Milk micro-rna information and lactation
|
|
- Clifford Wilkinson
- 6 years ago
- Views:
Transcription
1 Christophe Lefèvre, BioDeakin,. Deakin University, Geelong VIC Australia Milk micro-rna information and lactation New Signals in milk? - Markers of milk and lactation status? - Signal infant development? Comparative analysis of milk mirna data
2 Biogenesis of mirna ~22 nt (18-24) MicroRNAs are produced from either their own genes or from introns.
3 Mode of Action of mirnas *RISC: RNA-induced silencing complex
4 Function of mirnas MiRNAs constitute an important new class of regulatory bio-molecules. implicated, through their broad post transcriptional inhibitory effect on gene expression in the control of : Differentiation metabolism cell morphology polarity migration signal transduction cellular communication organogenesis developmental processes * Found in most multicellular organism (also found in green alga Chlamydomonas reinhardtii, casting shadow on previous suggestions that mirnas might have helped to drive evolution to a multicellular state, Chen et. Al. Genes Dev. 21, (2007)).
5 Biogenesis of secreted mirnas
6 exosome signalling Blood coagulation - Inflammation -Tumor growth (EGFRvIII) -Cell invasion through ECM remodeling (MMPs) Antigen presentation Neuron gene transfer => Alternative secretion of proteins Shuttle for RNA, proteins, infectious agents: Shuttle for mirnas (function still to be established)?
7 Identification of human milk mirnas The MicroRNA Spectrum in 12 Body Fluids J. A. Weber, D. H. Baxter, S. Zhang, D. Y. Huang, K. H. Huang, Ming Jen Lee, D. J. Galas and K. Wang. Clinical Chemistry 56:11 and Genetics (2010) - MicroRNAs are ubiquitous in all the body fluid types tested. - Fluid type specific mirnas may have functional roles associated with the surrounding tissues. * mir-518c* was uniquely detected in breast milk and is also highly expressed in the placenta
8 Identification of human milk mirnas microrna as a new immune-regulatory agent in breast milk. Kosaka et al.. Silence 2010, 1:7 - high expression levels of immune-related mirnas in the first 6 months of lactation. - mirnas are stable even in very acidic conditions, indicating that breast milk allows dietary intake of mirnas by infants. - Present in CD63 micro-vesicle exosome fraction =>breast milk may modulate the development of the infant's immune system. =>suggests the transfer of genetic material as mirna from human to human occurs by means other than through sexual reproduction.
9 Specificity of milk mirna Immune-related mirna levels in human breast milk (n = 5) and serum (n = 6) of healthy subjects measured by qrt-pcr. Kosaka et al. Silence :7 doi: / x-1-7
10 mirnas in bovine milk Identification and characterization of micrornas in raw milk during different periods of lactation, commercial fluid, and powdered milk products. Chen et. Al, Cell research mirnas in raw milk - individual mirnas can be significantly altered during lactation process - may be a more accurate indicator to reflect the quality alteration of milk -7 mirnas that have a relatively consistent expression throughout lactation expression profile of these 7milk-specific mirnas can serve as an ideal biomarker for discriminating poor-quality or manipulated milk from pure raw milk, as well as for the quality control of commercial milk products, such as fluid milk and powdered formula milk. The findings provide a basis for understanding the physiological role of milk mirnas and a new potential standard for determining the quality of raw milk or milk-related commercial products.
11 Identification of milk mirnas bovine milk Isolation of bovine milk-derived microvesicles carrying mrnas and micrornas. Hata et. Al, BBRC , and 1000 ng of total RNA, in which small RNAs were major components, was contained inside the microvesicles isolated from 6 ml of colostrum and mature milk, despite high RNase activity in the milk. - Moreover, a considerable amount of mammary gland and immune-related micrornas were present in the milk-derived microvesicles. - Acidification of milk to mimic gastrointestinal tract did not mostly affected RNA yield and quality. - The milk related gene transcripts were detected in cultured cells when incubated with milk-derived microvesicles, suggesting cellular uptake of the microvesicle RNA contents. Our findings suggest that bovine breast milk contains RNAs capable for being transferred to living cells and involved in the development of calf s gastrointestinal and immune systems.
12 Role of mirnas in mammary gland development Characterisation of microrna expression in post-natal mouse mammary gland development. S. Avril-Sassen et. al. BMC Genomics 2009, 10:548 - One third (n = 102) of all murine mirnas analysed were detected during mammary gland development - MicroRNAs were expressed in likely co-regulated clusters during mammary gland development. Breast cancer-associated mirnas were significantly enriched in these clusters. The mechanism and functional consequences of this mirna coregulation provide new avenues for research into mammary gland biology and generate candidates for functional validation. mir-212 and mir-132 are required for epithelial stromal interactions necessary for mouse mammary gland development. A. Ucar et. Al. NATURE GENETICS VOLUME 42 NUMBER 12 DECEMBER via regulation of stromal MMP-9 production. A microrna, mir-101a, controls mammary gland development by regulating cyclooxygenase-2 expression. Tanaka et. Al. Differentiation, Volume 77, Issue 2, February 2009, Pages MiR-126-3p regulates progesterone receptors and involves development and lactation of mouse mammary gland. Wei Cui, Qingzhang Li, Li Feng and Wei Ding. MOLECULAR AND CELLULAR BIOCHEMISTRY Volume 355, Numbers 1-2, mir-214 regulates Lactoferrin expression and pro-apoptotic function in mammary epithelial cells. Y. Liao et. Al. Journal of Nutrition, 2010 p Selective release of microrna species from normal and malignant mammary epithelial cells. L. Pigatiet. Al. PLOS one Volume 5, 10 p, 2010 p 1552.
13 Plant food mirna is detected in blood and regulate gene expression Exogenous plant MIR168a specifically targets mammalian LDLRAP1: evidence of cross-kingdom regulation by microrna.lin Zhang et al. Cell Research (2011) : mirnas from plants detected in human, cow and mice serum (5% of sequences) mir168a and mir156a 0.5% of total serum RNA reads > Half in microvesicles Transfected Caco cells express mirna168a/ago2 in microvesicules which can be taken by HEPG2 cells (with improved efficiency of transfer) 2O -methylation confer some extra stability Diet effect confirmed (rice mirna 168a) Plant mirnas found in many tissue including liver (up to ~853 copies/cell, with some selectivity) mirna168a targets LDL receptor adaptor protein 1 in exon4 and can decrease plasma removal (increase plasma LDL cholesterol) Plant mirna are stable ph 2, 37C, 6 hours =>mirnas in food can regulate target gene expression in mammals =>food mirnas are resistant to digestion, can cross the intestinal epithelia, to be secreted in circulating microvesicles allowing tissue uptake of functional mirnas => mirna can be transferred from one species to another
14 The case for micro-rna signaling in milk and dairy sciences Role in mammary function established Present in milk Some selectivity and compartment distribution Can cross the gastro-intestinal barrier and regulate gene expression May have a role in infant immunity and development. Emerging role of mirnas in Dairy sciences and industry: A new way to look at lactation New milk quality markers providing a new and deep insight into milk synthesis and function
15 Milks micro-rna in the mammalian kingdom Sequencing in human, pig, cow, buffalo, goat Sequencing in marsupial wallaby s * Agilent peaks in monotremes, seal, alpaca
16 >100/M (10-4) in >3 samples, DSAP annotation (cow UMD3.1) except for cow data Comparative analysis of sequencing data
17 >100/M (10-4) in >3 samples, DSAP annotation (cow UMD3.1) except for cow data Comparative analysis of sequencing data Outsider Lactation test? - failure - performance
18 >100/M (10-4) in >3 samples, DSAP annotation (cow UMD3.1) except for cow data Comparative analysis of sequencing data < 4 samples Mir-148a Mir-148a milk selection effect? (>240 mirs) Technical? Annotation? Raw data: not available!
19 Intra-specific correlation Colostrum/milk
20 Buffalo colostrum exoquick/whey (cm-a only) mir-223
21 Buffalo colostrum Buffalo milk human milk Pig day0 milk Cow colostrum
22 Human /pig day 0 Pig high Human high
23 Cow milk/colostrum(blue) or serum(red)
24 Wallaby Buffalo milk human pig
25 Milk markers
26 Some species enriched milk mirnas
27 conclusion All mammals drink milk mirna mirna profiling is a powerful technique for milk/lactation testing Some features of mirna composition are likely to be highly conserved while others are variable within and between species Challenges remain to reveal the full potential of mirna profiling for lactation research and the dairy industry Distribution, biogenesis, activity of milk mirna open data policies and funding will facilitate comparative approaches
28 New Signals in milk? Comparative Lactation Biology Mir-Milk: an interactive milk mirna browser for collaborative comparative lactation genomics? Bioinf: Amit Kumar Philip Church Adam Wong Lab: Sanjana Kuruppath Khanh Phuong Ngo Vengama Naidu Modepalli Kevin Nicholas
Human breast milk mirna, maternal probiotic supplementation and atopic dermatitis in offsrping
Human breast milk mirna, maternal probiotic supplementation and atopic dermatitis in offsrping Melanie Rae Simpson PhD candidate Department of Public Health and General Practice Norwegian University of
More informationMicroRNAs in Breastmilk and the Lactating Breast: Potential Immunoprotectors and Developmental Regulators for the Infant and the Mother
Int. J. Environ. Res. Public Health 2015, 12, 13981-14020; doi:10.3390/ijerph121113981 OPEN ACCESS Article International Journal of Environmental Research and Public Health ISSN 1660-4601 www.mdpi.com/journal/ijerph
More informationCharacterisation of RNA in milk and prediction of microrna functions
Characterisation of RNA in milk and prediction of microrna functions by Amit Kumar (MSc) Submitted in fulfilment of the requirements for the degree of Doctor of Philosophy Deakin University November 2013
More informationProfiling of the Exosomal Cargo of Bovine Milk Reveals the Presence of Immune- and Growthmodulatory Non-coding RNAs (ncrna)
Animal Industry Report AS 664 ASL R3235 2018 Profiling of the Exosomal Cargo of Bovine Milk Reveals the Presence of Immune- and Growthmodulatory Non-coding RNAs (ncrna) Eric D. Testroet Washington State
More informationExogenous plant MIR168a specifically targets mammalian LDLRAP1: evidence of cross-kingdom regulation by microrna
ORIGINAL ARTICLE Cell Research (2012) 22:107-126. 2012 IBCB, SIBS, CAS All rights reserved 1001-0602/12 $ 32.00 www.nature.com/cr npg Exogenous plant MIR168a specifically targets mammalian LDLRAP1: evidence
More informationmicro-rnas as biomarkers in children who underwent surgery for CHD
micro-rnas as biomarkers in children who underwent surgery for CHD mentors: Dr. Yael Nevo-Caspi & Prof. Gidi Paret Or Bercovich Liat Mor What will we talk about Congenital heart defects (CHD) Scientific
More informationUtility of Circulating micrornas in Cardiovascular Disease
Utility of Circulating micrornas in Cardiovascular Disease Pil-Ki Min, MD, PhD Cardiology Division, Gangnam Severance Hospital, Yonsei University College of Medicine Introduction Biology of micrornas Circulating
More informationChapter 2. Investigation into mir-346 Regulation of the nachr α5 Subunit
15 Chapter 2 Investigation into mir-346 Regulation of the nachr α5 Subunit MicroRNA s (mirnas) are small (< 25 base pairs), single stranded, non-coding RNAs that regulate gene expression at the post transcriptional
More informationInsight into cancer research from discovery to validation
Insight into cancer research from discovery to validation 1 Exosomes in cancer research: from exosome isolation to biomarker discovery Zheng Songyue, PhD Technical Sales Specialists Life Technologies The
More informationSupplementary Figure 1
Supplementary Figure 1 a Location of GUUUCA motif relative to RNA position 4e+05 3e+05 Reads 2e+05 1e+05 0e+00 35 40 45 50 55 60 65 Distance upstream b 1: Egg 2: L3 3: Adult 4: HES 4e+05 3e+05 2e+05 start
More informationWHY STUDY THE MAMMARY GLAND AND MILK SECRETION?
WHY STUDY THE MAMMARY GLAND AND MILK SECRETION? 1. Greater knowledge allows us to alter environment, nutrition, milking procedures, or general management to maximize production WHY STUDY THE MAMMARY GLAND
More informationmicrorna Presented for: Presented by: Date:
microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions
More informationMarta Puerto Plasencia. microrna sponges
Marta Puerto Plasencia microrna sponges Introduction microrna CircularRNA Publications Conclusions The most well-studied regions in the human genome belong to proteincoding genes. Coding exons are 1.5%
More informationMohammed A. Alsaweed, Ph.D.
Mohammed A. Alsaweed, Ph.D. Vice Dean for Academic Affairs and Student Affairs DOB: 09/01/1983 Assistant Professor, Medical Laboratory Sciences Department P.O. Box: 66 Majmaah 11952 Kingdom of Saudi Arabia
More informationRNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice
SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,
More informationHow exosomes in human breast milk may influence breast cancer risk
Review Article How exosomes in human breast milk may influence breast cancer risk Edward R. Sauter 1, Deirdre Reidy 2 1 Department of Surgery, Hartford Hospital and University of Connecticut School of
More informationProfiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola
Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the
More informationMicroRNAs, RNA Modifications, RNA Editing. Bora E. Baysal MD, PhD Oncology for Scientists Lecture Tue, Oct 17, 2017, 3:30 PM - 5:00 PM
MicroRNAs, RNA Modifications, RNA Editing Bora E. Baysal MD, PhD Oncology for Scientists Lecture Tue, Oct 17, 2017, 3:30 PM - 5:00 PM Expanding world of RNAs mrna, messenger RNA (~20,000) trna, transfer
More informationResearch Article Identification of Dietetically Absorbed Rapeseed (Brassica campestris L.) Bee Pollen MicroRNAs in Serum of Mice
BioMed Research International Volume 2016, Article ID 5413849, 5 pages http://dx.doi.org/10.1155/2016/5413849 Research Article Identification of Dietetically Absorbed Rapeseed (Brassica campestris L.)
More informationSTAT1 regulates microrna transcription in interferon γ stimulated HeLa cells
CAMDA 2009 October 5, 2009 STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells Guohua Wang 1, Yadong Wang 1, Denan Zhang 1, Mingxiang Teng 1,2, Lang Li 2, and Yunlong Liu 2 Harbin
More informationMicroRNA and Male Infertility: A Potential for Diagnosis
Review Article MicroRNA and Male Infertility: A Potential for Diagnosis * Abstract MicroRNAs (mirnas) are small non-coding single stranded RNA molecules that are physiologically produced in eukaryotic
More informationThe use of medium chain fatty acids as alternatives to antibiotic use in pigs
3/5/2018 The use of medium chain fatty acids as alternatives to antibiotic use in pigs - VIV Online News The use of medium chain fatty acids as alternatives to antibiotic use in pigs Written by Product
More informationExtracellular Vesicle RNA isolation Kits
Extracellular Vesicle RNA isolation Kits Summary Section 4 Introduction 42 Exo-TotalRNA and TumorExo-TotalRNA isolation kits 43 Extracellular Vesicle RNA extraction kits Ordering information Products can
More informationJAI La Leche League Epigenetics and Breastfeeding: The Longterm Impact of Breastmilk on Health Disclosure Why am I interested in epigenetics?
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 JAI La Leche League Epigenetics and Breastfeeding: The Longterm Impact of Breastmilk on Health By Laurel Wilson, IBCLC, CLE, CCCE, CLD Author of The Greatest Pregnancy
More informationmicrornas (mirna) and Biomarkers
micrornas (mirna) and Biomarkers Small RNAs Make Big Splash mirnas & Genome Function Biomarkers in Cancer Future Prospects Javed Khan M.D. National Cancer Institute EORTC-NCI-ASCO November 2007 The Human
More informationHepaRG LX2. HepaRG HepaRG LX2 LX2
C Supporting Figure 1. Experimental design of s between and cells. (A) -hepatocytes were isolated from a 30 days of -progenitors. Differentiation into mature hepatocytes was achieved following a 2-weeks
More informationPost-transcriptional regulation of an intronic microrna
Post-transcriptional regulation of an intronic microrna Carl Novina Dana-Farber Cancer Institute Harvard Medical School Broad Institute of Harvard and MIT Qiagen Webinar 05-17-11 Outline 1. The biology
More informationMicroRNA in Cancer Karen Dybkær 2013
MicroRNA in Cancer Karen Dybkær RNA Ribonucleic acid Types -Coding: messenger RNA (mrna) coding for proteins -Non-coding regulating protein formation Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear
More informationMorphogens: What are they and why should we care?
Morphogens: What are they and why should we care? Historic, Theoretical Mechanism of Action Nucleoprotein: the specific trophic cellular material extracted from the cell nucleus. DNA and RNA which regulates
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationTranscriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc
Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression Chromatin Array of nuc 1 Transcriptional control in Eukaryotes: Chromatin undergoes structural changes
More informationomiras: MicroRNA regulation of gene expression
omiras: MicroRNA regulation of gene expression Sören Müller, Goethe University of Frankfurt am Main Molecular Bioinformatics Group, Institute of Computer Science Plant Molecular Biology Group, Institute
More informationhe micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003)
MicroRNAs: Genomics, Biogenesis, Mechanism, and Function (D. Bartel Cell 2004) he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003) Vertebrate MicroRNA Genes (Lim et al. Science
More informationmirna Dr. S Hosseini-Asl
mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region
More informationEasy to digest. Kabrita protein digestibility (1)
Easy to digest Kabrita protein digestibility (1) In vitro analyses of human milk, Kabrita goat milk infant formula (IF) and cow s milk IF in the gastrointestinal model Tiny-TIM agc 90 80 Cum. nitrogen
More informationUSE OF EXOSOMES IN TRANSLATIONAL AND CLINICAL RESEARCH. Eva Colás Ortega Postdoc researcher IRBLleida
USE OF EXOSOMES IN TRANSLATIONAL AND CLINICAL RESEARCH Eva Colás Ortega Postdoc researcher IRBLleida ecolas@irblleida.cat THERE ARE DIFFERENT TYPE OF VESICLES RELEASED BY CELLS MICROVESICLES Size: 100-1000nm
More informationAlcoholic hepatitis is a drug-induced disorder
Alcoholic hepatitis is a drug-induced disorder Gyongyi Szabo, MD, PhD Professor of Medicine University of Massachusetts Medical School Source: 2 Sobernation.com Clinical Progression of ALD Mortality Acute
More informationMetabolic programming. Role of micrornas. M Elizabeth Tejero, PhD Laboratory of Nutrigenetics and Nutrigenomics INMEGEN Mexico City
Metabolic programming. Role of micrornas M Elizabeth Tejero, PhD Laboratory of Nutrigenetics and Nutrigenomics INMEGEN Mexico City Outline Overview on micrornas (mirnas) Role of mirnas in metabolic programming
More informationSelecting Beneficial Protein Components From all Dairy Animals for Manufacturing Next Generation Infant Formulas FOOD AND NUTRITION
Selecting Beneficial Protein Components From all Dairy Animals for Manufacturing Next Generation Infant Formulas FOOD AND NUTRITION Jared Raynes 14 th September 2017 What is the Problem? Breast milk is
More informationNew Studies Continue to Reveal the Health Benefits of Colostrum
New Studies Continue to Reveal the Health Benefits of Colostrum by Barbara L. Minton (see all articles by this author) (NaturalNews) Colostrum is the thin yellowish fluid produced during the first few
More informationSmall RNAs and Cross-Kingdom RNAi in Plant-Microbial Interaction Hailing Jin
Small RNAs and Cross-Kingdom RNAi in Plant-Microbial Interaction Hailing Jin Department of Plant Pathology & Microbiology Institute for Integrative Genome Biology micrornas (mirnas) Small RNAs PolII PolIV
More informationMicroRNAs: a new source of biomarkers in radiation response. Simone Moertl, Helmholtz Centre Munich
MicroRNAs: a new source of biomarkers in radiation response Simone Moertl, Helmholtz Centre Munich The RNA World mrna rrna coding snorna trna scarna RNA snrna noncoding lincrna rasirna RNAi anti-sense
More informationCircular RNAs (circrnas) act a stable mirna sponges
Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding
More informationSerum microrna biomarkers for human DILI
CLEARANCE DRUG bioactivation covalent binding Detoxication GLUCURONIDE SULPHATE DRUG + METABOLITE chemical stress mitochondrial dysfunction apoptosis necrosis hepatocyte hypertrophy hepatocyte hyperplasia
More informationIntrinsic cellular defenses against virus infection
Intrinsic cellular defenses against virus infection Detection of virus infection Host cell response to virus infection Interferons: structure and synthesis Induction of antiviral activity Viral defenses
More informationmirna profiling reveals a potential role of milk stasis in breast carcinogenesis
INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 33: 1243-1249, 2014 mirna profiling reveals a potential role of milk stasis in breast carcinogenesis YI-QI GU 1, GU GONG 2, ZHE-LI XU 1, LI-YING WANG 3, MING-LI
More informationSupporting Information
Supporting Information Retinal expression of small non-coding RNAs in a murine model of proliferative retinopathy Chi-Hsiu Liu 1, Zhongxiao Wang 1, Ye Sun 1, John Paul SanGiovanni 2, Jing Chen 1, * 1 Department
More informationThe Role of MicroRNAs in NEC Misty Good, MD
The Role of MicroRNAs in NEC Misty Good, MD Neonatologist, Assistant Professor of Pediatrics Division of Newborn Medicine, Children s Hospital of Pittsburgh Department of Pediatrics, University of Pittsburgh
More informationDownregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases
Brief Communication Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Qinghai Zeng 1 *, Cuihong Jin 2 *, Wenhang Chen 2, Fang Xia 3, Qi Wang 3, Fan Fan 4,
More informationSupplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
More informationTable S1. Quantitative RT-PCR primers
Table S1. Quantitative RT-PCR primers Gene Forward Primer Reverse Primer Human ApoB gcaagcagaagccagaagta ccatttggagaagcagtttgg Human ApoA1 gaaagctgcggtgctgac agtggccaggtccttcact Human MTP acggccattcccattgtg
More informationMicroRNA dysregulation in cancer. Systems Plant Microbiology Hyun-Hee Lee
MicroRNA dysregulation in cancer Systems Plant Microbiology Hyun-Hee Lee Contents 1 What is MicroRNA? 2 mirna dysregulation in cancer 3 Summary What is MicroRNA? What is MicroRNA? MicroRNAs (mirnas) -
More informationHuman Complex Milk Lipids: Concentrations, benefits and the implications for Paediatric Nutrition
Human Complex Milk Lipids: Concentrations, benefits and the implications for Paediatric Nutrition Alastair MacGibbon, Bertram Fong, Angela Rowan and Paul McJarrow Fonterra Research and Development Centre,
More informationAnalysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer. Application Note
Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer Application Note Odile Sismeiro, Jean-Yves Coppée, Christophe Antoniewski, and Hélène Thomassin
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±
More informationIdentification of mirnas in Eucalyptus globulus Plant by Computational Methods
International Journal of Pharmaceutical Science Invention ISSN (Online): 2319 6718, ISSN (Print): 2319 670X Volume 2 Issue 5 May 2013 PP.70-74 Identification of mirnas in Eucalyptus globulus Plant by Computational
More informationGeneral Biology 1004 Chapter 11 Lecture Handout, Summer 2005 Dr. Frisby
Slide 1 CHAPTER 11 Gene Regulation PowerPoint Lecture Slides for Essential Biology, Second Edition & Essential Biology with Physiology Presentation prepared by Chris C. Romero Neil Campbell, Jane Reece,
More informationmirna Biomarkers Seena K. Ajit PhD Pharmacology & Physiology Drexel University College of Medicine October 12, 2017
mirna Biomarkers Seena K. Ajit PhD Pharmacology & Physiology Drexel University College of Medicine October 12, 2017 Outline Introduction Circulating mirnas as potential biomarkers for pain Complex regional
More informationMicroRNA roles in signaling during lactation: an insight from differential expression, time course and pathway analyses of deep sequence data
MicroRNA roles in signaling during lactation: an insight from differential expression, time course and pathway analyses of deep sequence data Duy N. Do 1, 2, Ran Li 1, 3, Pier-Luc Dudemaine 1 and Eveline
More informationCirculating Microrna Expression As A Biomarker For Early Diagnosis Of Severity In Spinal Cord Injury
Circulating Microrna Expression As A Biomarker For Early Diagnosis Of Severity In Spinal Cord Injury Susumu Hachisuka 1, Naosuke Kamei, MD, PhD 2, Satoshi Ujigo 3, Shigeru Miyaki 3, Mitsuo Ochi 3. 1 Hiroshima
More informationGENERAL SUMMARY Corpus luteum is a transient endocrine structure formed from the ruptured ovarian follicle. Its main function is to secrete P 4, a pro
Corpus luteum is a transient endocrine structure formed from the ruptured ovarian follicle. Its main function is to secrete P 4, a pro-gestational hormone, essential for establishment and maintenance of
More informationIngredients for the next generation
Arla Foods Ingredients Ingredients for the next generation Using infant formulas is second to breastfeeding, a fact supported by WHO. This information is for professional use only. 002 003 Infant nutrition
More informationThe rat microrna body atlas: mirna identification and characterization
The rat microrna body atlas: mirna identification and characterization A Project of the HESI Genomics Committee Alison Harrill, Aaron Smith, and Raegan O Lone MicroRNAs: Tissue Specific Biomarkers mirna
More informationSupplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.
Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the mutated sequence. 1 Supplementary Figure 2. Expression of mir-182 and SMAD7 in various cell lines. (A) Basal levels of mir-182 expression
More informationMare s milk. Mare s milk, in chemical composition and particularly in the protein content, it is one of the most similar milks of human milk.
Mare s milk The mare s milk is produced for the mare (the female of horse) Mares, like all the mammal females, have mammary glands that secrete what it have to the unique food for their children during
More informationmir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons
Supplemental Material mir-7a regulation of Pax6 in neural stem cells controls the spatial origin of forebrain dopaminergic neurons Antoine de Chevigny, Nathalie Coré, Philipp Follert, Marion Gaudin, Pascal
More informationRNA sequencing of the human milk fat globule transcriptome at three stages of lactation
RNA sequencing of the human milk fat globule transcriptome at three stages of lactation Danielle G Lemay, 1 Olivia A Ballard, 2 Nelson D Horseman, 3 Ardythe L Morrow, 2,3 and Laurie A Nommsen-Rivers 2,3
More informationSupplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
More informationPaternal exposure and effects on microrna and mrna expression in developing embryo. Department of Chemical and Radiation Nur Duale
Paternal exposure and effects on microrna and mrna expression in developing embryo Department of Chemical and Radiation Nur Duale Our research question Can paternal preconceptional exposure to environmental
More informationFocus Areas for Entry Test (Technical Part) for M. Phil / PhD in Food & Nutrition
Focus Areas for Entry Test (Technical Part) for M. Phil / PhD in Food & Nutrition Sr. No. Core Areas Percentage 1. 2. Community Nutrition 15% Dietetics and Preventive Nutrition 15% 3. 4. 5. 6. 7. Nutritional
More informationMicroRNAs: novel regulators in skin research
MicroRNAs: novel regulators in skin research Eniko Sonkoly, Andor Pivarcsi KI, Department of Medicine, Unit of Dermatology and Venerology What are micrornas? Small, ~21-mer RNAs 1993: The first mirna discovered,
More informationBi 8 Lecture 17. interference. Ellen Rothenberg 1 March 2016
Bi 8 Lecture 17 REGulation by RNA interference Ellen Rothenberg 1 March 2016 Protein is not the only regulatory molecule affecting gene expression: RNA itself can be negative regulator RNA does not need
More informationChapter 6- An Introduction to Viruses*
Chapter 6- An Introduction to Viruses* *Lecture notes are to be used as a study guide only and do not represent the comprehensive information you will need to know for the exams. 6.1 Overview of Viruses
More informationEXOSOMES & MICROVESICLES
The Sample Preparation Experts EXOSOMES & MICROVESICLES The New Standard in Exosome Purification and RNA Isolation Best-in-Class, Pure & Simple Exosome Purification, Fractionation of Exosomal Free & Circulating
More informationPage 32 AP Biology: 2013 Exam Review CONCEPT 6 REGULATION
Page 32 AP Biology: 2013 Exam Review CONCEPT 6 REGULATION 1. Feedback a. Negative feedback mechanisms maintain dynamic homeostasis for a particular condition (variable) by regulating physiological processes,
More informationThe Biology and Genetics of Cells and Organisms The Biology of Cancer
The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried
More informationARTICLE IN PRESS. Critical Reviews in Oncology/Hematology xxx (2010) xxx xxx
Critical Reviews in Oncology/Hematology xxx (2010) xxx xxx Circulating micrornas: Association with disease and potential use as biomarkers Glen Reid, Michaela B. Kirschner, Nico van Zandwijk Asbestos Diseases
More informationMicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL
MicroRNA expression profiling and functional analysis in prostate cancer Marco Folini s.c. Ricerca Traslazionale DOSL What are micrornas? For almost three decades, the alteration of protein-coding genes
More informationCellular Physiology and Biochemistry
Original Paper 2015 The Author(s). 2015 Published The Author(s) by S. Karger AG, Basel Published online: November 27, 2015 www.karger.com/cpb Published by S. Karger AG, Basel 2194 1421-9778/15/0376-2194$39.50/0
More informationAccelerate Your Research with Conversant Bio
Imagination has given us the steam engine, the telephone, the talkingmachine and the automobile, for these things had to be dreamed of before they became realities. So I believe that dreams... are likely
More informationSUMMARY OF PRODUCT CHARACTERISTICS
SUMMARY OF PRODUCT CHARACTERISTICS 1.- NAME OF THE PRODUCT AMICEN S SOLUCION 2.- QUANTITATIVE AND QUALITATIVE COMPOSITION COMPOSITION PER ML: Protein hydrolized from vegetal origin... 75 mg Sodium chloride...
More informationRegulation of Gene Expression in Eukaryotes
Ch. 19 Regulation of Gene Expression in Eukaryotes BIOL 222 Differential Gene Expression in Eukaryotes Signal Cells in a multicellular eukaryotic organism genetically identical differential gene expression
More informationExpression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis
European Review for Medical and Pharmacological Sciences 2018; 22: 726-730 Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis H.-L. ZHANG 1, L. LI 2, C.-J.
More informationImportance of sow colostrum in relation to piglet survival
Importance of sow colostrum in relation to piglet survival Hélène Quesnel INRA Saint-Gilles, France D I E T A G R I C U L T U R E E N V I R O N M E N T Piglet mortality in herds Selection for prolificacy
More informationResults. Abstract. Introduc4on. Conclusions. Methods. Funding
. expression that plays a role in many cellular processes affecting a variety of traits. In this study DNA methylation was assessed in neuronal tissue from three pigs (frontal lobe) and one great tit (whole
More informationCancer Problems in Indonesia
mirna and Cancer : mirna as a Key Regulator in Cancer Sofia Mubarika 2 nd Symposium Biomolecular Update in Cancer PERABOI Padang 18 Mei 2013 Cancer Problems in Indonesia 1. Chemoresistency / recurrency
More informationCalf Notes.com. happens to the rest of the protein? It s an interesting observation and may provide some insights into the newborn calf s metabolism.
Calf Notes.com Calf Note 168 Where does the protein go? Introduction Colostrum is special stuff. The composition of maternal colostrum (MC) is profoundly different from that of milk; it s so different
More informationGene Regulation Part 2
Michael Cummings Chapter 9 Gene Regulation Part 2 David Reisman University of South Carolina Other topics in Chp 9 Part 2 Protein folding diseases Most diseases are caused by mutations in the DNA that
More informationLactose Lab: Some Don't Like it Sweet
Lactose Lab: Some Don't Like it Sweet Grade Level(s) 9-12 Estimated Time 60 minutes Purpose In this lesson students will learn the chemistry and composition of milk, identify the difference between a monosaccharide
More informationPlasma lipoproteins & atherosclerosis by. Prof.Dr. Maha M. Sallam
Biochemistry Department Plasma lipoproteins & atherosclerosis by Prof.Dr. Maha M. Sallam 1 1. Recognize structures,types and role of lipoproteins in blood (Chylomicrons, VLDL, LDL and HDL). 2. Explain
More informationReprogramming through micrornas Stefanie Dimmeler
Klinikum der Johann Wolfgang Goethe Universität Frankfurt am Main Reprogramming through micrornas Stefanie Dimmeler Conflict of interest: T2cure GmbH, Miragen Non-coding DNA & RNA and micrornas Human Genome
More informationOsteopontin a bioactive milk protein with immunological properties
Osteopontin a bioactive milk protein with immunological properties Esben S. Sørensen Section for Molecular Nutrition Department of Molecular Biology and Genetics Aarhus University, Denmark Proteins in
More informationProkaryotes and eukaryotes alter gene expression in response to their changing environment
Chapter 18 Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development and is responsible for differences
More informationCollege of Agriculture. Animal Sciences
101 DOMESTIC ANIMAL BIOLOGY. (3) The first in a sequence of two courses providing an introduction to the subject of animal science. Emphasis is placed on a fundamental understanding of anatomy, physiology,
More informationChapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko
Chapter 11 How Genes Are Controlled PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey, and
More informationStudy Exercises: 1. What special dietary needs do children <1 yr of age have and why?
Exam 3 Review: Lectures 21+ Nutrition 150 Winter 2007 Exam: Monday, March 19, 8-10am in regular classroom Strategies for Studying: 1) Go over all lectures including those given by fellow students 2) Read
More informationWhere Splicing Joins Chromatin And Transcription. 9/11/2012 Dario Balestra
Where Splicing Joins Chromatin And Transcription 9/11/2012 Dario Balestra Splicing process overview Splicing process overview Sequence context RNA secondary structure Tissue-specific Proteins Development
More informationSerum exosomes: A liquid biopsy for neurological disease. Michael Buckland RPAH Neuropathology Sydney, Australia
Serum exosomes: A liquid biopsy for neurological disease Michael Buckland RPAH Neuropathology Sydney, Australia Extracellular vesicles Tiny membrane-bound nano-sized vesicles Exosomes (50-100 nm) Microparticles
More informationRECENT ADVANCES IN THE MOLECULAR DIAGNOSIS OF BREAST CANCER
Technology Transfer in Diagnostic Pathology. 6th Central European Regional Meeting. Cytopathology. Balatonfüred, Hungary, April 7-9, 2011. RECENT ADVANCES IN THE MOLECULAR DIAGNOSIS OF BREAST CANCER Philippe
More informationAccepted Manuscript. Alternative splicing in heart surgery: lost in translation?
Accepted Manuscript Alternative splicing in heart surgery: lost in translation? Tyson A. Fricke, MBBS, BMedSci, Michael ZL. Zhu, MD, Igor E. Konstantinov, MD, PhD, FRACS PII: S0022-5223(18)32871-X DOI:
More information