genes on 13q21 plays a role in development of distant metastases is currently unclear. Interestingly, there were also chromosomal aberrations that were significantly more frequent in SCC samples of patients without distant metastases within a period of five years, i.e. gains of 2p16.2-p16.1, 2p12, and loss of 11q25. These regions may possibly act as a predictor for a relatively good prognosis in patients presenting with SCC. Chromosome 1q has previously been reported to be associated with NSCLC recurrence within one year as compared to those with no recurrence after one year 5. We also found differences in frequency of 1q between SCC samples from patients with or without metastases, although not significant. This discrepancy may be explained by differences related to histological subtype or the time of assessing the presence of distant metastasis. They chose a cut-off of 1 year, while we selected more extreme cut-off time points 6 113
17 chapter 6 for assessing development of metastasis, i.e. within 2 years after surgery or no metastases over a period of 5 years. In summary, we provide a detailed overview of the chromosomal regions with copy number changes in SCC. Application of acgh allows a direct coupling to the copy number changes with the potential target genes. In addition, this study demonstrates significant differences in genomic aberrations of SCC samples from patients presenting with solely lymph node metastasis or with distant metastases exclusively as compared to SCC from patients without any metastases. We found several chromosomal aberrations specific for SCC samples from patients developing distant metastases (gain of 8q23.2-q23.3), whereas others were specific for SCC samples from patients without metastases (gain of 2p12 and loss of 11q25). These loci can be further explored for their potential use as predictive markers in patients with SCC in relation to prognostic outcome. In addition, candidate genes on these loci may contribute to metastatic progression of SCC. Acknowledgements We thank Marnix Jonker, Tineke van der Sluis and Bea Rutgers for their help with laser microdissection. This study was financially supported by the J.K. de Cockstichting and the Spinoza award granted by the Dutch government to prof. D.S. Postma. 114
18 metastasis-specific acgh profiles in scc References Ma J, Gao M, Lu Y et al. Gain of 1q25-32, 12q , and 17q12-22 facilitates tumorigenesis and progression of human squamous cell lung cancer. J Pathol 2006; 210(2): Wistuba II, Behrens C, Milchgrub S et al. Sequential molecular abnormalities are involved in the multistage development of squamous cell lung carcinoma. Oncogene 1999; 18(3): Sy SM, Wong N, Lee TW et al. Distinct patterns of genetic alterations in adenocarcinoma and squamous cell carcinoma of the lung. Eur J Cancer 2004; 40(7): Yakut T, Schulten HJ, Demir A et al. Assessment of molecular events in squamous and non-squamous cell lung carcinoma. Lung Cancer 2006; 54(3): Tai AL, Yan WS, Fang Y, Xie D, Sham JS, Guan XY. Recurrent chromosomal imbalances in nonsmall cell lung carcinoma: the association between 1q amplification and tumor recurrence. Cancer 2004; 100(9): Pei J, Balsara BR, Li W et al. Genomic imbalances in human lung adenocarcinomas and squamous cell carcinomas. Genes Chromosomes Cancer 2001; 31(3): Chujo M, Noguchi T, Miura T, Arinaga M, Uchida Y, Tagawa Y. Comparative genomic hybridization analysis detected frequent overrepresentation of chromosome 3q in squamous cell carcinoma of the lung. Lung Cancer 2002; 38(1): Choi YW, Choi JS, Zheng LT et al. Comparative genomic hybridization array analysis and real time PCR reveals genomic alterations in squamous cell carcinomas of the lung. Lung Cancer 2007; 55(1): Yan W, Song L, Liang Q, Fang Y. Progression analysis of lung squamous cell carcinomas by comparative genomic hybridization. Tumour Biol 2005; 26(3): Emmert-Buck MR, Bonner RF, Smith PD et al. Laser capture microdissection. Science 1996; 274(5289): Atayar C, Kok K, Kluiver J et al. BCL6 alternative breakpoint region break and homozygous deletion of 17q24 in the nodular lymphocyte predominance type of Hodgkin s lymphoma-derived cell line DEV. Hum Pathol 2006; 37(6): Kok K, Dijkhuizen T, Swart YE et al. Application of a comprehensive subtelomere array in clinical diagnosis of mental retardation. Eur J Med Genet 2005; 48(3): Petersen I, Bujard M, Petersen S et al. Patterns of chromosomal imbalances in adenocarcinoma and squamous cell carcinoma of the lung. Cancer Res 1997; 57(12): Balsara BR, Sonoda G, du Manoir S, Siegfried JM, Gabrielson E, Testa JR. Comparative genomic hybridization analysis detects frequent, often high-level, overrepresentation of DNA sequences at 3q, 5p, 7p, and 8q in human non-small cell lung carcinomas. Cancer Res 1997; 57(11): Todd S, Franklin WA, Varella-Garcia M et al. Homozygous deletions of human chromosome 3p in lung tumors. Cancer Res 1997; 57(7): Yamakawa K, Takahashi T, Horio Y et al. Frequent homozygous deletions in lung cancer cell lines detected by a DNA marker located at 3p21.3-p22. Oncogene 1993; 8(2): Martin-Subero JI, Gesk S, Harder L et al. Recurrent involvement of the REL and BCL11A loci in classical Hodgkin lymphoma. Blood 2002; 99(4): Angulo B, Suarez-Gauthier A, Lopez-Rios F et al. Expression signatures in lung cancer reveal a profile for EGFRmutant tumours and identify selective PIK3CA overexpression by gene amplification. J Pathol 2008; 214(3): Racz A, Brass N, Heckel D, Pahl S, Remberger K, Meese E. Expression analysis of genes at 3q26-q27 involved in frequent amplification in squamous cell lung carcinoma. Eur J Cancer 1999; 35(4): Kawano O, Sasaki H, Okuda K et al. PIK3CA gene amplification in Japanese non-small cell lung cancer. Lung Cancer 2007; 58(1):
19 Volm M, Drings P, Wodrich W, van Kaick G. Expression of oncoproteins in primary human non-small cell lung cancer and incidence of metastases. Clin Exp Metastasis 1993; 11(4): Bailey JM, Singh PK, Hollingsworth MA. Cancer metastasis facilitated by developmental pathways: Sonic hedgehog, Notch, and bone morphogenic proteins. J Cell Biochem 2007; 102(4): Koochekpour S, Zhuang YJ, Beroukhim R et al. Amplification and overexpression of prosaposin in prostate cancer. Genes Chromosomes Cancer 2005; 44(4): Krupitza G, Grill S, Harant H et al. Genes related to growth and invasiveness are repressed by sodium butyrate in ovarian carcinoma cells. Br J Cancer 1996; 73(4): Tada K, Oka M, Tangoku A, Hayashi H, Oga A, Sasaki K. Gains of 8q23-qter and 20q and loss of 11q22-qter in esophageal squamous cell carcinoma associated with lymph node metastasis. Cancer 2000; 88(2): Alers JC, Rochat J, Krijtenburg PJ et al. Identification of genetic markers for prostatic cancer progression. Lab Invest 2000; 80(6): Chin SF, Teschendorff AE, Marioni JC et al. High-resolution acgh and expression profiling identifies a novel genomic subtype of ER negative breast cancer. Genome Biol 2007; 8(10):R215. Kubokura H, Tenjin T, Akiyama H et al. Relations of the c-myc gene and chromosome 8 in non-small cell lung cancer: analysis by fluorescence in situ hybridization. Ann Thorac Cardiovasc Surg 2001; 7(4): Oue N, Hamai Y, Mitani Y et al. Gene expression profile of gastric carcinoma: identification of genes and tags potentially involved in invasion, metastasis, and carcinogenesis by serial analysis of gene expression. Cancer Res 2004; 64(7): Neesse A, Gangeswaran R, Luettges J et al. Sperm-associated antigen 1 is expressed early in pancreatic tumorigenesis and promotes motility of cancer cells. Oncogene 2007; 26(11): Yamamoto G, Irie T, Aida T, Nagoshi Y, Tsuchiya R, Tachikawa T. Correlation of invasion and metastasis of cancer cells, and expression of the RAD21 gene in oral squamous cell carcinoma. Virchows Arch 2006; 448(4): Iwakuma T, Tochigi Y, Van Pelt CS et al. Mtbp haploinsufficiency in mice increases tumor metastasis. Oncogene 2008; 27(13): Yamada Y, Itano N, Narimatsu H et al. Elevated transcript level of hyaluronan synthase1 gene correlates with poor prognosis of human colon cancer. Clin Exp Metastasis 2004; 21(1): Zhou L, He XD, Cui QC et al. Expression of LAPTM4B-35: A novel marker of progression, invasiveness and poor prognosis of extrahepatic cholangiocarcinoma. Cancer Lett 2008; 264(2): De Bortoli M, Castellino RC, Lu XY et al. Medulloblastoma outcome is adversely associated with overexpression of EEF1D, RPL30, and RPS20 on the long arm of chromosome 8. BMC Cancer 2006; 6:223. Desmedt C, Ouriaghli FE, Durbecq V et al. Impact of cyclins E, neutrophil elastase and proteinase 3 expression levels on clinical outcome in primary breast cancer patients. Int J Cancer 2006; 119(11): Langer C, Radmacher MD, Ruppert AS et al. High BAALC expression associates with other molecular prognostic markers, poor outcome and a distinct gene-expression signature in cytogenetically normal acute myeloid leukemia: a Cancer and Leukemia Group B (CALGB) study. Blood Garnis C, Coe BP, Zhang L, Rosin MP, Lam WL. Overexpression of LRP12, a gene contained within an 8q22 amplicon identified by high-resolution array CGH analysis of oral squamous cell carcinomas. Oncogene 2004; 23(14): Heidenblad M, Lindgren D, Jonson T et al. Tiling resolution array CGH and high density expression profiling of urothelial carcinomas delineate genomic amplicons and candidate target genes specific for advanced tumors. BMC Med Genomics 2008; 1:3. van Duin M, van Marion R, Vissers K et al. High-resolution array comparative genomic hybridization of chromosome arm 8q: evaluation of genetic progression markers for prostate cancer. Genes Chromosomes Cancer 2005; 44(4):
20 metastasis-specific acgh profiles in scc Goeze A, Schluns K, Wolf G, Thasler Z, Petersen S, Petersen I. Chromosomal imbalances of primary and metastatic lung adenocarcinomas. J Pathol 2002; 196(1):8-16. Bockmuhl U, Ishwad CS, Ferrell RE, Gollin SM. Association of 8p23 deletions with poor survival in head and neck cancer. Otolaryngol Head Neck Surg 2001; 124(4): Thomassen M, Tan Q, Kruse TA. Gene expression meta-analysis identifies chromosomal regions and candidate genes involved in breast cancer metastasis. Breast Cancer Res Treat
21
University of Groningen
University of Groningen Dysregulation of transcription and cytokine networks in Hodgkin lymphomas with a focus on nodular lymphocyte predominance type of Hodgkin lymphoma Atayar, Cigdem IMPORTANT NOTE:
More informationCharacterization of the 11q13.3 amplicon in head and neck squamous cell carcinoma Gibcus, Johan Harmen
University of Groningen Characterization of the 11q13.3 amplicon in head and neck squamous cell carcinoma Gibcus, Johan Harmen IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationCitation for published version (APA): Bleeker, W. A. (2001). Therapeutic considerations in Dukes C colon cancer s.n.
University of Groningen Therapeutic considerations in Dukes C colon cancer Bleeker, Willem Aldert IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite
More informationSUPPLEMENTARY INFORMATION
doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured
More informationRNA preparation from extracted paraffin cores:
Supplementary methods, Nielsen et al., A comparison of PAM50 intrinsic subtyping with immunohistochemistry and clinical prognostic factors in tamoxifen-treated estrogen receptor positive breast cancer.
More informationImproving quality of care for patients with ovarian and endometrial cancer Eggink, Florine
University of Groningen Improving quality of care for patients with ovarian and endometrial cancer Eggink, Florine IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if
More informationRole of multidrug resistance-associated protein 1 in airway epithelium van der Deen, Margaretha
University of Groningen Role of multidrug resistance-associated protein 1 in airway epithelium van der Deen, Margaretha IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF)
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationCytogenetics 101: Clinical Research and Molecular Genetic Technologies
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these
More informationProfiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola
Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the
More informationTable S2. Expression of PRMT7 in clinical breast carcinoma samples
Table S2. Expression of PRMT7 in clinical breast carcinoma samples (All data were obtained from cancer microarray database Oncomine.) Analysis type* Analysis Class(number sampels) 1 2 3 4 Correlation (up/down)#
More informationSupplementary Figure 1: Comparison of acgh-based and expression-based CNA analysis of tumors from breast cancer GEMMs.
Supplementary Figure 1: Comparison of acgh-based and expression-based CNA analysis of tumors from breast cancer GEMMs. (a) CNA analysis of expression microarray data obtained from 15 tumors in the SV40Tag
More informationDownregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases
Brief Communication Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Qinghai Zeng 1 *, Cuihong Jin 2 *, Wenhang Chen 2, Fang Xia 3, Qi Wang 3, Fan Fan 4,
More informationAssessment of Breast Cancer with Borderline HER2 Status Using MIP Microarray
Assessment of Breast Cancer with Borderline HER2 Status Using MIP Microarray Hui Chen, Aysegul A Sahin, Xinyan Lu, Lei Huo, Rajesh R Singh, Ronald Abraham, Shumaila Virani, Bal Mukund Mishra, Russell Broaddus,
More informationMicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL
MicroRNA expression profiling and functional analysis in prostate cancer Marco Folini s.c. Ricerca Traslazionale DOSL What are micrornas? For almost three decades, the alteration of protein-coding genes
More informationThe diagnostic and prognostic value of genetic aberrations in resectable distal bile duct cancer Rijken, A.M.
UvA-DARE (Digital Academic Repository) The diagnostic and prognostic value of genetic aberrations in resectable distal bile duct cancer Rijken, A.M. Link to publication Citation for published version (APA):
More informationUniversity of Groningen. Hidradenitis suppurativa Dickinson-Blok, Janine Louise
University of Groningen Hidradenitis suppurativa Dickinson-Blok, Janine Louise IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check
More informationCharacterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
More informationProducts for cfdna and mirna isolation. Subhead Circulating Cover nucleic acids from plasma
MACHEREY-NAGEL Products for cfdna and mirna isolation Bioanalysis Subhead Circulating Cover nucleic acids from plasma n Flexible solutions for small and large blood plasma volumes n Highly efficient recovery
More informationMRC-Holland MLPA. Description version 06; 23 December 2016
SALSA MLPA probemix P417-B2 BAP1 Lot B2-1216. As compared to version B1 (lot B1-0215), two reference probes have been added and two target probes have a minor change in length. The BAP1 (BRCA1 associated
More informationCancers of unknown primary : Knowing the unknown. Prof. Ahmed Hossain Professor of Medicine SSMC
Cancers of unknown primary : Knowing the unknown Prof. Ahmed Hossain Professor of Medicine SSMC Definition Cancers of unknown primary site (CUPs) Represent a heterogeneous group of metastatic tumours,
More informationIntegrated Analysis of Copy Number and Gene Expression
Integrated Analysis of Copy Number and Gene Expression Nexus Copy Number provides user-friendly interface and functionalities to integrate copy number analysis with gene expression results for the purpose
More informationImpact of Prognostic Factors
Melanoma Prognostic Factors: where we started, where are we going? Impact of Prognostic Factors Staging Management Surgical intervention Adjuvant treatment Suraj Venna, MD Assistant Clinical Professor,
More informationa) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
More informationRNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers
Xu et al. Molecular Cancer (2019) 18:8 https://doi.org/10.1186/s12943-018-0932-8 LETTER TO THE EDITOR RNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers
More informationExpressArt FFPE Clear RNAready kit
Features and Example Results General problems with FFPE samples Formalin-fixation of tissues results in severe RNA fragmentation, as well as in RNA RNA, RNA-DNA and RNA protein cross-linking, which impairs
More informationUniversity of Groningen. BNP and NT-proBNP in heart failure Hogenhuis, Jochem
University of Groningen BNP and NT-proBNP in heart failure Hogenhuis, Jochem IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Fig. 1: Quality assessment of formalin-fixed paraffin-embedded (FFPE)-derived DNA and nuclei. (a) Multiplex PCR analysis of unrepaired and repaired bulk FFPE gdna from
More informationMAPK Pathway. CGH Next Generation Sequencing. Molecular Tools in Care of Patients with Pigmented Lesions 7/20/2017
Molecular Tools in Care of Patients with Pigmented Lesions Tammie Ferringer, MD Geisinger Medical Center, Danville, PA tferringer@geisinger.edu DISCLOSURE OF RELATIONSHIPS WITH INDUSTRY Tammie Ferringer,
More informationdeveloping new tools for diagnostics Join forces with IMGM Laboratories to make your mirna project a success
micrornas developing new tools for diagnostics Join forces with IMGM Laboratories to make your mirna project a success Dr. Carola Wagner IMGM Laboratories GmbH Martinsried, Germany qpcr 2009 Symposium
More information7/6/2015. Cancer Related Deaths: United States. Management of NSCLC TODAY. Emerging mutations as predictive biomarkers in lung cancer: Overview
Emerging mutations as predictive biomarkers in lung cancer: Overview Kirtee Raparia, MD Assistant Professor of Pathology Cancer Related Deaths: United States Men Lung and bronchus 28% Prostate 10% Colon
More informationmirna Dr. S Hosseini-Asl
mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region
More informationType of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationof TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed.
Supplementary Note The potential association and implications of HBV integration at known and putative cancer genes of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed. Human telomerase
More informationThe significance of Helicobacter pylori in the approach of dyspepsia in primary care Arents, Nicolaas Lodevikus Augustinus
University of Groningen The significance of Helicobacter pylori in the approach of dyspepsia in primary care Arents, Nicolaas Lodevikus Augustinus IMPORTANT NOTE: You are advised to consult the publisher's
More informationIdentification of Novel Variant of EML4-ALK Fusion Gene in NSCLC: Potential Benefits of the RT-PCR Method
International journal of Biomedical science ORIGINAL ARTICLE Identification of Novel Variant of EML4-ALK Fusion Gene in NSCLC: Potential Benefits of the RT-PCR Method Martin K. H. Maus 1, 2, Craig Stephens
More informationLow levels of serum mir-99a is a predictor of poor prognosis in breast cancer
Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer J. Li 1, Z.J. Song 2, Y.Y. Wang 1, Y. Yin 1, Y. Liu 1 and X. Nan 1 1 Tumor Research Department, Shaanxi Provincial Tumor Hospital,
More informationThe Pathology of Neoplasia Part II
The Pathology of Neoplasia Part II February 2018 PAUL BOGNER, MD A S S O C I A T E P R O F E S S O R O F O N C O L O G Y P A T H O L O G Y A N D D E R M A T O L O G Y Clinical goals of cancer pathology
More informationCHROMOSOMAL MICROARRAY (CGH+SNP)
Chromosome imbalances are a significant cause of developmental delay, mental retardation, autism spectrum disorders, dysmorphic features and/or birth defects. The imbalance of genetic material may be due
More informationGastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR
Gastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR Pages with reference to book, From 305 To 307 Irshad N. Soomro,Samina Noorali,Syed Abdul Aziz,Suhail Muzaffar,Shahid
More informationUniversity of Groningen. Real-world influenza vaccine effectiveness Darvishian, Maryam
University of Groningen Real-world influenza vaccine effectiveness Darvishian, Maryam IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please
More informationSupplementary webappendix
Supplementary webappendix This webappendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Kratz JR, He J, Van Den Eeden SK, et
More informationmicrorna Presented for: Presented by: Date:
microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions
More informationComputer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015
Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a
More informationMultifocal Lung Cancer
Multifocal Lung Cancer P. De Leyn, MD, PhD Department of Thoracic Surgery University Hospitals Leuven Belgium LEUVEN LUNG CANCER GROUP Department of Thoracic Surgery Department of Pneumology Department
More informationSupplementary Online Content
Supplementary Online Content Fumagalli D, Venet D, Ignatiadis M, et al. RNA Sequencing to predict response to neoadjuvant anti-her2 therapy: a secondary analysis of the NeoALTTO randomized clinical trial.
More informationChallenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014
Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical
More informationUniversity of Groningen. The microenvironment of Hodgkin lymphoma Sattarzadeh, Ahmad
University of Groningen The microenvironment of Hodgkin lymphoma Sattarzadeh, Ahmad IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please
More informationDetection of Anaplastic Lymphoma Kinase (ALK) gene in Non-Small Cell lung Cancer (NSCLC) By CISH Technique
Cancer and Clinical Oncology; Vol. 7, No. 1; 2018 ISSN 1927-4858 E-ISSN 1927-4866 Published by Canadian Center of Science and Education Detection of Anaplastic Lymphoma Kinase (ALK) gene in Non-Small Cell
More informationExpression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer
European Review for Medical and Pharmacological Sciences 2018; 22: 5525-5530 Expression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer Y.-X. SHI, B.-L. YE, B.-R. HU, X.-J.
More informationCorporate Medical Policy
Corporate Medical Policy Microarray-based Gene Expression Testing for Cancers of Unknown File Name: Origination: Last CAP Review: Next CAP Review: Last Review: microarray-based_gene_expression_testing_for_cancers_of_unknown_primary
More informationNew treatment strategies in myelodysplastic syndromes and acute myeloid leukemia van der Helm, Lidia Henrieke
University of Groningen New treatment strategies in myelodysplastic syndromes and acute myeloid leukemia van der Helm, Lidia Henrieke IMPORTANT NOTE: You are advised to consult the publisher's version
More informationBin Liu, Lei Yang, Binfang Huang, Mei Cheng, Hui Wang, Yinyan Li, Dongsheng Huang, Jian Zheng,
The American Journal of Human Genetics, Volume 91 Supplemental Data A Functional Copy-Number Variation in MAPKAPK2 Predicts Risk and Survival of Lung Cancer Bin Liu, Lei Yang, Binfang Huang, Mei Cheng,
More informationSALSA MLPA KIT P078-B1 Breast Tumour Lot 0210, 0109
SALSA MLPA KIT P078-B1 Breast Tumour Lot 0210, 0109 This P078-B1 Breast Tumour probemix contains probes for several genes (including ERBB2, BIRC5, MYC, TOP2A, ESR1, MTDH, CCND1, CCNE1, EGFR and C11orf30)
More informationWHAT SHOULD WE DO WITH TUMOUR BUDDING IN EARLY COLORECTAL CANCER?
CANCER STAGING TNM and prognosis in CRC WHAT SHOULD WE DO WITH TUMOUR BUDDING IN EARLY COLORECTAL CANCER? Alessandro Lugli, MD Institute of Pathology University of Bern Switzerland Maastricht, June 19
More informationValue of serum galectin-3 and midkine level determination for assessing tumor severity in patients with thyroid cancer
148 Journal of Hainan Medical University 2017; 23(3): 148-152 Journal of Hainan Medical University http://www.hnykdxxb.com Value of serum galectin-3 and midkine level determination for assessing tumor
More informationApplications of IHC. Determination of the primary site in metastatic tumors of unknown origin
Applications of IHC Determination of the primary site in metastatic tumors of unknown origin Classification of tumors that appear 'undifferentiated' by standard light microscopy Precise classification
More informationTowards a more personalized approach in the treatment of esophageal cancer focusing on predictive factors in response to chemoradiation Wang, Da
University of Groningen Towards a more personalized approach in the treatment of esophageal cancer focusing on predictive factors in response to chemoradiation Wang, Da IMPORTANT NOTE: You are advised
More informationp.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11
ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N
More informationRD-100i OSNA the new generation of sentinel lymph node analysis in breast cancer
RD-1i OSNA the new generation of sentinel lymph node analysis in breast cancer RD-1i OSNA the new generation of sentinel lymph node analysis in breast cancer Sentinel node biopsy has rapidly emerged as
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature8645 Physical coverage (x haploid genomes) 11 6.4 4.9 6.9 6.7 4.4 5.9 9.1 7.6 125 Neither end mapped One end mapped Chimaeras Correct Reads (million ns) 1 75 5 25 HCC1187 HCC1395 HCC1599
More informationCellecta Overview. Started Operations in 2007 Headquarters: Mountain View, CA
Cellecta Overview Started Operations in 2007 Headquarters: Mountain View, CA Focus: Development of flexible, scalable, and broadly parallel genetic screening assays to expedite the discovery and characterization
More informationMEDICAL POLICY Gene Expression Profiling for Cancers of Unknown Primary Site
POLICY: PG0364 ORIGINAL EFFECTIVE: 04/22/16 LAST REVIEW: 07/26/18 MEDICAL POLICY Gene Expression Profiling for Cancers of Unknown Primary Site GUIDELINES This policy does not certify benefits or authorization
More informationCharacterization and significance of MUC1 and c-myc expression in elderly patients with papillary thyroid carcinoma
Characterization and significance of MUC1 and c-myc expression in elderly patients with papillary thyroid carcinoma Y.-J. Hu 1, X.-Y. Luo 2, Y. Yang 3, C.-Y. Chen 1, Z.-Y. Zhang 4 and X. Guo 1 1 Department
More informationPatnaik SK, et al. MicroRNAs to accurately histotype NSCLC biopsies
Patnaik SK, et al. MicroRNAs to accurately histotype NSCLC biopsies. 2014. Supplemental Digital Content 1. Appendix 1. External data-sets used for associating microrna expression with lung squamous cell
More informationA novel and universal method for microrna RT-qPCR data normalization
A novel and universal method for microrna RT-qPCR data normalization Jo Vandesompele professor, Ghent University co-founder and CEO, Biogazelle 4 th International qpcr Symposium Weihenstephan, March 1,
More informationBiochemistry of Carcinogenesis. Lecture # 35 Alexander N. Koval
Biochemistry of Carcinogenesis Lecture # 35 Alexander N. Koval What is Cancer? The term "cancer" refers to a group of diseases in which cells grow and spread unrestrained throughout the body. It is difficult
More informationEvolution of Pathology
1 Traditional pathology Molecular pathology 2 Evolution of Pathology Gross Pathology Cellular Pathology Morphologic Pathology Molecular/Predictive Pathology Antonio Benivieni (1443-1502): First autopsy
More informationFISH mcgh Karyotyping ISH RT-PCR. Expression arrays RNA. Tissue microarrays Protein arrays MS. Protein IHC
Classification of Breast Cancer in the Molecular Era Susan J. Done University Health Network, Toronto Why classify? Prognosis Prediction of response to therapy Pathogenesis Invasive breast cancer can have
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*
More information(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
More informationUSCAP 2012: Companion Meeting of the AAOOP. Update on lacrimal gland neoplasms: Molecular pathology of interest
USCAP 2012: Companion Meeting of the AAOOP Vancouver BC, Canada, March 17, 2012 Update on lacrimal gland neoplasms: Molecular pathology of interest Valerie A. White MD, MHSc, FRCPC Department of Pathology
More informationCitation for published version (APA): Weert, E. V. (2007). Cancer rehabilitation: effects and mechanisms s.n.
University of Groningen Cancer rehabilitation Weert, Ellen van IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the document
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationTriple Negative Breast Cancer
Triple Negative Breast Cancer Prof. Dr. Pornchai O-charoenrat Division of Head-Neck & Breast Surgery Department of Surgery Faculty of Medicine Siriraj Hospital Breast Cancer Classification Traditional
More informationVirtual Journal Club: Front-Line Therapy and Beyond Recent Perspectives on ALK-Positive Non-Small Cell Lung Cancer.
Virtual Journal Club: Front-Line Therapy and Beyond Recent Perspectives on ALK-Positive Non-Small Cell Lung Cancer Reference Slides ALK Rearrangement in NSCLC ALK (anaplastic lymphoma kinase) is a receptor
More informationCitation for published version (APA): Francken, A. B. (2007). Primary and metastatic melanoma: aspects of follow-up and staging s.n.
University of Groningen Primary and metastatic melanoma Francken, Anne Brecht IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check
More informationPrenatal Diagnosis: Are There Microarrays in Your Future?
Financial Disclosure UCSF Antepartum Intrapartum Management Course June 8 I have no financial relationship with any aspect of private industry Prenatal Diagnosis: Are There Microarrays in Your Future?
More information3/23/2017. Disclosure of Relevant Financial Relationships. Pathologic Staging Updates in Lung Cancer T STAGE OUTLINE SURVIVAL ACCORDING TO SIZE ONLY
Pathologic Staging Updates in Lung Cancer Disclosure of Relevant Financial Relationships USCAP requires that all planners (Education Committee) in a position to influence or control the content of CME
More information> 6000 Mutations in Melanoma. Tests That Cay Be Employed. FISH for Additions/Deletions. Comparative Genomic Hybridization
Winter Clinical 2017: The Assessment and Diagnosis of Melanoma Whitney A. High, MD, JD, MEng Associate Professor, Dermatology & Pathology Director of Dermatopathology (Dermatology) University of Colorado
More informationSupplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the
Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the deep dermis. (b) The melanocytes demonstrate abundant
More informationGenerating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University
Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic
More informationMir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer
European Review for Medical and Pharmacological Sciences 2017; 21: 4278-4282 Mir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer Q.-H. ZHOU 1, Y.-M. ZHAO 2, L.-L.
More informationPET Imaging of Mild Traumatic Brain Injury and Whiplash Associated Disorder Vállez García, David
University of Groningen PET Imaging of Mild Traumatic Brain Injury and Whiplash Associated Disorder Vállez García, David IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's
More informationPlasma Bmil mrna as a potential prognostic biomarker for distant metastasis in colorectal cancer patients
Title Plasma Bmil mrna as a potential prognostic biomarker for distant metastasis in colorectal cancer patients Author(s) Pun, JC; Chan, JY; Chun, BK; Ng, KW; Tsui, SY; Wan, TMH; Lo, OSH; Poon, TCJ; Ng,
More informationHPV and Head and Neck Cancer: What it means for you and your patients
HPV and Head and Neck Cancer: What it means for you and your patients Financial Disclosure: None November 8, 2013 Steven J. Wang, MD Associate Professor Department of Otolaryngology-Head and Neck Surgery
More informationGenomic Medicine: What every pathologist needs to know
Genomic Medicine: What every pathologist needs to know Stephen P. Ethier, Ph.D. Professor, Department of Pathology and Laboratory Medicine, MUSC Director, MUSC Center for Genomic Medicine Genomics and
More informationMolecular Genetics of Paediatric Tumours. Gino Somers MBBS, BMedSci, PhD, FRCPA Pathologist-in-Chief Hospital for Sick Children, Toronto, ON, CANADA
Molecular Genetics of Paediatric Tumours Gino Somers MBBS, BMedSci, PhD, FRCPA Pathologist-in-Chief Hospital for Sick Children, Toronto, ON, CANADA Financial Disclosure NanoString - conference costs for
More informationMaram Abdaljaleel, MD Dermatopathologist and Neuropathologist University of Jordan, School of Medicine
Maram Abdaljaleel, MD Dermatopathologist and Neuropathologist University of Jordan, School of Medicine The most common non-skin malignancy of women 2 nd most common cause of cancer deaths in women, following
More informationLecture 1: Carcinogenesis
Lecture 1: Carcinogenesis Anti-cancer (oncology agents): These are perhaps the most dangerous of drugs, other than the narcotic analgesics. This is due to their toxicities. Killing or inhibiting cancer
More informationSALSA MLPA probemix P315-B1 EGFR
SALSA MLPA probemix P315-B1 EGFR Lot B1-0215 and B1-0112. As compared to the previous A1 version (lot 0208), two mutation-specific probes for the EGFR mutations L858R and T709M as well as one additional
More informationCanadian College of Medical Geneticists (CCMG) Cytogenetics Examination. May 4, 2010
Canadian College of Medical Geneticists (CCMG) Cytogenetics Examination May 4, 2010 Examination Length = 3 hours Total Marks = 100 (7 questions) Total Pages = 8 (including cover sheet and 2 pages of prints)
More informationUniversity of Groningen. Acantholysis in pemphigus van der Wier, Gerda
University of Groningen Acantholysis in pemphigus van der Wier, Gerda IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check the
More informationTITLE: Prostate Expression Databases: Gene Expression Resources for Comparative Studies of Prostate Carcinogenesis
AD Award Number: W81XWH-05-1-0110 TITLE: Prostate Expression Databases: Gene Expression Resources for Comparative Studies of Prostate Carcinogenesis PRINCIPAL INVESTIGATOR: Peter S. Nelson, Ph.D. CONTRACTING
More informationROLE OF TGF-BETA SIGNALING IN PIK3CA-
ROLE OF TGF-BETA SIGNALING IN - DRIVEN HEAD AND NECK CANCER INVASION AND METASTASIS 1,2 Sophia Bornstein, 3 Jingping Shen, 3 Jacob Minor, 3 Frank Hall, 3 Fang Zhang, 4 Sherif Said, 4 Xiao-Jing Wang, 1
More informationUniversity of Groningen. Mutational landscape of Hodgkin lymphoma Abdul Razak, Fazlyn Reeny Binti
University of Groningen Mutational landscape of Hodgkin lymphoma Abdul Razak, Fazlyn Reeny Binti IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite
More informationRD-100i OSNA the new generation of sentinel lymph node analysis in breast cancer
RD-1i OSNA the new generation of sentinel lymph node analysis in breast cancer www.sysmex-europe.com RD-1i OSNA the new generation of sentinel lymph node analysis in breast cancer Sentinel node biopsy
More informationRole of FISH in Hematological Cancers
Role of FISH in Hematological Cancers Thomas S.K. Wan PhD,FRCPath,FFSc(RCPA) Honorary Professor, Department of Pathology & Clinical Biochemistry, Queen Mary Hospital, University of Hong Kong. e-mail: wantsk@hku.hk
More information