Ayesha Baig. Suppression of Apoptosis by Mammalian Target of Rapamycin and the Role of Protein Kinase C-delta. Faculty of Medicine

Transcription

1 Suppression of Apoptosis by Mammalian Target of Rapamycin and the Role of Protein Kinase C-delta. Ayesha Baig Faculty of Medicine Division of Experimental Medicine McGill University, Montreal, QC February 2013 A thesis submitted to McGill University in partial fulfillment of the requirements of the degree of Master of Science Ayesha Baig 2013

2 ABSTRACT mtor is a serine/threonine protein kinase that controls cell growth, proliferation, and survival in response to mitogens and nutrients. When inactivated by nutrient deprivation or serum withdrawal, mtor can also enhance stress transcriptional responses. In agreement, once inhibited, mtor binds signal transducer and activator of transcription- 1 (STAT1), a pro-apoptotic transcription factor, and the STAT1 kinase protein kinase C- delta (PKCδ). Inactivation of mtor enhanced STAT1 nuclear import, the induction of STAT1-dependent genes (including STAT1 per se), and apoptosis, indicating a role for mtor activity in suppressing apoptosis transcriptional responses. However the function of PKCδ in the mtor/stat1 complex is unknown. After identifying a target of rapamycin signalling (TOS) motif in PKCδ, we hypothesized that mtor suppresses STAT1-dependent apoptosis via a physical interaction with PKCδ. We expressed the TOSmutated isoform of PKCδ (ΔTOS) in mammalian cells, and determined the effect of rapamycin on STAT1 protein levels, apoptosis, or cell viability. In HEK 293T cells, phosphorylation of STAT1 was retained upon expression of ΔTOS PKCδ, indicating preservation of PKCδ kinase activity. There was an increase in cleaved caspase-3 levels (apoptosis) in cells expressing ΔTOS, as compared to wild-type (WT), PKCδ. Rapamycin failed to increase STAT1 levels in ΔTOS-expressing cells exposed to the pro-apoptotic cytokine interferon-β. In human fibrosarcoma (2fTGH) cells, the increase in cleaved caspase-3 levels by rapamycin was lost upon expression of the ΔTOS mutant. In similar, but STAT1-deficient (U3A) cells, WT or ΔTOS PKCδ failed to restore cleavage of caspase- 3. Unlike apoptosis, ΔTOS PKCδ reduced viability in U3A cells, but not in 2fTGH cells 2

3 exposed to rapamycin, indicating that mtor, PKCδ, and STAT1 can control cell viability by caspase-3-independent mechanisms. Our results are consistent with an inhibitory effect of mtor on STAT1 expression and apoptosis that is mediated by the PKCδ TOS motif. 3

4 RÉSUMÉ mtor est une sérine / thréonine protéine kinase qui contrôle la croissance cellulaire, la prolifération et la survie en réponse à des mitogènes et nutriments. Quand inactivée par une carence en nutriments ou un retrait de sérum, la protéine mtor peut également augmenter les réponses transcriptionnelles dues au stress. En accord, une fois inhibée, mtor se lie au 'transducteur de signal et activateur de transcription-1' (STAT1), un facteur de transcription pro-apoptotique, et une kinase pour STAT1 protéine kinase C- delta (PKCδ). L'inactivation de mtor augmente l importation nucléaire de STAT1, l'induction de gènes dépendants de STAT1 (y compris STAT1), et l'apoptose, ce qui indique un rôle de la protéine mtor dans la suppression transcriptionnelle de réponses apoptotiques. Cependant, la fonction de PKCδ dans le complexe mtor/stat1 est inconnue. Après avoir identifié un motif de cible de rapamycine dans PKCδ (motif TOS), nous avons émis l hypothèse que mtor supprime l'apoptose dépendante de STAT1 par une interaction physique avec PKCδ. Nous avons exprimé l'isoforme TOS-mutée de PKCδ (ΔTOS) dans les cellules, et nous avons déterminé l'effet de la rapamycine sur la teneur en protéines STAT1, l'apoptose, ou la viabilité des cellules. Dans des cellules HEK 293T, la phosphorylation de STAT1 a été retenu lors de l'expression de ΔTOS PKCδ, indiquant la préservation de l'activité kinase PKCδ. Il y avait une augmentation des niveaux de caspase-3 clivés (apoptose) dans les cellules exprimant ΔTOS par rapport à PKCδ de type sauvage (WT). La rapamycine n a pas pu augmenter les niveaux de STAT1 dans les cellules exprimant ΔTOS exposées à la cytokine pro-apoptotique interféron-. Dans les cellules humaines de fibrosarcome (2fTGH), l'augmentation des niveaux de caspase-3 4

5 clivé induite par la rapamycine a été perdue lors de l'expression du mutant ΔTOS. De façon similaire dans les cellules déficientes en STAT1 (U3A), le PKCδ WT ou ΔTOS n a pas réussi à restaurer les niveaux de caspase-3 clivé. Contrairement à l'apoptose, les ΔTOS réduisent la viabilité des cellules dans U3A, mais pas dans les cellules exposées à 2fTGH rapamycine, ce qui suggère que la protéine mtor, PKCδ, et STAT1 contrôlent la viabilité des cellules par des mécanismes autres que l'apoptose. Nos résultats suggèrent que le motif TOS dans PKCδ assure un effet inhibiteur de mtor sur l expression STAT1 et l'apoptose. 5

6 ACKNOWLEDGEMENTS I would like to acknowledge everyone who have contributed to my studies. I have always been interested in research, and my supervisor Dr. Arnold Kristof has made the dream of studying at McGill come true. Doing a Masters in experimental medicine department is an honour for me. Working in Dr. Kristof s lab gave me the opportunity to be trained. This would not have been accomplished without the members of Critical Care Division; Dr. Kwang-bo Joung, Dr. Bernard Nkengfac, Jill A. Fielhaber, Dominique Mayaki (special thanks for French translation of the abstract), Sharon Harel, Yeting Guo, Ortal Attias, Hodan Ismail, Christine Mutter, Irene Prager. Especially my friend Raquel Echavarria has been the most important person to support, help and guide me. I would like to thank the members of my thesis committee Dr. Coimbatore B. Srikant, Dr. Suhad Ali, and Dr. Andrey V. Cybulsky. 6

7 TABLE OF CONTENTS Abstract 2 Résumé 4 Acknowledgements 6 Table of Contents 7 List of Figures 9 List of Abbreviations 11 SECTION 1: Review of the Literature 15 Summary 15 Mammalian target of rapamycin (mtor) Overview 15 mtor 16 mtor signalling network and complexes 17 Structural domains of mtor 19 TOS motif in mtorc1 substrates 19 Dysregulation of mtor in Disease 23 Regulation of transcription by mtor 24 STAT1 and interferons 25 Type I and II Interferons 28 Transcriptional targets of IFNs and STAT1 29 STAT isoforms and functions 30 STAT1 structure 30 STAT1 nuclear trafficking 31 7

8 Latent STAT1 and its functions 34 STAT1 is a regulator of apoptosis 34 Apoptosis 35 Caspase-cascade system 36 PKCδ (protein kinase C- delta) and apoptosis 36 Regulation of STAT1 by mtorc1 and potential role of PKCδ 37 SECTION 2: Hypothesis 39 SECTION 3: Material and methods 40 Plasmids Vectors - Cloning and Mutagenesis 41 Cell culture and treatments 43 Transfection of HEK 293 cells 43 Transfection of 2fTGH and U3A cells 44 Generation of whole cell lysates 44 Detection of proteins 44 Crystal violet staining 45 SECTION 4: Results 46 SECTION 5: Discussion 61 Summary 61 TOS motif sequence and protein conformation 62 TOS motif operates independently of PKCδ kinase activity 63 STAT1 expression and positive feedback loop 63 PKCδ interaction with mtorc1 and significance of latent STAT1 66 8

9 PKCδ as a potential KPNA1 kinase 66 PKCδ ΔTOS mutation is independent of other mtorc1 downstream regulators 67 STAT1 is required for PKCδ-mediated apoptosis 68 PKCδ TOS motif is required for rapamycin induced STAT1 expression and apoptosis 70 Other mechanisms of mtor-induced apoptosis 70 Impact and future directions 72 List of Figures Figure 1: mtor Signalling Elements and Responses 18 Figure 2: 3D model of PKCδ kinase domain containing TOS motif 22 Figure 3: Interferon and JAK-STAT signalling 27 Figure 4: STAT1 and nuclear trafficking 33 Figure 5: Cleaved caspase-3 levels in HEK 293T cells expressing PKCδ ΔTOS mutant 50 Figure 6: STAT1 levels in HEK 293T cells expressing PKCδ ΔTOS mutant 51 Figure 7: Effect of the ΔTOS mutation on phosphorylation of STAT1 at S Figure 8: Regulation of rapamycin-induced apoptosis by the PKCδ TOS motif and STAT1 55 9

10 Figure 9: Regulation of rapamycin-induced STAT1 levels by the PKCδ TOS motif 57 Figure 10: Effect of PKCδ activity and the TOS motif and STAT1 on cell viability 59 Figure 11: Positive feedback loop for STAT1 expression 65 List of Tables Table 1: TOS motif amino acid sequences in mtorc1 downstream target proteins 21 Table 2: Oligonucleotide primers (5-3 ) for PCR cloning of PKCδ into Gateway entry vector pdonr Table 3: Oligonucleotide primers (5-3 ) for PKCδ site-directed mutagenesis 42 Reference List 73 10

11 LIST OF ABBREVIATIONS 4EBP: eif4e binding protein A: alanine ALI: acute lung injury AMPK: 5 -AMP-activated protein kinase ASK1: apoptosis signal-regulating kinase 1 C: cysteine c-jun: Jun proto-oncogene Caspase: cysteine-dependent aspartate-directed proteases CRM1: chromosome region maintenance 1 D: aspartic acid DC: dendritic cell DN: Dominant Negative E: glutamic acid ERK: extracellular signal-regulated kinase EV: empty vector F: phenylalanine FAT: FRAP, ATM and TRRAP FATC: FAT carboxyl-terminal FKBP12: FK506-binding protein 12 FOXO: forkhead box protein O 11

12 FRAP: FKBP12-rapamycin associated protein FRB: FKBP12-rapamycin binding domain GAP: GTPase-activating proteins GAS: gamma activated site HEAT: huntington, elongation factor 3, the regulatory A subunit of PP2A, TOR1 HIF1A: hypoxia-inducible factor-1 hinos: human inducible nitric oxide synthase I: isoleucine IFN: interferon IFNAR: type I IFN receptor IFNGR: type II IFN receptor IGF: insulin-like growth factor inos: inducible nitric oxide synthase IRF: interferon regulatory factor ISG: IFN-sensitive gene ISGF3: IFN-stimulated gene factor 3 ISRE: IFN-stimulated response element JAK: janus kinase K: lysine KPNA: karyopherin alpha L: leucine LAM: Lymphangioleiomyomatosis 12

13 LPS: lipopolysaccharide M: methionine MAPK: mitogen-activated protein kinase mlst8: mammalian lethal with Sec13 protein 8 mtor: mammalian target of rapamycin mtorc1: mtor complex 1 mtorc2: mtor complex 2 NES: nuclear export signal P: proline p70 S6 kinase: S6 kinase PCR: polymerase chain reaction PI3K: phosphatidylinositol-3 kinase PIKK: PI3K-related kinase PIP3: phosphatidylinositol 3, 4, 5-triphosphate PKC: protein kinase C PKCδ: protein-kinase-c-delta PP2A: type 2A related protein phosphatase PP2Ac: PP2A catalytic subunit R: arginine Raptor: regulatory associated protein of mtor RAPT1: rapamycin target 1 Rheb: ras-homolog enriched in brain 13

14 Rictor: rapamycin insensitive companion of TOR S6K: p70 S6 kinase S6KB2: p70 S6 Kinase beta SEM: standard error of the mean S: serine SH2: src homology 2 STAT: signal transducer and activator of transcription STAT1: signal transducer of activated transcription-1 T: threonine TA: transactivation domain TLR: toll-like receptor TNF: tumour necrosis factor TOR: target of rapamycin TOS: TOR signalling motif ΔTOS: PKCδ TOS motif mutant TSC: tuberous sclerosis complex TSC1: hamartin TSC2: tuberin V: valine WT: wild type Y: tyrosine 14

15 SECTION 1: REVIEW OF THE LITERATURE Summary The major objective of this thesis project was to better understand the cell signalling pathways that determine programmed cell death. Our focus is on mammalian target of rapamycin (mtor) a sensor of mitogens and nutrients and a controller of cell growth, proliferation and survival. Previous work in our laboratory demonstrated a physical interaction between mtor and signal transducer of activated transcription-1 (STAT1), a pro-apoptotic transcription factor as well as its kinase protein-kinase-c-delta (PKCδ). Subsequent studies showed that mtor attenuates the nuclear import and transcriptional activity of STAT1, thereby promoting cell survival. The role of PKCδ is unknown. Diseases of excessive mtor activity (e.g., TSC, LAM) may therefore be partly characterized by aberrant STAT1 and PKCδ signalling. Moreover, reduced mtor activity during inflammatory states appears to promote cellular apoptosis and organ injury [1]. Here, I will discuss how mtor impacts upon pivotal cell processes, and how mtor regulates transcription, STAT1 and PKCδ, thus linking cell metabolism, cytokine signalling and apoptosis/ cell death. Mammalian target of rapamycin (mtor) Overview Eukaryotic TORs, also called FKBP12-rapamycin associated protein (FRAP) or rapamycin target 1 (RAPT1), are 289-kDa proteins that are conserved from yeast (S. cerevisiae) [2] to mammals [3-5]. They are large highly conserved serine-threonine kinase proteins and 15

16 belong to the phosphatidylinositol kinase-related kinase (PIKK) family [6, 7]. Aminoterminal to the kinase domain in TOR is the FKBP12-rapamycin binding domain [8]. Rapamycin is an immunosuppressive compound that permitted the discovery of TOR in yeast [8], and is a potent inhibitor of cell growth at proliferation [6]. Its use as an antifungal agent led to the discovery of mtor [2, 6, 7], but was abandoned due to its antiproliferative affects. Its anti-tumor and immunosuppressive activity led to its use in organ transplantation and renal cell carcinoma [9]. Rapamycin has been found to arrest cell growth and proliferation in cultured tumor cells, as well as in some human and murine tumor models [10-15]. Thus, it has been used as antitumor (e.g., rhabdomyosarcoma, neuroblastoma, glioblastoma) and as a post transplantation immunosuppressive agent [9]. mtor is a ubiquitous protein kinase present in all eukaryotic organisms. It is a large protein whose functions depend on several conserved structural domains. mtor is a key element responsible in several cellular processes like growth, proliferation, survival and metabolism [16]; disruption of the mtor gene is embryologically lethal [17, 18]. mtor in mammals is not only regulated by nutrients (as in yeast), but also by growth factors, ATP, and phosphatidic acid via a number of upstream signaling proteins [19-21]. The protein Raptor acts as a link between mtor and its effectors. Raptor and mlst8 act as modulators of mtor under nutrient-dependent conditions. Via its interaction with raptor, mtor induces the phosphorylation of p70 S6 kinase at T389, likely by inactivating the phosphatase PP2A [22-24]. p70 S6 kinase is a serine/threonine kinase that phosphorylates the S6 ribosomal protein which induces protein synthesis at the 16

17 ribosome. mtor also phosphorylates 4EBP1, an inhibitor of protein synthesis, thereby facilitating the translation of mrnas that encode cell proliferation and survival proteins. Raptor forms a high molecular weight complex with mtor which interacts with the downstream regulator through their target of rapamycin signaling (TOS) motifs, for example by linking mtor with p70 S6 kinase or 4EBP1 in rapamycin-sensitive manner [22, 23, 25-27]. Other mtorc1 targets that contain TOS motifs include the transcription factors HIF-1 and STAT3. mtor signalling network and complexes: mtor functions depend on its physical interaction with distinct protein partners in large macromolecular complexes. These are mtorc1 and mtorc2 (Figure 1). mtorc1 is highly sensitive to rapamycin, as well as to its synthetic analogues (e.g. RAD001, CCI779). Rapamycin binds to FKBP12 (FK506-binding protein 12) forming a ternary and inhibitory complex with mtor [8]. It controls several pathways that control cell mass in response to growth factors (insulin/igf), nutrient levels, energy and stress. mtorc1 is comprised of mtor, raptor and mlst8 (lethal with SEC13 protein 8) [22-24, 28, 29]. 17

18 Figure 1 Figure 1: mtor Signalling Elements and Responses [30] mtor complex showing signaling activities of mtorc1 and mtorc2 organized into concentric spheres. The outer upper half sphere represents the input signals like growth factors, glucose, hypoxia, amino acids, AMP: ATP levels. These signals indirectly or directly modifying mtorcs (center). Proteins that modify mtorc activity are above the horizontal line, whereas those which mediate mtor functions are below. From center to periphery (lower half) each mtorc leads to the phosphorylation of target proteins, and their activation or suppression. Adapted from reference [30]. 18

19 mtorc2 is comprised of mtor, Rictor (rapamycin-insensitive companion of mtor), SIN1 (stress-activated-protein-kinase-interacting protein 1) and mlst8 [31-33]. It is known to determine the shape of cells by controlling actin cytoskeleton mainly through the downstream regulator PKCα; mtorc2 also controls cell survival via Akt [34-36]. mtorc2 regulates cytokinesis or survival in rapamycin-independent fashion. Structural Domains of mtor: mtor structural domains are required for its functions. The amino terminus consist of 20 tandem HEAT (Huntington, elongation factor 3, the regulatory A subunit of protein phosphatase 2A (PP2A), TOR1) repeats. Each HEAT repeat consists of 2 alpha-helices of approximately 40 amino acids, and mediate protein-protein interactions or membrane localization [37-40]. The kinase domain is located in the carboxyl-terminal of mtor possessing serine/threonine kinase activity [41]. The kinase domain also contains the auto phosphorylation site S2481 which promotes mtor kinase activity. The FKBP12- rapamycin-binding domain (FRB) binds the FKBP12- rapamycin complex, which inhibits mtor kinase activity [42]. mtor also contains the FAT (for FRAP, ATM and TRAP) and FATC (FAT carboxyl-terminal) domains, which are responsible for proper orientation of the kinase domain, and interactions with selected binding partners [41, 43, 44]. TOS motif in mtorc1 substrates: mtorc1 downstream targets include p70 ribosomal S6 kinases (S6K1, S6K2), 4EBP1 and 4EBP2. S6K and 4EBP1 are key regulators of protein translation, and their 19

20 phosphorylation is inhibited by rapamycin [45-47]. These substrates contain highlyconserved amino acid sequences (Table 1), termed target of rapamycin signalling (TOS) motifs) [26], which are required for interaction with and phosphorylation by mtorc1 [48, 49]. Within the TOS motif, the first residue (phenylalanine) is most critical. We identified a TOS sequence (FVMEF; phenylalanine, valine, methionine, glutathione, and phenyl alanine) in PKCδ, an apoptosis regulator and mtor-interacting protein (Figure 2). By controlling the interaction between PKCδ and mtorc1, this sequence of five amino acids may be one mechanism by which mtorc1 suppresses cell death (apoptosis). 20

21 Table 1 Proteins TOS motif sequence PKCδ FVMEF 4EBP1 FEMDI HIF1A FVMVL S6KB2 FDLDL STAT3 FPMEL Table 1: TOS motif amino acid sequences in mtorc1 downstream target proteins TOS motif amino acid sequences (right column) are shown with respective proteins (left column). PKCδ TOS amino acid sequence is FVMEF (phenylalalnine, valine, methioninie, glutathione, phenylalanine). Amino acids are: D (aspartic acid), E (glutamic acid), F (phenylalanine), I (isoleucine), L (leucine), M (methionine), P (proline), V (valine). 21

22 Figure 2 Figure 2: 3D model of PKCδ kinase domain containing TOS motif This PKCδ kinase domain is shown in this 3D model developed in our lab. TOS motif (yellow color band) located in the N-terminus of β-sheets. α-helices contain the kinase domain active site (red color band). ATP bound in kinase domain is shown in blue. 22

23 Dysregulation of mtor in Disease: The effect of excessive mtor activity in human disease states is exemplified by Tuberous Sclerosis Complex (TSC), an autosomal dominant neurocutaneous syndrome [50] occurring in ~1/6000 live births. A genetic model of oncogenesis, TSC causes hamartomatous tumors in the brain, eyes, heart, kidney, skin and lungs. In the lungs, lymphangioleiomyomatosis (LAM) can occur sporadically or as a manifestation of TSC. LAM is characterized by excessive growth of neoplastic smooth muscle-like cells, cystic destruction of the lung, angiomyolipomas, lymphangiomyomas, progressive respiratory failure and eventually death or lung transplantation. Low grade neoplastic tumours in TSC and LAM are caused by mutations in the TSC1 or TSC2 gene, which lead to hyperactivation of mtor, excessive cell growth, and inappropriate cell survival. mtor is emerging as an important antitumor target, as studies have shown that mtor inhibitor rapamycin appears to be effective against tumors like renal cells carcinoma [51] and other cancers are under trial [52]. A better understanding of mtor signalling pathways will lead to better insights into control of cell growth, proliferation, and thus, eventually, better therapeutic agents. TSC1 (hamartin) and TSC2 (tuberin) form a tumour suppressor complex. TSC2 is a negative regulator of mtorc1 through its GAP (GTPase-activating protein) activity towards the small G-protein Rheb (Ras homologue enriched in brain) [53, 54]. Rheb is an essential activator of mtor. Loss of TSC2 inhibition therefore leads to excessive mtorc1 activity and oncogenesis (LAM) [55, 56]. TSC2 activation is inhibited by the 23

24 PI3K/Akt pathway [57-59]. Akt phosphorylates TSC2, and leads to loss of its GAP activity and increased mtor activity [58, 60-62]. Therefore, growth factors increase mtor activity via the PI3K pathway; loss of TSC2 leads to constitutively active mtor. Low cellular AMP/ATP ratio cause an increase in 5 adenosine monophosphate (AMP)- activated protein kinase (AMPK), which phosphorylates TSC2 and stimulates GAP activity for Rheb thereby decreasing mtorc1 activity [63]. Glucose also regulates mtor via AMPK, likely by altering cellular ATP levels [64]. The exact mechanisms by which growth factor signalling through the TSC complex modifies mtorc2 activity are unknown. Essential amino acids directly activate mtorc1 via signal transduction mechanisms independent of TSC2. Amino acids result in activation of the Rag family of GTPases, which than interact with raptor, and mediate increases in mtor activity [65, 66]. Regulation of transcription by mtor: Several studies indicated that mtor can localize to the nucleus, especially in transformed or cancer cells [67]. In addition, others have shown that mtor can interact with transcription factors (e.g., STAT3, HIF-1a). mtor directly bound chromatin DNA, and was required for the transcription of genes involved in mitochondrial biogenesis [68-70]. The regulation of survival or apoptosis transcriptional programs by mtor, a key sensor of nutritional and mitogen stimuli, is poorly understood. Studies have shown that TORC1 is important for gene transcription in yeast [16] and requires the TOR-associated phosphatase subunits Tap42 and Pph1. Reduced TOR activity increases the nuclear import of the stress response transcription factors Gln3 or Msn2/4. The nuclear import 24

25 adaptor (karyopherin) Srp1 is required for Gln3 Nuclear import [17]. The mammalian homologues of Tap42 and Pph1 are α4 and PP2Ac; Srp1 is karyopherin-α1 (KPNA1/importin-α5) [18, 40]. In our lab it was demonstrated that modulation of mtorc1 or PP2Ac activity enhanced KPNA1-mediated STAT1 nuclear import and caused the induction of STAT1-dependent apoptotic genes [71]. Previous work in Dr. Kristof s lab demonstrated a physical interaction between mtor, PKCδ and STAT1, thereby establishing a potential link between mtor and apoptosis transcriptional programs. STAT1 and interferons: Interferons and STAT1 play an important role in inflammation, infection, and tumor immunosurveillance. IFNs are pleiotropic cytokines released during the innate immune response, and have anti-viral, anti-proliferative, anti-tumor and immunomodulatory properties thus affecting cell growth and cell survival [72-76]. There are two types of IFNs; type I IFNs consist of IFN-α, IFN-β, IFN-ω and IFN-k and type II IFNs include only IFN-γ. IFNs bind to cell surface receptors and activate Janus kinases (JAKs), which result in activation of MAPKs, Src-family kinases, G-protein-linked signalling molecules and protein tyrosine phosphatases [77]. Activated JAKs phosphorylate STATs, especially STAT1 and STAT2. They form homo or heterodimers, and mediate downstream interferon-stimulated transcriptional responses. IFNs and STAT1 also facilitate cell death by making cells susceptible to pro-apoptotic cytokines such as TNF-α, Fas, or TRAIL [78-82]. The binding of type I and II IFNs to their respective receptors, and activation of the JAK/STAT pathway, are critical for IFN-dependent gene regulation. In general, type I 25

26 interferons lead to the formation of STAT1/STAT2 heterodimers, and type II interferons cause STAT1 homodimerization (Figure 3). They bind interferon-sensitive response elements (ISREs) and gamma-activated sequences (GAS), respectively, resulting in tight and specific regulation of IFN-stimulated transcriptional programs during inflammation and immunity. Finally, IFNs can activate a number of other signaling pathways (e.g., Erk, p38 MAPK, PI3k) that contribute to pleiotropic STAT-dependent and independent signaling responses [83-94]. 26

27 Figure 3 Figure 3: Interferon and JAK-STAT signalling The type I IFN receptor is composed of two subunits, IFNAR1 and IFNAR2, which are associated with JAK1 and TYK2. Similarly, type II IFN, which is composed of IFNGR1 and IFNGR2 is associated with JAK1 and JAK2. Activation of JAKs, linked with type I IFN receptor results in tyrosine phosphorylation of STAT2 or STAT1. Type II IFN receptor lead to phosphorylation of STAT1. 27

28 Type I Interferons (e.g., IFN-α, IFN-β) are cytokines that have anti-proliferative, cytotoxic, and anti-viral and immunomodulatory effects. They bind to target cell receptors, and receptor-associated TYK2 and JAK1 kinases are activated. Downstream effectors include STATs, IRS-PI3Kinase, Crk, and mitogen activated protein (MAP) kinases pathways [95]. Type I interferons (IFNs) bind to a common receptor known as the type I IFN receptor. This receptor is made up of two subunits, IFNAR1 and IFNAR2 associated with the (JAKs) tyrosine kinase 2 (TYK2) and Janus activated kinase 1 (JAK1), respectively. STAT1 nuclear translocation occurs after it is phosphorylated on Y701, and STAT2, at Y690, leading to an orientation permissive for the SH2 domain-dependent dimerization [96-99]. This leads to formation of the STAT1 STAT2 IRF-9 (IFN-regulatory factor 9) complex [100]. These ISGF3 (IFN-stimulated gene (ISG) factor 3) complexes translocate to the nucleus and bind IFN-stimulated response elements (ISREs) in the promoters of IFN-sensitive genes (ISGs), and initiate gene transcription [75, 101]. Independent of Y701, STAT1 can be phosphorylated at S727 by PKCδ or calmodulin-dependent Kinase-II independent (CaMK-II). Certain stimuli like LPS, TNF-α and UV radiation can induce this modification in a p38 MAPK-dependent fashion [95, ]. Phosphorylation of STAT1 at S727 is required for maximal transcriptional activity. The type II IFN (IFN-γ) is a known pro-inflammatory cytokine [ ] and an important mediator of innate immunity against infection, as well as tumour immune surveillance [111]. It binds a receptor heterodimer consisting of the interferon gamma receptor 1 (IFN-γR1) and the interferon gamma receptor 2 (IFN-γR2); these associate with JAK1 and JAK2, respectively, resulting in conformational change and activation of JAK-STAT 28

29 pathway [112]. STAT1 homodimer formation occurs after its phosphorylation at Y701 by JAK [113]. The STAT1 STAT1 homodimers translocate to the nucleus and bind to GAS (IFN-γ activated site) in the promoters of early IFN sensitive genes [101]. For instance, interferon regulatory factor 1 (IRF-1) is one of the early interferon-γ-activated genes, and leads to expression of later IFN-response genes and STAT1 itself [ ]; this constitutes a positive feedback loop for STAT1-dependent STAT1 expression. The phosphorylation of S727 is required for full transcriptional activity [96], but not for translocation of STAT1 to the nucleus or binding of STAT1 to DNA. Cells expressing a S727 to alanine mutant of STAT1 exhibited deficient induction of anti-proliferative and antiviral genes [117, 118]. Transcriptional targets of IFNs and STAT1: IFNs perform inhibitory and pro-apoptotic activities primarily via STAT1. For example, IFN-γ upregulates the expression of Fas, FasL, TRAILR and TRAIL in STAT1-dependent fashion [119, 120]. Other factors (e.g., angiotensin-ii, epidermal growth factor) can lead to STAT1 activation either in JAK-dependent or independent fashion [121, 122] [123, 124]. STATs are the only known transcription factors activated directly by tyrosine phosphorylation [ ]. After homo or hetero-dimerization STAT1 goes through conformational changes which confer DNA binding properties, and activation of target genes. 29

30 STAT isoforms and functions: The mammalian STAT family consists of 7 known members each with specific cellular functions [129]. STAT1 belongs to the family of STAT transcription factors and signal transducers which are present in all higher eukaryotic organisms [130]. They were discovered as DNA binding domains activated by Type I IFNs [99, 131]. STAT1 and STAT2 are involved in IFN mediated cellular responses such as proliferation, differentiation, survival, and apoptosis [ ]. Thus, loss of STAT1 leads to increased tendency for malignant transformation, and decreased cellular apoptosis in response to TNFα [136]. Animals deficient in specific STATs led to discovery of their functions; STAT3 promotes cell survival/proliferation and immune tolerance, STAT4 is important for development of T helper 1 cells and STAT6 is important for development of T helper 2 cells [132, ]. Continuous STAT stimulation and cell signalling can lead to immune dysfunction, excessive cell proliferation and neoplasms [ ]. STAT1 structure: Different STATs exhibit diversity in their functions but they share a similar structural arrangement. STAT1 functional motifs consist of: (i) an amino terminal domain/nterminus, (amino acids 1-130), which mediates dimerization and stabilization of STAT1 through phosphorylation), (ii) a coiled-coiled domain (amino acids ), which is responsible for protein-protein interactions (iii) a partially conserved central DNA binding domain (amino acids ) that contains the nuclear import/export sequences and a linker domain, and (iv) a carboxyl/c-terminal to the linker domain is the 30

31 Src homology 2 (SH2) domain which mediates STAT1 binding to tyrosine phosphorylated receptors. [95, 125, 127, 145]. A C-terminal transactivation (TA) domain contains phosphorylation sites that modulate the activity of STAT1 in response to tyrosine kinases. Phosphorylation of C-terminal transactivation (TA) domain at S727 by factors like IL-1, TNFα and UV irradiation, has an important role in optimal transcriptional activation [146]. STAT1 nuclear trafficking: STAT1 nuclear-cytosolic trafficking is integral to its function as a signal transducer and activator of transcription. STAT1 nuclear import is mediated by karyopherin-α1, a member of a family of proteins that includes importin-α isoforms, importin-β, and exportins. Importin-α bind to the nuclear localization signals (NLS) and forms a ternary complex with importin-β. This complex binds nuclear pore components, and enters the nucleus in a Ran-GTPase-dependent mechanism [147]. Once in the nucleus, the complex dissociates, and importin-α is exported back into the cytoplasm. Karyopherinα1 (KPNA1, NPI-1 or importin-α5) mediates STAT1 nuclear import [148]. Phosphorylation at Y701 causes dimerization, unmasking of the NLS, and nuclear import of STAT1 by KPNA1 [ ]. STAT1 export is facilitated by exportins, which recognize the nuclear export signals (NES). Once in the nucleus, the STAT1 dimer binds to the DNA target sites present in the promoters of target genes. T-Cell Protein Tyrosine Phosphatase (TC PTP) is a phospho-tyrosine-specific protein phosphatase which dephosphorylate STAT1, and permits nuclear export [ ] by unmasking a nuclear export sequence. STAT1 then 31

32 binds CRM1, a nuclear export carrier [148, 154, 157, 158]. The nuclear export signal of STAT1 appears to be masked when dimers are bound to DNA, but it is exposed after dissociation from DNA (Figure 4). Nuclear export is also facilitated by phosphorylation of STAT1 at S727 [80]. 32

33 Figure 4 Figure 4: STAT1 and nuclear trafficking STAT1 tyrosine-phosphorylation leads to homodimer formation, which is imported into the nucleus by importin-α5. Nuclear STAT1 associates with DNA targets and induces transcription. Dephosphorylation of STAT1 leads to its release from DNA, and the NES (nuclear export signal) becomes accessible for CRM1- (chromosome region maintenance 1) mediated export. 33

34 Latent STAT1 and its functions: Much of the work on STAT1 nuclear import focused on cells activated by IFN-γ, and the tyrosine phosphorylation of STAT1 at Y701. However, latent STAT1, (i.e., unphosphorylated STAT1) can also undergo nuclear import [159]. Experiments done in STAT1-deficient cells, or those reconstituted with a STAT1 Y701F mutant, showed that latent STAT1 can also mediate the transcription of a distinct sets of genes [160]. The nuclear levels of latent STAT1 depend on its interaction with certain factors. For instance, latent STAT1 can bind IRF-1 and regulate innate immune gene transcription [154]. Moreover, in the absence of IFN, there is still expression of STAT1-dependent apoptosis and immunomodulatory genes like caspase-3, p27, and LMP1 [136, 161]. STAT1 is a regulator of apoptosis: STAT1 performs its apoptotic functions by affecting cell death and survival responses. It directly induces pro-apoptotic genes, modifies the activity of other apoptotic regulators, interacts with apoptotic proteins and suppress survival responses. For instance, STAT1 has been found to control expression of IRF-1, Fas, FasL, TRAIL, Bak and Bax [162, 163]. STAT1 also interacts with p53, a known cell cycle suppressor and apoptotic factor, and acts as co-activator for p53-dependent apoptosis genes [162, 164]. The role of PKCδ, another mtor-interacting protein, in latent STAT1 nuclear trafficking and mtorc1 signalling is poorly understood. Protein Kinase C- delta (PKC-δ) can be activated by Type I Interferons, and mediates phosphorylation of STAT1 on S727. IFN-α-dependent gene transcription was blocked using pharmacological and molecular inhibitors of PKCδ. 34

35 Apoptosis: Apoptosis (programmed cell death) plays a significant role in embryogenesis and in eliminating infected, damaged, or senescent cells. It is distinct from other cell death processes, as cell integrity is maintained until cells form apoptotic bodies which are removed by phagocytic cells, and the inflammatory response is not provoked. An apoptotic cell exhibits shrinkage, nuclear condensation, and DNA cleavage. Extrinsic factors like Fas, TNF, DNA damage, UV or gamma irradiation, inhibition of protein synthesis, and viral infection, initiate the expression of death receptors which are present on the cell membrane. The intrinsic pathway is then activated resulting in loss of mitochondrial membrane potential. Eventually these processes result in proteolysis of zymogen caspases [ ]. The activated caspases, including caspase-3, cause the morphological and biochemical changes of apoptosis. The proteolytic cleavage of caspase-3 is a recognized biomarker of apoptosis. Apoptosis can be divided into two biochemical processes/phases. The commitment phase is the period initiated by apoptosis-inducing signals before cells undergo apoptosis. The execution phase, or suicide phase, is irreversible and results in changes in the cytoplasmic membrane, breakdown of the nuclear envelope, condensation of chromatin structure, and chromatin cleavage. The execution phase is characterized by activation of caspases. A defective apoptotic process is associated with chronic inflammatory and proliferative disorders as infected cells are not removed. Dysfunctional apoptosis can lead to cancer formation, or resistance to chemo- or radiotherapy resistance [169]. Excessive 35

36 apoptosis can result in diseases like acute lung injury (ALI) due to damage to the lung epithelium [165]. Caspase-cascade system: Caspases are a group of cysteine proteases related to the prototype interleukin-1bconverting enzyme (caspase-1). Poly (ADP-ribose) polymerase, DNA-dependent protein kinase, and nuclear laminae are the targets of these caspases [170, 171]. Caspases play vital roles in intracellular apoptotic signals. Activation of initiator caspases requires specific oligomeric adaptor proteins. Eventually the effector caspases are activated through their proteolytic cleavage. The expression of caspapses-1, 2, 3, 7 and 8 is directly controlled by STAT1 [136, ]. The cleavage of caspase-3 is considered a marker of apoptosis. PKCδ (protein kinase C- delta) and apoptosis: PKCδ is a serine/threonine kinase, a kinase for STAT1, and a member of the PKC family of lipid-regulated kinases [71, 99]. It is found ubiquitously and is important for cell homeostasis, growth, differentiation and apoptosis by phosphorylating signaling intermediates and transcription factors (e.g., p53). The regulation of biological functions like proliferation, differentiation, migration, immunity, and apoptosis by PKCδ is not completely understood. However during activation, PKC isoforms translocate from the cytosol to membrane or cell organelles. Type I IFNs activate PKCδ, which can then associate with, and phosphorylate, STAT1 on S727 [ ]. 36

37 PKCδ can act as a potent apoptotic agent. In its inactive state, it resides in the cytoplasm, and its nuclear localization sequence (NLS) is prevented from interacting with importin-α [182]. Apoptotic signals leads to tyrosine phosphorylation of PKCδ (regulatory domain) at Y64 and Y155 [183], resulting in PKCδ nuclear translocation and activation of cell death signals. During apoptosis PKCδ also translocates to mitochondria and causes an alteration in calcium signalling to mediate: (i) the H2O2-induced loss of membrane potential, (ii) release of cytochrome c, and (iii) activation of caspase-3. Moreover, PKCδ is proteolytically cleaved and activated by caspase-3 [ ]. The cleaved catalytic fragment of PKCδ translocates to the nucleus and induces apoptosis; it is unclear whether the cleavage of PKCδ requires its tyrosine phosphorylation [185]. A conserved PPxxP motif overlapping the NLS was found to play important role in preventing the binding of karyopherin-α, and the resulting cytoplasmic retention of PKCδ [182]. Regulation of STAT1 by mtorc1 and potential role of PKCδ: When inactivated under conditions of metabolic or mitogenic stress (e.g., nutrient deprivation, serum withdrawal), mtorc1 can also control stress transcriptional responses. The Kristof lab found that when inactivated by its inhibitor rapamycin, mtor physically associated with STAT1, a pro-apoptotic and pro-inflammatory transcription factor, as well as its kinase PKCδ [99]. mtorc1 activity attenuated the activation of STAT1-dependent apoptosis genes, and suppressed apoptosis in cells exposed to interferons. The function of PKCδ in the mtor/stat1 pathway is unknown; however, PKCδ is a known kinase for STAT1, and a TOS motif in PKCδ mediated its physical 37

38 association with raptor (i.e., mtorc1; data not shown). The hydrophobic motif in PKCδ can be phosphorylated in an mtorc1-sensitive fashion [187, 188]. Phosphorylation of S662 is mtor dependent, and results in optimal activity of PKCδ [187, 189, 190]. Taken together, a physical interaction between PKCδ and mtorc1 would appear to be essentially for coordinated PKCδ activity, and mtorc1 might suppress STAT1- dependent apoptosis via a physical interaction with PKCδ [71]. Thus analysis of the PKCδ TOS motif would provide evidence as to its role in the control of KPNA1-mediated STAT1 nuclear import by mtorc1. Finally, the TOS motif could be an important therapeutic target in promoting apoptosis in diseases of excessive mtor activity (e.g., tuberous sclerosis complex, lymphangioleiomyomatosis). 38

39 SECTION 2: HYPOTHESIS mtorc1 suppresses apoptosis by attenuating STAT1 transcriptional activity and expression via a physical interaction with PKCδ mediated by its target of signaling (TOS) motif. 39

40 SECTION 3: MATERIALS AND METHODS Adenovirus type 5-transformed human embryonic kidney cells (HEK 293T) were obtained from Dr. S. Lemay. Human fibrosarcoma cells (2fTGH) and their mutagenized STAT1-deficient counterparts (U3A cells) were generously provided by Dr. G. Stark (Cleveland clinic) [191]. Each was propagated as previously described [192]. Dulbecco s Modified Eagle Medium (DMEM), Fetal Bovine Serum (FBS), Penicillin-Streptomycin, Lipofectamine LTX, Lipofectamine 2000 were obtained from Invitrogen Canada Inc. (Burlington, ON). Plasmid Plus Midi Kit was obtained from Qiagen (Mississauga, ON). Rapamycin was obtained from EMD Biosciences (Mississauga, ON). Human recombinant IFN-γ was obtained from Roche Applied Science (Laval, QC). Human recombinant IFN-β was obtained from BD Biosciences (Mississauga, ON). Hygromycin and rottlerin was obtained from Bioshop (Montreal, QC). SuperSignal West Pico Chemiluminescent Substrate (ECL) was obtained from Thermo Fisher Scientific (Rockford, IL). Bio-Rad Protein Assay Dye Reagent was from Bio-Rad (Mississauga, ON). Amersham Hybond-ECL nitrocellulose paper was obtained from GE Healthcare (Montreal, QC). Rabbit anticleaved caspase-3, rabbit anti-total STAT1, rabbit anti-phospho-stat1 (S727), rabbit anti- S6 (S235/236), rabbit anti-total p70 S6 kinase and rabbit anti- p70 S6 kinase (ps6k T389) antibodies for Western blot were obtained from Cell Signaling (Danvers, MA). Rabbit anti-v5 antibodies were obtained from Millipore. Mouse anti-β-actin antibodies were obtained from Sigma-Aldrich Canada (Mississauga, ON). Anti-rabbit and anti-mouse horseradish-peroxidase-conjugated antibodies were obtained from Santa Cruz Biotechnologies (Santa Cruz, CA). All other chemicals, reagents, and biological 40

41 agents were obtained from Sigma-Aldrich Canada (Mississauga, ON) or Bioshop (Montreal, QC) unless otherwise indicated. All 1 antibody dilutions were prepared in 1% BSA + 0.1% NaN3 solution in PBS (filtered and stored at 4 C). Plasmids Vectors Cloning and Mutagenesis: The cdna encoding wild-type PKCδ (Gene ID: 5580) (amino acids 1-676) was cloned by PCR into the Gateway pdonr 221 Entry vector (Invitrogen) using the plasmid pcdna3- PKCδ as a template (kind gift of Dr. S. Listwak, National Institutes of Health), and oligonucleotide primers (listed in Table 2), and verified by automated sequencing. The ΔTOS (425F I) and kinase dead (K378 R) mutants were created by site-directed mutagenesis using the primers (listed in Table 3) and pdon221 PKCδ as a template. For mammalian expression, the wild-type, ΔTOS, or kinase-dead PKCδ cdna was transferred to the gateway destination vectors pcdna3.1/nv5/ecfp-dest (Invitrogen) under the control of a CMV promoter [71]. Vectors were propagated in Escherichia coli with selectivity for ampicillin-resistance. Plasmid isolation and purification was done using the Qiagen Plasmid Plus Midi Kit. 41

42 Table 2: Oligonucleotide primers (5-3 ) for PCR cloning of PKCδ into Gateway entry vector pdonr-221 Transcript Forward Primer Reverse Primer Template PKCδ WT ggggacaagtttgtacaaa ggggaccactttgtacaag pcdna3.1 PKCδ - aaagcaggctatggcgccg aaagctgggttctaaccgg WT ttcctg aacctccatcttc Table 3: Oligonucleotide primers (5-3 ) for PKCδ site-directed mutagenesis Mutation Forward Primer Reverse Primer Template PKCδ TOS ggaccacctgttcattgtgatggag ccgttgaggaactccatcacaat pdonr221- (F425 I) ttc ctcaacgg gaacaggtggtcc PKCδ PKCδ kinase ggagagtactttgccatcagggccc ccttcttgagggccctgatggcaa pdonr221- dead tcaag aagg agtactctcc PKCδ (K378 R) 42

43 Cell culture and treatments: HEK 293T cells were maintained in DMEM containing 10% fetal bovine serum (FBS) and penicillin 100 U/ml, streptomycin 100 U/ml antibiotic. 2fTGH and U3A cells were also maintained in DMEM supplemented with 10% fetal bovine serum and hygromycin, 100 µg/ml. All cell lines were cultured at 37 C and 5% CO2. Cells were re-fed prior to experimentation with the appropriate growth media. For mtorc1 blockade, cells were incubated with rapamycin, 50 ng/ml, in serum-containing media for 24hrs. For cytokine treatment, cells were incubated with 250 U/ml and 100 U/ml IFN-β and IFN-γ, respectively, in serum-containing media for the indicated durations. Transfection of HEK 293 cells: 2.25x10^6 HEK 293T cells were plated per 10 cm dish. The next morning, media was changed with 8 ml of fresh medium. Each plate was transfected with empty vector or plasmids for expression of wild type, kinase dead, or ΔTOS PKCδ (4μg - 15μg, adjusted for plasmid molecular weight). A mixture of CaCl₂, HEPES buffered saline (HBS), and DNA was prepared separately for each plate; that is, 500 μl 2X HBS was combined with 440 μl sterile H₂O, DNA, and 61 μl 2M CaCl₂. After incubation for 20 minutes at 21 C, the mix was added drop-wise, and cells were incubated at 37 C overnight. Experiments were performed 48h after the transfection. 43

44 Transfection of 2fTGH and U3A cells: 100, ,000 2fTGH or U3A cells were seeded in 35 mm wells. Cells were transfected after 24 h with empty vector (EV), 0.7 μg, wild type PKCδ (WT), 2 μg, or PKCδ TOS motif mutant (ΔTOS), 2μg, each combined with Lipofectamine 2000, 4 μl. Cells were then contacted with rapamycin (50 ng/ml) or IFN-β (250 U/ml) the next day. Generation of whole cell lysates: Cells were washed with cold D-PBS and mechanically scraped from the plates. For apoptosis experiments whole cell lysates included cells centrifuged from culture supernatants. Cells were centrifuged at 1500 x g for 5 min and then resuspended in lysis buffer (20mM Tris ph 8.0, 0.3% CHAPS, 1mM EDTA, 10mM β-glycerophosphate, 10μg/ml aprotinin, 10ug/ml leupeptin, 1mM PMSF, 50mM NaF, 100μM sodium orthovanadate). Cells were then incubated on ice for 15 minutes in lysis buffer, and lysates were stored over night at -80 C. The next day, samples were thawed on ice, and vortexed for 30 seconds. Supernatants were then centrifuged (13,000 x g for 30 min) to generate particle-free lysates. The resulting supernatant was stored at -80 C for future use. Proteins in cell lysates were quantified by Bradford assay. Detection of proteins and densitometry: Proteins from whole cell lysates were detected by Western blot analysis. Equal quantities of protein were separated by SDS-PAGE, and electrophoretically transferred to nitrocellulose membranes. Membranes were blocked (in 5% fat-free dry milk) for 1 h. 44

45 They were then incubated overnight with primary antibody at 4 C. Membranes were then washed, and incubated with secondary antibody conjugated to horseradish peroxidase for 1 h at room temperature, followed by enhanced chemiluminescence reagent (ECL). Protein bands were imaged, and densities (densitometry) were measured using The Discovery Series Quantity One 1-D Analysis Software Version Comparisons were made by Student s t-test, and are indicated in the figure legends. Statistically significant differences were defined as those with p < Crystal violet staining: 2fTGH or U3A cells were plated at 150,000 cells/well in 35 mm dishes as described above. Following treatment with rapamycin, 50 ng/ml, or 5µM rottlerin, cells were washed once in PBS before staining with 0.05% Crystal violet solution for 5 minutes. Cells were then washed 3 times with PBS, before solubilization in 1% SDS. The relative staining of Crystal violet staining was measured by absorption spectrophotometry (λ = 570nm). 45

46 SECTION 4: RESULTS Inhibition of the interaction between PKCδ and raptor (mtorc1) results in increased in apoptosis. Apoptosis was analyzed by Western blot by assessing the levels of cleaved caspase-3 (CCasp 3). In HEK 293T cells, expression of the PKCδ TOS motif mutant (ΔTOS) led to a significant increase in CCasp 3 levels in untreated cells as compared to those expressing wild-type PKCδ (WT) (Figure 5). These data suggest that the interaction between PKCδ and mtorc1 is required for mtor suppression of apoptosis. Inhibition of the interaction between PKCδ and raptor (mtorc1) results in increased STAT1 levels. mtor suppresses STAT1 nuclear import and transcription of pro-apoptotic genes associated with IFNs signalling, including STAT1 itself. We reasoned that the effect of PKCδ ΔTOS expression on apoptosis should correlate with its effect on STAT1 levels. HEK 293T cells were transfected with plasmid vectors for the expression of wild-type PKCδ (WT), or the mutant of PKCδ (ΔTOS). Expression of PKCδ ΔTOS in HEK 293T cells, increased constitutive STAT1 level as compared to cells expressing WT PKCδ. In HEK 293T cells overexpressing WT and ΔTOS, IFN-β treatment led to an increase in STAT1 levels, indicating intact STAT1 transcriptional activity. However the effect of rapamycin was reduced in cells expressing the ΔTOS mutant (Figure 6A). Thus, consistent with the loss of mtorc1 suppression, expression of PKCδ ΔTOS blocks rapamycin induced an increase in STAT1 levels in cells exposed to IFN-β. As previously shown, phospho-stat1 46

47 S727 (active STAT1) levels correlate with total STAT1 levels suggesting that the PKCδ ΔTOS mutant retains kinase activity. In control experiments, rapamycin blocked the phosphorylation of p70 S6 kinase at T389; p70 S6 kinase phosphorylation was not affected by the ΔTOS mutation (Figure 6B). The PKCδ ΔTOS mutation does not affect phosphorylation of STAT1 or PKCδ kinase activity. Molecular modelling of PKCδ indicates that the TOS motif lies in a β-sheet that opposes the active site in the kinase domain. We therefore determined whether the ΔTOS mutation affects the phosphorylation of STAT1 at S727, a surrogate for PKCδ kinase activity. In cells expressing both WT and ΔTOS PKCδ, activation with IFN-γ and IFN-β for 30 minutes induced the phosphorylation of STAT1 at S727 (Figure 7A). There was no change in total STAT1 levels. In contrast, expression of a kinase-dead isoform of PKCδ (dominant-negative, DN) reduced IFN-γ or β induced phosphorylation of STAT1 at S727 (Figure 7B). These results indicate that the ΔTOS mutation affects PKCδ interaction with raptor (data not shown), but likely not its kinase activity. The TOS motif alters rapamycin-induced apoptosis in human fibrosarcoma cells. Unlike in the highly transformed HEK 293T cell line, rapamycin alone induced apoptosis in human fibrosarcoma (2fTGH) cells. In order to investigate the role of PKCδ, STAT1 and mtorc1 in cell survival and viability, we incubated 2fTGH, and its STAT1-dependent counterpart (U3A), cells with rapamycin for 24h. In previous studies [1], we showed a significant increase in LPS/IFN-β-induced apoptosis (CCasp 3 levels) with rapamycin 47

48 treatment in 2fTGH cells, but not in STAT1-deficient (U3A) cells. Consistent with these findings, rapamycin increased cleaved caspase 3 (CCasp 3) levels in empty vector (EV) (Figure 8B) or WT PKCδ-expressing 2fTGH cells (Figure 8A). As was the case for HEK 293T cells, expression of PKCδ ΔTOS in 2fTGH cells increased basal CCasp 3 levels (Figure 5). Interestingly, rapamycin-induced cleavage of CCasp 3 was blocked by rapamycin in ΔTOS-expressing cells, suggesting inhibition of an alternate mtorc1 pro-apoptotic effect (Figure 8A). Expression of PKCδ does not restore apoptosis in STAT1-deficient (U3A) cells. Basal CCasp 3 levels in empty vector-transfected 2fTGH cells served as positive control for apoptosis. Expression of WT or ΔTOS PKCδ in U3A cells did not restore CCasp 3 levels to those basal levels observed in 2fTGH cells (Figure 8C). Western blots for STAT1 blot confirmed loss of expression in U3A cells (Figure 8C). Moreover, levels of endogenous PKCδ were similar in U3A and 2fTGH cells (Figure 8D). Effect of PKCδ TOS-motif mutant (ΔTOS) on total-stat1 levels correlates with CCasp 3 levels. Rapamycin increased STAT1 levels in EV-transfected 2fTGH cells or in those expressing WT PKCδ (Figure 9A, B). Expression of PKCδ ΔTOS blocked the rapamycininduced increase in STAT1 levels (Figure 9A). Consistent with inhibition of mtorc1, rapamycin blocked the phosphorylation of ribosomal S6 (p-s6; Figure 9C). Unlike HEK 293T cells, the increase in basal levels of STAT1 in PKCδ ΔTOS- vs. WT-expressing cells 48

49 was not statistically significant in 2fTGH cells, perhaps reflecting an enhanced effect of the PKCδ expression of STAT1 expression. Effect of PKCδ ΔTOS mutant and rapamycin on cell viability. To determine weather changes in CCasp 3 correlate with cell viability, we assessed Crystal violet staining. Cell viability reflects growth, proliferation, survival and attachment. Cell viability was reduced in both 2fTGH and U3A cells after exposure to rapamycin (Figure 10A). Inhibition of PKCδ activity by rottlerin reduced viability to a greater extent in 2fTGH cells than in U3A cells indicating that the reduction partly required STAT1. Rapamycin did not further decrease viability in 2fTGH cells, suggesting that PKCδ and mtorc1 might constitute a linear signalling pathway. However in STAT1- deficient U3A cells, rapamycin further decreased viability in rottlerin-treated cells (Figure 10A; p < 0.05 for bar 8 vs. 6). These data indicate that when PKCδ activity is blocked, rapamycin can further reduce cell viability in a mechanism that is normally attenuated by STAT1, and that is not apoptosis. We next examined the effect of the ΔTOS mutant on cell viability. Unlike apoptosis (Figure 5, 8), expression of the ΔTOS mutant did not further decrease basal cell viability. In 2fTGH cells expressing PKCδ ΔTOS, and incubated with rottlerin, rapamycin further reduced cell viability. This effect of rapamycin was lost in STAT1-deficient U3A cells, suggesting that inactive PKCδ might have STAT1-dependent anti-viability effect that requires its interaction with raptor (Figure 10B). 49

50 Figure 5 Figure 5: Cleaved caspase-3 levels in HEK 293T cells expressing PKCδ ΔTOS mutant HEK 293T cells expressing wild-type PKCδ (WT) or a mutant of PKCδ (ΔTOS) were incubated with vehicle (10% serum media), IFN-β, 250 U/ml or rapamycin, 50 ng/ml, for 24h. Proteins in whole cell lysates, 80 µg were separated by SDS-PAGE, and detected by Western blot analysis. Data shown are the means of band density normalized to control = 1 from 4 independent experiments ± SEM. *p < 0.05 vs. wild-type PKCδ (WT). 50

51 Figure 6 51

52 Figure 6: STAT1 levels in HEK 293T cells expressing PKCδ ΔTOS mutant HEK 293T cells were incubated with vehicle, IFN-β, 250 U/ml or rapamycin, 50 ng/ml, for 24h. Proteins in whole cell lysates, 5 µg, were separated by SDS-PAGE, and detected by Western blot analysis using antibodies against STAT1, phospho-stat1 S727, and phospho-p70 S6 kinase. Data shown are the means of band density normalized to control = 1 from 4 independent experiments ± SEM. *p < 0.05 vs. wild-type PKCδ (WT) control; p < 0.05 vs. WT exposed to IFN-β; p < 0.05 vs. TOS mutant (ΔTOS) control; p < 0.05 vs. ΔTOS exposed to IFN-β. 52

53 Figure 7 53

54 Figure 7: Effect of the ΔTOS mutation on phosphorylation of STAT1 at S727 HEK 293T cells were transfected with plasmids for the expression of A. wild-type (WT) or TOS mutant (ΔTOS), or B. empty vector (EV) or dominant-negative (DN) PKCδ. Cells were exposed to vehicle, IFN-β, 250 U/ml, or IFN-γ, 100 U/ml, for 30 min. The indicated proteins in whole cell lysates, 40 µg, were separated by SDS-PAGE and detected by Western blot analysis. Data shown are the means of band density normalized to control = 1, from 4 independent experiments ± SEM. A. *p < 0.05 vs. wild-type PKCδ (WT) control; p < 0.05 vs. TOS mutant (ΔTOS) control; p=0.06 vs. ΔTOS control; B. *p < 0.05 vs. empty vector (EV) control; p < 0.05 vs. dominant-negative PKCδ (DN) control; p < 0.05 vs. EV exposed to IFN-γ 54

55 Figure 8 55

56 Figure 8: Regulation of rapamycin-induced apoptosis by the PKCδ TOS motif and STAT1 STAT1 expressing human fibrosarcoma (2fTGH) cells (A. and B.) or their STAT1-deficient counterparts (U3A cells) (C.) were transfected with empty vector (EV), or plasmids for the expression of wild-type PKCδ (WT) or its TOS mutant (ΔTOS). Cells were incubated with vehicle or rapamycin, 50ng/ml, for 24h. In D., PKCδ levels were compared in U3A and 2fTGH cells. Proteins in whole cell lysates were separated by SDS-PAGE, and detected by Western blot analysis. Data shown are the means of band density normalized to control = 1 from 4 independent experiments ± SEM. A. *p < 0.05 vs. wildtype PKCδ (WT) control; p < 0.05 vs. TOS mutant (ΔTOS) control; B. *p < 0.05 vs. empty vector (EV) control. 56

57 Figure 9 57

58 Figure 9: Regulation of rapamycin-induced STAT1 levels by the PKCδ TOS motif Human fibrosarcoma (2fTGH) cells were transfected with empty vector (EV), or plasmids for the expression of wild-type PKCδ (WT) or its TOS mutant (ΔTOS). Cells were incubated with vehicle or rapamycin, 50 ng/ml, for 24h. Proteins in whole cell lysates were separated by SDS-PAGE, and detected by Western blot analysis. Data shown are the means of band density normalized to control = 1 from 4 independent experiments ± SEM. A. *p < 0.05 vs. wild-type PKCδ (WT) control; p < 0.05 vs. TOS mutant (ΔTOS) control; B. *p < 0.05 vs. empty vector (EV) control; C. *p < 0.05 vs. EV control; p < 0.05 vs. WT control; p < 0.05 vs. ΔTOS control. 58

59 Figure 10 59

60 Figure 10: Effect of PKCδ activity and the TOS motif and STAT1 on cell viability (A) 2fTGH or U3A cells were exposed to 5 µm rottlerin or rapamycin, 50 ng/ml, for 24h before assessment of cell viability by Crystal violet staining and measurement of optical density of the solubilized dye. (B) 2fTGH (Upper Panel) or U3A (lower panel) cells expressing wild-type (WT) or TOS-mutant (ΔTOS) PKCδ were exposed to vehicle, rapamycin, 50ng/ml, 5 µm rottlerin, or both, before assessment of viability by Crystal violet staining. Crystal violet-stained cells were solubilised in 1% SDS, before spectrophotometer absorbance readings at 570 nm after correction for the optical density at 620 nm. Data shown are the means of band density normalized to control = 1 from 4 independent experiments ± SEM. A. *p < 0.05 vs. 2fTGH control; p < 0.05 vs. U3A control; B. *p < 0.05 vs. WT or ΔTOS 2fTGH control; NS (not significant) vs. WT or ΔTOS U3A control. 60

61 SECTION 5: DISCUSSION Summary: In this thesis, I established that PKCδ couples mtorc1 to the inhibition of STAT1 protein expression and cleaved caspase-3 levels (a marker of apoptosis). The function of PKCδ as an mtorc1 effector protein was previously unknown. We explored the PKCδ TOS motif, a sequence that mediates the interaction with mtorc1, and found that its mutation enhances STAT1 expression and cleaved caspase-3 levels. The TOS motif is a highly conserved amino acid sequence that mediates the interactions between raptor, the key mtorc1 adaptor protein, and its effector proteins [193]. It is thought that through their interactions with raptor, TOS-containing proteins localize to mtorc1 complexes and coordinate downstream mtorc1 effector functions in cell growth, proliferation and survival [48, 49]. Although the TOS motif lies in close proximity to the PKCδ kinase domain active site (Figure 2), the ΔTOS mutant likely retained kinase activity; that is, interferon-induced phosphorylation of STAT1 at S727 was retained, and phosphorylated STAT1 levels correlated with total STAT1 (Figure 6A). Moreover, expression of the ΔTOS mutant did not affect the phosphorylation of another known mtorc1 effector, p70 S6 kinase, suggesting its regulation of a distinct effector pathway. Finally, the effect of PKCδ on rapamycin-induced apoptosis required STAT1, indicating that the PKCδ, through its TOS motif, in part mediates the suppressive effect of mtorc1 on STAT1 expression and cleaved caspase-3 levels. 61

62 TOS motif sequence and protein conformation: We found that PKCδ TOS motif was required for suppression of STAT1 by mtorc1. mtorc1 interacts with the downstream regulators through their TOS motifs. The importance of the TOS motif in mtor signalling is reflected in its identification and localization in other mtor regulated proteins. mtorc1 effectors include S6K, 4EBP1, PKCδ, HIF1A and STAT3, and contain a highly-conserved amino acid sequences termed the TOR signalling (TOS) motifs [26]. TOS motifs in these proteins are similar to one another; 4E-BP1, 4E-BP2, PKCδ, PKCε TOS motifs are FEMDI, FEMDI, FVMEF, FVMEY, respectively. TOS motifs are found in β-sheets, for example in the N terminus of S6K1, and the C terminus of 4E-BP1. They permit binding to raptor and coordinate mtor phosphorylation of S6K1 and 4E-BP1. Point mutations in the TOS motifs result in loss of their interaction with raptor [194]. For instance, the TOS motif links mtor with p70 S6 kinase in rapamycin sensitive manner [22, 23, 25-27]. Interestingly, TOS motifs in raptor-interacting proteins are similar (Table 1) but not identical. Mutagenesis studies indicated that replacement of the p70 S6 kinase TOS motif with that in 4E-BP1 blocked its mtorc1-dependent phosphorylation [195]. Thus, the TOS motif may confer specificity for interactions between raptor and its respective substrates [193, 196]. For the five amino acid residue TOS motif, the first residue, phenylalanine, is most critical. Mutation of the phenylalanine to alanine resulted in loss of raptor interaction with C- terminal fragment of human 4E-BP1 [193, 196]. Thus, the TOS motif is important for the conformational changes in structure and stability of the respective proteins, thus affecting their interaction with raptor. 62

63 TOS motif operates independently of PKCδ kinase activity: Structural modelling permits insights into the potential mechanism by which the TOS motif affects PKCδ intermolecular interactions. A 3D structure of PKCδ kinase domain based on database models (Figure 2) revealed a TOS motif in the N-terminus portion of the kinase domain, buried within five folded β-sheets at the interior of the molecule, and located in close proximity to the active site. I therefore confirmed that the TOS mutation does not affect kinase activity (Figure 6). PKCδ-dependent phosphorylation of STAT1 at S727 was retained in PKCδ ΔTOS-expressing cells. As expected, phosphorylation of STAT1 at S727 was attenuated in PKCδ kinase-dead-expressing cells. Also, phosphorylated STAT1 levels correlated with total STAT1 in ΔTOS-expressing cells. Thus, ΔTOS is not a dominant-negative mutation for PKCδ kinase activity or phosphorylation of STAT1. In contrast to an effect on kinase activity, we hypothesize that the TOS motif confers a conformation in PKCδ that facilitates its surface interaction with raptor. Future mutagenesis studies will identify the exact point of contact between PKCδ and raptor, which may represent a druggable target. Nonetheless, our findings, taken with those from previous studies, show that this sequence may be one mechanism by which mtorc1 suppresses PKCδ activity and programmed cell death (apoptosis) as indicated by cleaved caspase-3 levels. mtorc1 and the STAT1 positive feedback loop: We previously showed that inactivation of mtorc1 promoted STAT1 nuclear translocation, induction of its own (STAT1) transcription, and enhanced expression of 63

64 STAT1-dependent genes in a positive feedback loop (Figure 11). Mutation of the TOS motif blocked the ability of rapamycin to enhance IFN-β-induced STAT1 protein levels or apoptosis in HEK 293T cells (Figure 6A). This mutation also blocked the ability of rapamycin to increase STAT1 protein levels or apoptosis in 2fTGH cells (Figure 9A, 8A). This indicates that the interaction between PKCδ and raptor is required for the suppression of cleaved caspase-3 levels or STAT1 expression by mtorc1. Previous studies showed that inactivation of mtorc1 led to increased STAT1 nuclear import, STAT1 transcriptional activity, and STAT1 expression [1]. Other groups have shown that rapamycin enhances the production of innate immune cytokines from dendritic cells [197]. Rapamycin increased nuclear STAT1 levels by blocking mtorc1 [198]. This increased the levels of STAT1-dependent early and late apoptosis genes in cells exposed to IFN-γ [71]. Similar results were seen in stress response genes in yeast with loss of function mutations in TOR [199]. Consistent with a metabolic sensing role for mtor, glucose deprivation also increased STAT1 nuclear import [71]. The pro-survival effect of mtorc1 is therefore in part mediated by lowering the levels of STAT1-dependent apoptosis genes (e.g., caspase-3, Fas, inos), as demonstrated previously [71]. In agreement, rapamycin enhanced acute lung injury in mice, and this correlated with increased STAT1 activity and epithelial cell apoptosis [1]. The data imply that other inhibitors of mtorc1 activity (e.g., amino acid deprivation, glucose starvation) would enhance organ injury in similar fashion. In summary, mtorc1 suppresses a positive feedback loop for STAT1 expression (Figure 11) and cleaved caspase-3 levels -, via its interaction with raptor, is involved. 64

65 Figure 11 Figure 11: Positive feedback loop for STAT1 expression Fold change increase (mrna levels) in STAT1 (signal transducer and activator of transcription-1) and apoptotic genes (human inducible nitric oxide synthase (hinos), interferon regulatory factor 1 (IRF-1)) over 18h of rapamycin treatment. Normally, IFN-γ leads to STAT1 dimerization and transcriptional activity, which then induces IRF-1 mrna. IRF-1 protein then feeds forward to activate STAT1. The initial induction of IRF-1 and STAT1 are required for the transcription of late IFN-sensitive genes (e.g., inos). All are augmented by rapamycin, likely by inhibiting mtorc1 suppression of STAT1 nuclear import (adapted from reference [71]). 65