Prognostic significance of phosphorylated RON in esophageal squamous cell carcinoma

Size: px
Start display at page:

Download "Prognostic significance of phosphorylated RON in esophageal squamous cell carcinoma"

Transcription

1 DOI /s ORIGINAL PAPER Prognostic significance of phosphorylated RON in esophageal squamous cell carcinoma Marco K. C. Hui Kenneth K. Y. Lai Kwok Wah Chan John M. Luk Nikki P. Lee Yvonne Chung Leo C. Cheung Gopesh Srivastava Sai Wah Tsao Johnny C. Tang Simon Law Received: 7 October 2011 / Accepted: 2 November 2011 Ó Springer Science+Business Media, LLC 2011 Abstract Esophageal squamous cell carcinoma (ESCC) is the most common type of esophageal cancer. RON is a transmembrane receptor overexpressed in various cancers; however, the clinical significance of its phosphorylated form () is not fully deciphered. This report is the first to investigate the expression and clinical significance of in human ESCC. Quantitative polymerase chain reaction revealed an up-regulation of RON mrna in 70% (7/10) of ESCC tissues when compared to the adjacent Marco K. C. Hui and Kenneth K. Y. Lai contributed equally to this work. Electronic supplementary material The online version of this article (doi: /s ) contains supplementary material, which is available to authorized users. M. K. C. Hui K. K. Y. Lai N. P. Lee Y. Chung L. C. Cheung S. Law (&) Department of Surgery, Queen Mary Hospital, The University of Hong Kong, Pokfulam, Hong Kong slaw@hkucc.hku.hk K. W. Chan G. Srivastava Department of Pathology, The University of Hong Kong, Pokfulam, Hong Kong J. M. Luk Department of Pharmacology and Surgery, National University Health System, Singapore, Singapore S. W. Tsao Department of Anatomy, The University of Hong Kong, Pokfulam, Hong Kong J. C. Tang Department of Applied Biology and Chemical Technology, Hong Kong Polytechnic University, Pokfulam, Hong Kong nontumor tissues. An overexpression of protein was found in most of the ESCC cell lines studied (4/5) when compared to two non-neoplastic esophageal epithelial cells using immunoblot. In 64 ESCC tissues, was localized at the cell membrane, cytoplasm and nucleus in 15 (23.4%), 63 (98.4%) and 61 (95.3%) cases using immunohistochemistry. Patients having high expression of cytoplasmic significantly associated with shorter median survival when compared to those with low expression (25.41 months vs months), suggesting cytoplasmic as a potential marker for poor prognosis in ESCC patients. Keywords Esophageal squamous cell carcinoma Phosphorylated RON Overexpression Poor prognostic marker Median survival after surgery Introduction Esophageal cancer is the eighth most prevalent cancer worldwide and ranks sixth as the most common cause of cancer-related deaths. Among all histological subtypes, esophageal squamous cell carcinoma (ESCC) is the predominant type in Asia. Despite various therapeutic options such as surgery, chemotherapy and radiotherapy, the prognosis of ESCC is relatively poor with the overall 5-year survival rate at 10 40% [1, 2]. Recepteur d origine nantais (RON) is a 185 kda heterodimeric transmembrane glycoprotein composed of a 35 kda extracellular a-chain and a 150 kda transmembrane b-chain [3]. Upon ligand binding, RON is activated via autophosphorylation within its kinase catalytic domain, resulting in an array of effects, including increase in cellular motility, invasiveness and apoptosis, which are

2 important features of tumor metastasis [4 6]. RON expression is often altered in human cancers like those happened in colon, bladder and pancreas [5, 7 12]. Most of these studies focus on studying the expression and involvement of RON and its splice variant, but not the phosphorylated RON (), in tumorigenesis. To address this, we investigated the expression of in ESCC and examined its prognostic significance. Materials and methods Human esophageal cell lines Five human ESCC cell lines (HKESC-1, HKESC-2, HKESC-3, HKESC- 4 and SLMT-1) and two human nonneoplastic esophageal cell lines (NE-1 and NE-3) were used as described, for which these cell lines were established by our team earlier [13 18]. Both NE-1 and NE-3 cells were cultured in Keratinocyte-SFM medium (Invitrogen, Carlsbad, CA) supplemented with bovine pituitary extract and human recombinant EGF. HKESC-1 and HKESC-4 were maintained in Minimum Essential Medium (MEM) medium (Invitrogen) with 10% heat-inactivated fetal bovine serum (FBS) (Invitrogen) and 1% penicillin and streptomycin (P/S) (Invitrogen). HKESC-2, HKESC-3 and SLMT-1 cells were cultured in MEM medium with 20% FBS and 1% P/S. Patient specimens We have recruited 64 ESCC patients who had undergone esophagectomy, without neoadjuvant chemotherapy nor radiotherapy, between 1997 and 2005 at Queen Mary Hospital, Hong Kong. Tumor and nontumor tissues near the proximal resection margins were obtained and stored at -80 C for subsequent analyses; 5 lm of paraffin embedded sections were prepared and stained with hematoxylin and eosin for light microscopy, which were then classified into different grades based on the criteria of the World Health Organization. Cancers were staged according to the TNM classification. GG-3 0 and reverse: 5 0 -GCG ATG CTG TTG AAC ACT-3 0 ), following the protocol as described [19, 20]. Quantification of the gene expression was performed in ABI PRISM 7700 Sequence Detection System (Applied Biosystems, Carlsbad, CA). Immunoblot Immunoblotting was performed as described [21, 22]. Rabbit polyclonal antibody (1:1,500) (Santa Cruz Biotechnology, Santa Cruz, CA) was used as the primary antibody. b-actin antibody (1:5,000) (Sigma-Aldrich, St Louis, MO) was used as an internal control. Goat antirabbit (1:7,000) (Zymed, Carlsbad, CA) or goat anti-mouse (1:20,000) (Zymed) antibodies conjugated with horseradish peroxidase (HRP) was used for detecting or b-actin, respectively. Protein expressions were visualized using ECL Plus Western blotting reagent pack (GE Healthcare Biosciences, Piscataway, NJ) followed by radiography. Immunohistochemistry Immunohistochemistry was performed as described [23, 24]. In brief, 10% normal goat serum (in TBS) (Dako, Glostrup, Denmark) was used to block the nonspecific (a) 25 RON expression level (b) NE NE HKESC-1 HKESC HKESC-3 HKESC Patients SLMT Reverse transcription (RT) and quantitative polymerase chain reaction (qpcr) β-actin 185 kda 150 kda 42 kda TRIzol reagent (Invitrogen) was used for RNA extraction in ESCC specimens, according to manufacturer s instructions. RT was started with 500 ng RNA using SuperScript III First-Strand Synthesis System for RT-PCR kit (Invitrogen), following manufacturer s protocol; 3 6 lg cdna was subjected for qpcr using Platinum Quantitative PCR SuperMix-UDG w/rox (Invitrogen) and RON-specific primers (forward: 5 0 -AAG GAC CTC ATC AGC TTT Fig. 1 High level of RON mrna in ESCC tissues and protein in ESCC cells. a qpcr showed high level of RON mrna in ESCC tissues when compared to adjacent nontumor tissues of the same patient in 7 out of 10 cases. The fold ratio of RON mrna in nontumor tissue was arbitrarily set to 1 in all cases. b Immunoblotting data showed high protein level of in most ESCC cell lines (HKESC-1, HKESC-2, HKESC-4 and SLMT-1) when compared to non-neoplastic esophageal cell lines (NE-1 and NE-3). b-actin was used as a loading control. Each sample was repeated in at least duplicates

3 binding sites following by incubating antibody (1:600). Anti-rabbit labeled polymer-hrp provided in EnVision? System-HRP (Dako) was then used. Signals were visualized by incubating with liquid DAB? (diaminobenzidine) (Dako) before counterstaining with hematoxylin. Negative controls were performed using normal goat serum instead of antibody. staining was evaluated by Dr. KW Chan, a qualified pathologist, under light microscope. According to Wang et al. [25] with modifications, a weighted index score (0 9) Fig. 2 High specificity of antibody. antibody yielded positive signals when used for immunoblot (a) and immunohistochemistry (b). However, no signals were observed when the antibody was first pre-incubated with an excess amount of blocking peptide (a, c). Original magnification, 9100 (b) (a) Corresponding blocking peptide - + (c) 185 kda 150 kda Fig. 3 in ESCC tissues. antibody was used to detect in ESCC tissues using immunohistochemistry, and positive signal was observed (a). No signal was observed when normal goat serum was used to replace the antibody in parallel experiment (b). Original magnification, ESCC tissues exhibit varied expression of, such that low (c) or high (d) expression of was detected in different specimens. Various localizations of were observed in different ESCC specimens, such that was found associating either with membrane (indicated by an arrow) (e) or nucleus (indicated by an arrow) (f). Original magnification, 9100

4 was calculated for each tumor by multiplying the values of these two categories, that is, low expression group with weighted index score 0 4 and high expression group with weighted index score 5 9. The cellular expression of at the cytoplasm and nucleus was also determined. Prediction of nuclear localization signal (NLS) PSORT II software [26] ( was utilized to predict any putative NLSs in human RON peptide sequence (NCBI accession number: NP_002438). Statistical analyses Data were expressed as mean ± SEM. Pearson s Chi-square test was used to assess the correlations between expression and various clinicopathological parameters. Kaplan Meier method was employed for analyzing survival, and the differences in survival were estimated using log-rank test. Any parameter with a P value\0.05 in the univariate analysis was subjected for multivariate analysis. A P value \0.05 was considered statistically significant. Statistical analyses were performed using SPSS 12.0 for Windows (Chicago, IL). Results High expression of RON in ESCC tissues qpcr results showed an up-regulation of RON mrna in 70% (7 of 10) ESCC tissues when compared to the corresponding nontumor tissues (Fig. 1a). The fold change of RON expression in ESCC tissues versus nontumor tissues ranged from *3-fold (Patient 10) to *23-fold (Patient 6). ESCC tissues from Patient 4 and 5 showed down-regulation of RON mrna. ESCC tissue from Patient 1 had no apparent difference in the expression of RON. High expression of in ESCC cell lines Immunoblot was used to determine the protein level of in esophageal cell lines. The antibody used was able to detect intact RON of 185 kda (with both a and b chains) and cleaved RON of 150 kda (with b chain only). To ensure the specificity of the staining, preincubation of the antibody with its blocking peptide was performed and no detectable signal was observed (Fig. 2a). Similar observation was noticed when this antibody was pre-incubated with blocking peptide before immunohistochemistry (Fig. 2b, c). Using this antibody for immunoblot, most ESCC cells (HKESC-1, HKESC-2, Fig. 4 in non-neoplastic esophageal squamous tissue. was found densely in the proliferating layer of the esophageal epithelium using immunohistochemistry. Original magnification, 9200 HKESC-4 and SLMT-1) except HKESC-3 showed an up-regulation of level, while the two non-neoplastic cell lines NE-1 and NE-3 expressed minimal level of this protein (Fig. 1b). Low expression of cytoplasmic associates with better survival in ESCC patients Immunohistochemistry was used to examine the cellular expression of in 64 ESCC tissues and 10 randomly selected nontumor tissues. Negative control utilizing normal goat serum instead of the antibody yielded no immunoreactivity (Fig. 3b). Expression of was detected at cell membrane, cytoplasm and nucleus in ESCC tissues (Fig. 3). Membranous, cytoplasmic and nuclear were found in 23.4% (15/64), 98.4% (63/64) and 95.3% (61/64) of ESCC tissues, respectively. was associated preferentially in the proliferating layer of the non-neoplastic epithelium and not found in the upper and more differentiated layer in the nontumor tissues (Fig. 4). No correlation between cytoplasmic (Table 1) or nuclear (Table 2) with any clinicopathological parameters was identified. The statistical analysis of membranous with clinicopathological parameters was not attempted due to the small number of samples with membranous. Cytoplasmic expression was associated with patients survival in univariate analysis (log-rank test: P = 0.034, Fig. 5a), while nuclear was not (logrank test: P = 0.164, Fig. 5b). Patients with low expression of cytoplasmic had a longer median survival (25.41 months, 95% CI: months) when

5 Table 1 Correlations between cytoplasmic expression and various clinicopathological parameters in ESCC patients Subgroups Clinicopathological parameters P value Table 2 Correlations between nuclear expression and various clinicopathological parameters in ESCC patients Subgroups Clinicopathological parameters P value Low expression of cytoplasmic High expression of cytoplasmic Low expression of nuclear High expression of nuclear Age (grouped) Below or equal Above Gender Female Male Smoking Nonsmoker Smoker Level of tumor Upper Middle Lower 9 5 Double 2 1 Tumor differentiation Poor Moderate Well 8 4 R category R R1/R T-stage Early (T1/T2) Advanced (T3/T4) N-stage N N M-stage M M1a/M1b 4 2 Overall pathological stage Early (stage I/II) Advanced (stage III/IV) Age (grouped) Below or equal Above Gender Female Male 40 7 Smoking Nonsmoker Smoker 28 5 Level of tumor Upper Middle 31 6 Lower 13 1 Double 3 0 Tumor differentiation Poor Moderate 32 6 Well 10 2 R category R R1/R T-stage Early (T1/T2) Advanced (T3/T4) 45 6 N-stage N N M-stage M M1a/M1b 5 1 Overall pathological stage Early (stage I/II) Advanced (stage III/IV) 34 5 compared to those patients with high expression (14.43 months, 95% CI: months). In multivariate analysis (Table 3), cytoplasmic significantly correlated with patients survival (cox regression: P = 0.004, RR: and 95% CI: ). R category was also significant (P = 0.009, RR: and 95% CI: ), and N-stage was marginally significant (P = 0.051, RR: and 95% CI: ) in correlating with patients survival. Presence of NLSs in human RON Due to the presence of nuclear in ESCC tissues, we employed PSORT II to identify any putative NLSs present in human RON that enable the nuclear translocation of. Five putative NLSs were found in RON peptide sequence. Four of them were located at the amino-terminus: (1) PKRR, amino acid ; (2) KRRR, amino acid ; (3) RRRR, amino acid ; and (4) PKRRRRG, amino

6 Fig. 5 Kaplan Meier survival curves for cytoplasmic and nuclear. Survival analysis was performed for cytoplasmic in a cohort of 25 high expression patients and 39 low expression patients. Log-rank test: P = (a). Survival analysis was performed for nuclear in a cohort of 9 high expression patients and 55 low expression patients. Log-rank test: P = (b) acid One NLS was found at the carboxyl-terminus: RRPR, amino acid 1,388 1,391 (Supp. fig. 1). Discussion This is the first study to report the prognostic significance of cytoplasmic in ESCC by stating patients with low cytoplasmic expression associate with longer median survival after surgery when compared to those with high expression. To our knowledge, no immunohistochemical analysis using -specific antibody was performed to investigate its prognostic importance in any types of cancer. Instead, several studies demonstrated the prognostic significance of total RON expression (i.e., the nonphosphorylated RON and ) in bladder carcinoma [8, 11], breast cancer [27], pancreatic cancer [7, 12] and renal cancer [28] using antibodies capable of detecting both forms. Here, we used -specific antibody to provide the first insight on the clinical correlation of in ESCC. RON is a transmembrane receptor, thus it is expected for its localization at the cell membrane. However, cytoplasmic expression of RON was reported in several cancers like pancreatic cancer using immunohistochemistry, and no reason has been given to explain for this observation [7, 12]. In addition, we have demonstrated here for the presence of in both cytoplasm and nucleus of ESCC tumors. Therefore, it is speculated for RON to behave like other membrane receptors, such as androgen receptor [29], ErbB4 [30] and epidermal growth factor receptor (EGFR) [31], in relocating to other cellular compartments. Indeed, c-met receptor, which also belongs to the same family of RON, is also capable of translocating to the cell nucleus [32]. It is proposed that nuclear expression of these membrane receptors could activate gene transcription [33, 34],

7 Table 3 Correlations between ESCC patients survival after surgery and various clinicopathological parameters Subgroups Clinicopathological parameters Univariate analysis Multivariate analysis RR (95% CI) P value RR (95% CI) P value Age (n = 64) Below or equal Above ( ) Gender Female Male ( ) Smoking Nonsmoker Smoker ( ) Level of tumor Upper 1 Middle ( ) Lower 0.61 ( ) Double ( ) Tumor differentiation Poor 1 Moderate ( ) Well ( ) R category R R1/R ( ) ( ) T-stage Early (T1/T2) Advanced (T3/T4) ( ) N-stage N N ( ) ( ) M-stage M M1a/M1b ( ) Overall pathological stage Early (stage I/II) Advanced (stage III/IV) ( ) ( ) Cytoplasmic Low High ( ) ( ) which, therefore, indicates for the roles of these receptors in enhancing signaling pathway at the transcriptional level [31]. NLS is a stretch of basic amino acids within a peptide sequence, which directs host proteins to the cell nucleus via interacting with the nuclear transport receptor importin [35]. In this study, we have used bioinformatics to show the presence of five putative NLSs in human RON peptide sequence. The presence of these NLSs implicates for the potential of in translocating into cell nucleus as observed in this study. This also helps to explain for the presence of cytoplasmic. However, further experiments are required to validate this notion. Although an overexpression of RON associates with increase in cell motility and protects cells against apoptosis [36], the functions of nonmembranous RON remain to be identified.

8 References 1. Jemal A, et al. Global cancer statistics. CA Cancer J Clin. 2011;61(2): Anderson LL, Lad TE. Autopsy findings in squamous-cell carcinoma of the esophagus. Cancer. 1982;50(8): Wang MH, et al. Identification of the RON gene product as the receptor for the human macrophage stimulating protein. Science. 1994;266(5182): Iwama A, Yamaguchi N, Suda T. STK/RON receptor tyrosine kinase mediates both apoptotic and growth signals via the multifunctional docking site conserved among the HGF receptor family. EMBO J. 1996;15(21): Peace BE, et al. Point mutations and overexpression of RON induce transformation, tumor formation, and metastasis. Oncogene. 2001;20(43): Wang MH, et al. Macrophage-stimulating protein induces proliferation and migration of murine keratinocytes. Exp Cell Res. 1996;226(1): Thomas RM, et al. The RON receptor tyrosine kinase mediates oncogenic phenotypes in pancreatic cancer cells and is increasingly expressed during pancreatic cancer progression. Cancer Res. 2007;67(13): Hsu PY, et al. Collaboration of RON and epidermal growth factor receptor in human bladder carcinogenesis. J Urol. 2006;176(5): Wang MH, Kurtz AL, Chen Y. Identification of a novel splicing product of the RON receptor tyrosine kinase in human colorectal carcinoma cells. Carcinogenesis. 2000;21(8): Okino T, et al. Presence of RON receptor tyrosine kinase and its splicing variant in malignant and non-malignant human colonic mucosa. Int J Oncol. 1999;15(4): Cheng HL, et al. Co-expression of RON and MET is a prognostic indicator for patients with transitional-cell carcinoma of the bladder. Br J Cancer. 2005;92(10): Camp ER, et al. Tyrosine kinase receptor RON in human pancreatic cancer: expression, function, and validation as a target. Cancer. 2007;109(6): Cheung LC, et al. Establishment and characterization of a new xenograft-derived human esophageal squamous cell carcinoma cell line HKESC-4 of Chinese origin. Cancer Genet Cytogenet. 2007;178(1): Hu YC, et al. Establishment, characterization, karyotyping, and comparative genomic hybridization analysis of HKESC-2 and HKESC-3: two newly established human esophageal squamous cell carcinoma cell lines. Cancer Genet Cytogenet. 2002;135(2): Tang JC, et al. Establishment and characterization of a new xenograft-derived human esophageal squamous cell carcinoma cell line SLMT-1 of Chinese origin. Cancer Genet Cytogenet. 2001;124(1): Hu Y, et al. Establishment and characterization of HKESC-1, a new cancer cell line from human esophageal squamous cell carcinoma. Cancer Genet Cytogenet. 2000;118(2): Zhang H, et al. Cytogenetic aberrations in immortalization of esophageal epithelial cells. Cancer Genet Cytogenet. 2006; 165(1): Zhang H, et al. Papillomavirus type 16 E6/E7 and human telomerase reverse transcriptase in esophageal cell immortalization and early transformation. Cancer Lett. 2007;245(1 2): Lee NP, et al. Comparative proteomic analysis of mouse livers from embryo to adult reveals an association with progression of hepatocellular carcinoma. Proteomics. 2008;8(10): Lee NP, et al. Prognostic significance and therapeutic potential of eukaryotic translation initiation factor 5A (eif5a) in hepatocellular carcinoma. Int J Cancer. 2010;127(4): Lee NP, et al. Kidney claudin-19: localization in distal tubules and collecting ducts and dysregulation in polycystic renal disease. FEBS Lett. 2006;580(3): Lee NP, et al. Proteomic expression signature distinguishes cancerous and nonmalignant tissues in hepatocellular carcinoma. J Proteome Res. 2009;8(3): Liu LX, et al. Targeting cadherin-17 inactivates Wnt signaling and inhibits tumor growth in liver carcinoma. Hepatology. 2009; 50(5): Chung Y, et al. Altered E-cadherin expression and p120 catenin localization in esophageal squamous cell carcinoma. Ann Surg Oncol. 2007;14(11): Wang MH, et al. Altered expression of the RON receptor tyrosine kinase in various epithelial cancers and its contribution to tumourigenic phenotypes in thyroid cancer cells. J Pathol. 2007; 213(4): Nakai K, Horton P. PSORT a program for detecting sorting signals in proteins and predicting their subcellular localization. Trends Biochem Sci. 1999;24(1): Lee WY, et al. Prognostic significance of co-expression of RON and MET receptors in node-negative breast cancer patients. Clin Cancer Res Off J Am Assoc Cancer Res. 2005;11(6): Rampino T, et al. The Ron proto-oncogene product is a phenotypic marker of renal oncocytoma. Am J Surg Pathol. 2003;27(6): Kaku N, et al. Characterization of nuclear import of the domainspecific androgen receptor in association with the importin alpha/ beta and Ran-guanosine 5 0 -triphosphate systems. Endocrinology. 2008;149(8): Schlessinger J, Lemmon MA. Nuclear signaling by receptor tyrosine kinases: the first robin of spring. Cell. 2006;127(1): Lin SY, et al. Nuclear localization of EGF receptor and its potential new role as a transcription factor. Nat Cell Biol. 2001; 3(9): Pozner-Moulis S, Pappas DJ, Rimm DL. Met, the hepatocyte growth factor receptor, localizes to the nucleus in cells at low density. Cancer Res. 2006;66(16): Ni CY, et al. Gamma-secretase cleavage and nuclear localization of ErbB-4 receptor tyrosine kinase. Science. 2001;294(5549): Lee HJ, et al. Presenilin-dependent gamma-secretase-like intramembrane cleavage of ErbB4. J Biol Chem. 2002;277(8): Lange A, et al. Classical nuclear localization signals: definition, function, and interaction with importin alpha. J Biol Chem. 2007; 282(8): Chen YQ, et al. Overexpression and activation of the RON receptor tyrosine kinase in a panel of human colorectal carcinoma cell lines. Exp Cell Res. 2000;261(1):

Original Article CREPT expression correlates with esophageal squamous cell carcinoma histological grade and clinical outcome

Original Article CREPT expression correlates with esophageal squamous cell carcinoma histological grade and clinical outcome Int J Clin Exp Pathol 2017;10(2):2030-2035 www.ijcep.com /ISSN:1936-2625/IJCEP0009456 Original Article CREPT expression correlates with esophageal squamous cell carcinoma histological grade and clinical

More information

Correlation between estrogen receptor β expression and the curative effect of endocrine therapy in breast cancer patients

Correlation between estrogen receptor β expression and the curative effect of endocrine therapy in breast cancer patients 1568 Correlation between estrogen receptor β expression and the curative effect of endocrine therapy in breast cancer patients LIYING GUO 1, YU ZHANG 2, WEI ZHANG 3 and DILIMINA YILAMU 1 1 Department of

More information

High expression of fibroblast activation protein is an adverse prognosticator in gastric cancer.

High expression of fibroblast activation protein is an adverse prognosticator in gastric cancer. Biomedical Research 2017; 28 (18): 7779-7783 ISSN 0970-938X www.biomedres.info High expression of fibroblast activation protein is an adverse prognosticator in gastric cancer. Hu Song 1, Qi-yu Liu 2, Zhi-wei

More information

Original Article Tissue expression level of lncrna UCA1 is a prognostic biomarker for colorectal cancer

Original Article Tissue expression level of lncrna UCA1 is a prognostic biomarker for colorectal cancer Int J Clin Exp Pathol 2016;9(4):4241-4246 www.ijcep.com /ISSN:1936-2625/IJCEP0012296 Original Article Tissue expression level of lncrna UCA1 is a prognostic biomarker for colorectal cancer Hong Jiang,

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

Characterization and significance of MUC1 and c-myc expression in elderly patients with papillary thyroid carcinoma

Characterization and significance of MUC1 and c-myc expression in elderly patients with papillary thyroid carcinoma Characterization and significance of MUC1 and c-myc expression in elderly patients with papillary thyroid carcinoma Y.-J. Hu 1, X.-Y. Luo 2, Y. Yang 3, C.-Y. Chen 1, Z.-Y. Zhang 4 and X. Guo 1 1 Department

More information

Cell lines and tissue samples. The 18 human NSCLC cell lines used in this. study included eight adenocarcinoma cell lines (ADCs; A427, A549, LC319,

Cell lines and tissue samples. The 18 human NSCLC cell lines used in this. study included eight adenocarcinoma cell lines (ADCs; A427, A549, LC319, Supplementary Materials and Methods Cell lines and tissue samples. The 18 human NSCLC cell lines used in this study included eight adenocarcinoma cell lines (ADCs; A427, A549, LC319, NCI-H1373, PC-3, PC-9,

More information

Study on the expression of MMP-9 and NF-κB proteins in epithelial ovarian cancer tissue and their clinical value

Study on the expression of MMP-9 and NF-κB proteins in epithelial ovarian cancer tissue and their clinical value Study on the expression of MMP-9 and NF-κB proteins in epithelial ovarian cancer tissue and their clinical value Shen Wei 1,a, Chen Juan 2, Li Xiurong 1 and Yin Jie 1 1 Department of Obstetrics and Gynecology,

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

Layered-IHC (L-IHC): A novel and robust approach to multiplexed immunohistochemistry So many markers and so little tissue

Layered-IHC (L-IHC): A novel and robust approach to multiplexed immunohistochemistry So many markers and so little tissue Page 1 The need for multiplex detection of tissue biomarkers. There is a constant and growing demand for increased biomarker analysis in human tissue specimens. Analysis of tissue biomarkers is key to

More information

Expression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer

Expression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer European Review for Medical and Pharmacological Sciences 2018; 22: 5525-5530 Expression of mir-1294 is downregulated and predicts a poor prognosis in gastric cancer Y.-X. SHI, B.-L. YE, B.-R. HU, X.-J.

More information

Original Article Clinical significance of SOX2 and snail expression in esophageal squamous cell carcinoma

Original Article Clinical significance of SOX2 and snail expression in esophageal squamous cell carcinoma Int J Clin Exp Pathol 2016;9(9):9569-9574 www.ijcep.com /ISSN:1936-2625/IJCEP0027666 Original Article Clinical significance of SOX2 and snail expression in esophageal squamous cell carcinoma Na Miao 1*,

More information

Claudin-4 Expression in Triple Negative Breast Cancer: Correlation with Androgen Receptors and Ki-67 Expression

Claudin-4 Expression in Triple Negative Breast Cancer: Correlation with Androgen Receptors and Ki-67 Expression Claudin-4 Expression in Triple Negative Breast Cancer: Correlation with Androgen Receptors and Ki-67 Expression Mona A. Abd-Elazeem, Marwa A. Abd- Elazeem Pathology department, Faculty of Medicine, Tanta

More information

Correlation between expression and significance of δ-catenin, CD31, and VEGF of non-small cell lung cancer

Correlation between expression and significance of δ-catenin, CD31, and VEGF of non-small cell lung cancer Correlation between expression and significance of δ-catenin, CD31, and VEGF of non-small cell lung cancer X.L. Liu 1, L.D. Liu 2, S.G. Zhang 1, S.D. Dai 3, W.Y. Li 1 and L. Zhang 1 1 Thoracic Surgery,

More information

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12. Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.

More information

Expression and clinical significance of ADAM17 protein in esophageal squamous cell carcinoma

Expression and clinical significance of ADAM17 protein in esophageal squamous cell carcinoma Expression and clinical significance of ADAM17 protein in esophageal squamous cell carcinoma H.B. Liu, Y. Zhu, Q.C. Yang, Y. Shen, X.J. Zhang and H. Chen Department of Pathology First People s Hospital

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

P atients with primary breast cancer have an increased risk of developing contralateral breast cancer1. When

P atients with primary breast cancer have an increased risk of developing contralateral breast cancer1. When OPEN SUBJECT AREAS: BONE METASTASES BREAST CANCER Received 23 July 2013 Accepted 19 August 2013 Published 5 September 2013 Correspondence and requests for materials should be addressed to C.W.D. (ducaiwen@

More information

Astrocyte Elevated Gene 1 (AEG-1): A Promising Candidate for Molecular Targeted Therapy in Oral Squamous Cell Carcinomas

Astrocyte Elevated Gene 1 (AEG-1): A Promising Candidate for Molecular Targeted Therapy in Oral Squamous Cell Carcinomas DOI:10.22034/APJCP.2017.18.12.3301 RESEARCH ARTICLE Astrocyte Elevated Gene 1 (AEG-1): A Promising Candidate for Molecular Targeted Therapy in Oral Squamous Cell Carcinomas Maryam Seyedmajidi 1, Shabnam

More information

High Expression of Forkhead Box Protein C2 is Related to Poor Prognosis in Human Gliomas

High Expression of Forkhead Box Protein C2 is Related to Poor Prognosis in Human Gliomas DOI:http://dx.doi.org/10.7314/APJCP.2014.15.24.10621 RESEARCH ARTICLE High Expression of Forkhead Box Protein C2 is Related to Poor Prognosis in Human Gliomas Yao-Wu Wang 1, Chun-Li Yin 2, Hong-Yi Zhang

More information

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic

More information

CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer

CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer European Review for Medical and Pharmacological Sciences 2018; 22: 3713-3718 CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer N. LIU 1, J. ZHANG 1, L.-Y. ZHANG 1, L.

More information

Plasma Bmil mrna as a potential prognostic biomarker for distant metastasis in colorectal cancer patients

Plasma Bmil mrna as a potential prognostic biomarker for distant metastasis in colorectal cancer patients Title Plasma Bmil mrna as a potential prognostic biomarker for distant metastasis in colorectal cancer patients Author(s) Pun, JC; Chan, JY; Chun, BK; Ng, KW; Tsui, SY; Wan, TMH; Lo, OSH; Poon, TCJ; Ng,

More information

Roles of transcriptional factor Snail and adhesion factor E-cadherin in clear cell renal cell carcinoma

Roles of transcriptional factor Snail and adhesion factor E-cadherin in clear cell renal cell carcinoma EXPERIMENTAL AND THERAPEUTIC MEDICINE 6: 1489-1493, 2013 Roles of transcriptional factor Snail and adhesion factor E-cadherin in clear cell renal cell carcinoma JINQUAN CAI Department of Urology, Fuzhou

More information

Department of General Surgery, The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui, P. R. China; 2

Department of General Surgery, The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui, P. R. China; 2 Int J Clin Exp Pathol 2016;9(3):2841-2848 www.ijcep.com /ISSN:1936-2625/IJCEP0020368 Original Article Expression of Shh signaling pathway factors in gastrointestinal stromal tumor tissues and their associations

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, 1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed

More information

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 activity. Upper panel: Representative histograms for FACS

More information

Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer

Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer J. Li 1, Z.J. Song 2, Y.Y. Wang 1, Y. Yin 1, Y. Liu 1 and X. Nan 1 1 Tumor Research Department, Shaanxi Provincial Tumor Hospital,

More information

Original Article Up-regulation of mir-10a and down-regulation of mir-148b serve as potential prognostic biomarkers for osteosarcoma

Original Article Up-regulation of mir-10a and down-regulation of mir-148b serve as potential prognostic biomarkers for osteosarcoma Int J Clin Exp Pathol 2016;9(1):186-190 www.ijcep.com /ISSN:1936-2625/IJCEP0018032 Original Article Up-regulation of mir-10a and down-regulation of mir-148b serve as potential prognostic biomarkers for

More information

Clinical relevance of Fas expression in oesophageal squamous cell carcinoma.

Clinical relevance of Fas expression in oesophageal squamous cell carcinoma. Clinical relevance of Fas expression in oesophageal squamous cell carcinoma. Author Chan, K, Lee, P, Lam, Alfred, Law, S, Wong, J, Srivastava, G Published 2006 Journal Title Journal of Clinical Pathology

More information

Expression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival

Expression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival European Review for Medical and Pharmacological Sciences 2017; 21: 3397-3401 Expression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival W.-X. LI 1, R.-L.

More information

Advances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016)

Advances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) Expression of Beta-Adrenergic Receptor in Glioma LN229 Cells and Its Effect on Cell Proliferation Ping Wang1, Qingluan

More information

To determine the effect of over-expression and/or ligand activation of. PPAR / on cell cycle, cell lines were cultured as described above until ~80%

To determine the effect of over-expression and/or ligand activation of. PPAR / on cell cycle, cell lines were cultured as described above until ~80% Supplementary Materials and Methods Cell cycle analysis To determine the effect of over-expression and/or ligand activation of PPAR / on cell cycle, cell lines were cultured as described above until ~80%

More information

Phospho-AKT Sampler Kit

Phospho-AKT Sampler Kit Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody

More information

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum

More information

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar

More information

Androgen Receptor Expression in Renal Cell Carcinoma: A New Actionable Target?

Androgen Receptor Expression in Renal Cell Carcinoma: A New Actionable Target? Androgen Receptor Expression in Renal Cell Carcinoma: A New Actionable Target? New Frontiers in Urologic Oncology Juan Chipollini, MD Clinical Fellow Department of Genitourinary Oncology Moffitt Cancer

More information

RALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD

RALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD RALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD Aurora Healthcare, Milwaukee, WI INTRODUCTION v Epigenetic aberration and genetic alteration

More information

Long noncoding RNA LINC01510 is highly expressed in colorectal cancer and predicts favorable prognosis

Long noncoding RNA LINC01510 is highly expressed in colorectal cancer and predicts favorable prognosis European Review for Medical and Pharmacological Sciences 2018; 22: 7710-7715 Long noncoding RNA LINC01510 is highly expressed in colorectal cancer and predicts favorable prognosis J.-F. ZHOU, H.-G. WANG,

More information

Overexpression of long-noncoding RNA ZFAS1 decreases survival in human NSCLC patients

Overexpression of long-noncoding RNA ZFAS1 decreases survival in human NSCLC patients European Review for Medical and Pharmacological Sciences 2016; 20: 5126-5131 Overexpression of long-noncoding RNA ZFAS1 decreases survival in human NSCLC patients F.-M. TIAN 1, F.-Q. MENG 2, X.-B. WANG

More information

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer J Yu *, KF To, QY Liang K e y M e s s a g e s 1. Somatostatin receptor 1

More information

Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases

Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Brief Communication Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Qinghai Zeng 1 *, Cuihong Jin 2 *, Wenhang Chen 2, Fang Xia 3, Qi Wang 3, Fan Fan 4,

More information

Cancers of unknown primary : Knowing the unknown. Prof. Ahmed Hossain Professor of Medicine SSMC

Cancers of unknown primary : Knowing the unknown. Prof. Ahmed Hossain Professor of Medicine SSMC Cancers of unknown primary : Knowing the unknown Prof. Ahmed Hossain Professor of Medicine SSMC Definition Cancers of unknown primary site (CUPs) Represent a heterogeneous group of metastatic tumours,

More information

7/6/2015. Cancer Related Deaths: United States. Management of NSCLC TODAY. Emerging mutations as predictive biomarkers in lung cancer: Overview

7/6/2015. Cancer Related Deaths: United States. Management of NSCLC TODAY. Emerging mutations as predictive biomarkers in lung cancer: Overview Emerging mutations as predictive biomarkers in lung cancer: Overview Kirtee Raparia, MD Assistant Professor of Pathology Cancer Related Deaths: United States Men Lung and bronchus 28% Prostate 10% Colon

More information

VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer

VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer VIII Curso Internacional del PIRRECV Some molecular mechanisms of cancer Laboratorio de Comunicaciones Celulares, Centro FONDAP Estudios Moleculares de la Celula (CEMC), ICBM, Facultad de Medicina, Universidad

More information

Implications of Progesterone Receptor Status for the Biology and Prognosis of Breast Cancers

Implications of Progesterone Receptor Status for the Biology and Prognosis of Breast Cancers 日大医誌 75 (1): 10 15 (2016) 10 Original Article Implications of Progesterone Receptor Status for the Biology and Prognosis of Breast Cancers Naotaka Uchida 1), Yasuki Matsui 1), Takeshi Notsu 1) and Manabu

More information

MDJ The Role of K-Ras and PI3Kcb Expression in Oral Vol.:10 No.:2 2013

MDJ The Role of K-Ras and PI3Kcb Expression in Oral Vol.:10 No.:2 2013 MDJ The Role of K-Ras and PI3Kcb Expression in Oral Squamous Cell Carcinoma Dr. Asseel Mohammed ghazi. B.D.S Dr.Muna S. Merza. B.D.S, M.Sc. Ph.D Abstract Background: Oral squamous cell carcinoma is an

More information

Expression and clinical significance of Kelch-like epichlorohydrin-associated protein 1 in breast cancer

Expression and clinical significance of Kelch-like epichlorohydrin-associated protein 1 in breast cancer Expression and clinical significance of Kelch-like epichlorohydrin-associated protein 1 in breast cancer L. Zhang*, W.P. Yang*, L.Y. Wu, X. Zhu and C.Y. Wei Department of Breast Surgery, Affiliated Tumor

More information

microrna Presented for: Presented by: Date:

microrna Presented for: Presented by: Date: microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2

More information

Expression and Significance of GRP78 and HER-2 in Colorectal Cancer

Expression and Significance of GRP78 and HER-2 in Colorectal Cancer Expression and Significance of GRP78 and HER-2 in Colorectal Cancer Qiu-xia Ji 1, Li-li Wang 2, Lin Li 3, Xiaoming Xing 2 1 Department of Pathology, Qingdao University, Qingdao, China 2 Department of Pathology,

More information

FGL2 A new biomarker for cancer in a simple blood test

FGL2 A new biomarker for cancer in a simple blood test FGL2 A new biomarker for cancer in a simple blood test WHO IS FGL2 Human gene (chromosome 7) is 7 kb long, 2 exons, monomer protein 70 KD, tetramer in solution. Fibrinogen-like protein 2 (Fgl2), a member

More information

Association of BTBD7 with Metastasis and Poor Prognosis in Non-Small-Cell Lung Cancer Patients

Association of BTBD7 with Metastasis and Poor Prognosis in Non-Small-Cell Lung Cancer Patients 477 Ivyspring International Publisher Research Paper Journal of Cancer 2015; 6(5): 477-481. doi: 10.7150/jca.11715 Association of BTBD7 with Metastasis and Poor Prognosis in Non-Small-Cell Lung Cancer

More information

95% CI: , P=0.037).

95% CI: , P=0.037). Biomedical Research 2017; 28 (21): 9248-9252 Reduced expression level of mir-205 predicts poor prognosis in Qiang Yang 1*#, Peng Sun 2#, Haotian Feng 1, Xin Li 1, Jianmin Li 1 1 Department of Orthopedics,

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed.

of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed. Supplementary Note The potential association and implications of HBV integration at known and putative cancer genes of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed. Human telomerase

More information

Expanded View Figures

Expanded View Figures Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and

More information

Hypoxia inducible factor-1 alpha and carbonic anhydrase IX overexpression are associated with poor survival in breast cancer patients

Hypoxia inducible factor-1 alpha and carbonic anhydrase IX overexpression are associated with poor survival in breast cancer patients Journal of BUON 17: 663-668, 2012 2012 Zerbinis Medical Publications. Printed in Greece ORIGINAL ARTICLE Hypoxia inducible factor-1 alpha and carbonic anhydrase IX overexpression are associated with poor

More information

Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.

Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification. Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA

More information

mir-218 tissue expression level is associated with aggressive progression of gastric cancer

mir-218 tissue expression level is associated with aggressive progression of gastric cancer mir-218 tissue expression level is associated with aggressive progression of gastric cancer X.X. Wang 1, S.J. Ge 2, X.L. Wang 2, L.X. Jiang 1, M.F. Sheng 2 and J.J. Ma 2 1 Department of General Surgery,

More information

Expression and significance of Bmi-1 and Ki67 in colorectal carcinoma tissues

Expression and significance of Bmi-1 and Ki67 in colorectal carcinoma tissues [Chinese Journal of Cancer 27:12, 568-573; December Expression 2008]; 2008 and significance Sun Yat-sen of University Bmi-1 and Cancer Ki67 in Center colorectal carcinoma tissues Clinical Research Paper

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

Downregulation of long non-coding RNA LINC01133 is predictive of poor prognosis in colorectal cancer patients

Downregulation of long non-coding RNA LINC01133 is predictive of poor prognosis in colorectal cancer patients European Review for Medical and Pharmacological Sciences 2017; 21: 2103-2107 Downregulation of long non-coding RNA LINC01133 is predictive of poor prognosis in colorectal cancer patients J.-H. ZHANG 1,

More information

FISH mcgh Karyotyping ISH RT-PCR. Expression arrays RNA. Tissue microarrays Protein arrays MS. Protein IHC

FISH mcgh Karyotyping ISH RT-PCR. Expression arrays RNA. Tissue microarrays Protein arrays MS. Protein IHC Classification of Breast Cancer in the Molecular Era Susan J. Done University Health Network, Toronto Why classify? Prognosis Prediction of response to therapy Pathogenesis Invasive breast cancer can have

More information

Expression of lncrna TCONS_ in hepatocellular carcinoma and its influence on prognosis and survival

Expression of lncrna TCONS_ in hepatocellular carcinoma and its influence on prognosis and survival European Review for Medical and Pharmacological Sciences 2017; 21: 5655-5660 Expression of lncrna TCONS_00027978 in hepatocellular carcinoma and its influence on prognosis and survival Q. CHEN 1, G.-D.

More information

Original Article Increased LincRNA ROR is association with poor prognosis for esophageal squamous cell carcinoma patients

Original Article Increased LincRNA ROR is association with poor prognosis for esophageal squamous cell carcinoma patients Int J Clin Exp Pathol 2017;10(4):4654-4660 www.ijcep.com /ISSN:1936-2625/IJCEP0048142 Original Article Increased LincRNA ROR is association with poor prognosis for esophageal squamous cell carcinoma patients

More information

Title page. Title: MicroRNA-155 Controls Exosome Synthesis and Promotes Gemcitabine Resistance in

Title page. Title: MicroRNA-155 Controls Exosome Synthesis and Promotes Gemcitabine Resistance in Title page Title: MicroRNA- Controls Synthesis and Promotes Gemcitabine Resistance in Pancreatic Ductal Adenocarcinoma Authors Manabu Mikamori, Daisaku Yamada, Hidetoshi Eguchi, Shinichiro Hasegawa, Tomoya

More information

Positive nin one binding protein expression predicts poor outcome in prostate cancer

Positive nin one binding protein expression predicts poor outcome in prostate cancer MOLECULAR MEDICINE REPORTS 11: 2671-2676, 2015 Positive nin one binding protein expression predicts poor outcome in prostate cancer JIE CHEN *, JUNKAI WANG *, XINGANG CUI, YUSHAN LIU, LEI YIN, YAO LI,

More information

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h) Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d

More information

The clinical significance of HPIP and the associated prognosis in cervical cancer

The clinical significance of HPIP and the associated prognosis in cervical cancer /, 2017, Vol. 8, (No. 41), pp: 70262-70270 The clinical significance of HPIP and the associated prognosis in cervical cancer Fanling Meng 1,*, Haixia Liu 1,*, Shuang Liu 1 and Rong Ma 1 1 Department of

More information

Exosomal Del 1 as a potent diagnostic marker for breast cancer : A prospective cohort study

Exosomal Del 1 as a potent diagnostic marker for breast cancer : A prospective cohort study GBCC 2017: ABS-0017 Exosomal Del 1 as a potent diagnostic marker for breast cancer : A prospective cohort study Soo Jung Lee 1, Jeeyeon Lee 2, Jin Hyang Jung 2, Ho Yong Park 2, Chan Hyeong Lee 3, Pyong

More information

Detection of Anaplastic Lymphoma Kinase (ALK) gene in Non-Small Cell lung Cancer (NSCLC) By CISH Technique

Detection of Anaplastic Lymphoma Kinase (ALK) gene in Non-Small Cell lung Cancer (NSCLC) By CISH Technique Cancer and Clinical Oncology; Vol. 7, No. 1; 2018 ISSN 1927-4858 E-ISSN 1927-4866 Published by Canadian Center of Science and Education Detection of Anaplastic Lymphoma Kinase (ALK) gene in Non-Small Cell

More information

Prognostic significance of overexpressed long non-coding RNA TUG1 in patients with clear cell renal cell carcinoma

Prognostic significance of overexpressed long non-coding RNA TUG1 in patients with clear cell renal cell carcinoma European Review for Medical and Pharmacological Sciences 2017; 21: 82-86 Prognostic significance of overexpressed long non-coding RNA TUG1 in patients with clear cell renal cell carcinoma P.-Q. WANG, Y.-X.

More information

Smoking, human papillomavirus infection, and p53 mutation as risk factors in oropharyngeal cancer: a case-control study

Smoking, human papillomavirus infection, and p53 mutation as risk factors in oropharyngeal cancer: a case-control study RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Smoking, human papillomavirus infection, and p53 as risk factors in oropharyngeal cancer: a case-control study PKS Chan *, JSY Chor, AC Vlantis, TL

More information

Original Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk in a Chinese Han population

Original Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk in a Chinese Han population Int J Clin Exp Med 2014;7(12):5832-5836 www.ijcem.com /ISSN:1940-5901/IJCEM0002117 Original Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk

More information

Bin Liu, Lei Yang, Binfang Huang, Mei Cheng, Hui Wang, Yinyan Li, Dongsheng Huang, Jian Zheng,

Bin Liu, Lei Yang, Binfang Huang, Mei Cheng, Hui Wang, Yinyan Li, Dongsheng Huang, Jian Zheng, The American Journal of Human Genetics, Volume 91 Supplemental Data A Functional Copy-Number Variation in MAPKAPK2 Predicts Risk and Survival of Lung Cancer Bin Liu, Lei Yang, Binfang Huang, Mei Cheng,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES

More information

RNA preparation from extracted paraffin cores:

RNA preparation from extracted paraffin cores: Supplementary methods, Nielsen et al., A comparison of PAM50 intrinsic subtyping with immunohistochemistry and clinical prognostic factors in tamoxifen-treated estrogen receptor positive breast cancer.

More information

Prognostic significance of nemo like kinase in nasopharyngeal carcinoma

Prognostic significance of nemo like kinase in nasopharyngeal carcinoma MOLECULAR MEDICINE REPORTS 10: 131-136, 2014 Prognostic significance of nemo like kinase in nasopharyngeal carcinoma SIZE CHEN 1,2*, ZHIJIAN MA 3*, XUEMEI CHEN 4 and JIREN ZHANG 1 1 Department of Oncology,

More information

Correlation between survivin expression and prognosis in non-small cell lung cancer

Correlation between survivin expression and prognosis in non-small cell lung cancer Respiratory Medicine (2006) 100, 2220 2226 Correlation between survivin expression and prognosis in non-small cell lung cancer Sükran Atikcan a, Ebru Ünsal a,, Funda Demirag b, Deniz Köksal a, Aydın Yilmaz

More information

without LOI phenotype by breeding female wild-type C57BL/6J and male H19 +/.

without LOI phenotype by breeding female wild-type C57BL/6J and male H19 +/. Sakatani et al. 1 Supporting Online Material Materials and methods Mice and genotyping: H19 mutant mice with C57BL/6J background carrying a deletion in the structural H19 gene (3 kb) and 10 kb of 5 flanking

More information

Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis by regulating EZH2 and repressing E-cadherin in esophageal squamous cell carcinoma

Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis by regulating EZH2 and repressing E-cadherin in esophageal squamous cell carcinoma JBUON 2018; 23(1): 157-162 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis

More information

Decreased expression of mir-490-3p in osteosarcoma and its clinical significance

Decreased expression of mir-490-3p in osteosarcoma and its clinical significance European Review for Medical and Pharmacological Sciences Decreased expression of mir-490-3p in osteosarcoma and its clinical significance B. TANG, C. LIU, Q.-M. ZHANG, M. NI Department of Orthopedics,

More information

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

More information

Log odds of positive lymph nodes is a novel prognostic indicator for advanced ESCC after surgical resection

Log odds of positive lymph nodes is a novel prognostic indicator for advanced ESCC after surgical resection Original Article Log odds of positive lymph nodes is a novel prognostic indicator for advanced ESCC after surgical resection Mingjian Yang 1,2, Hongdian Zhang 1,2, Zhao Ma 1,2, Lei Gong 1,2, Chuangui Chen

More information

Circular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis

Circular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis European Review for Medical and Pharmacological Sciences 2018; 22: 7178-7182 Circular RNA_LARP4 is lower expressed and serves as a potential biomarker of ovarian cancer prognosis T. ZOU, P.-L. WANG, Y.

More information

Clinical significance of CD44 expression in children with hepatoblastoma

Clinical significance of CD44 expression in children with hepatoblastoma Clinical significance of CD44 expression in children with hepatoblastoma H.-Y. Cai 1 *, B. Yu 1 *, Z.-C. Feng 2, X. Qi 1 and X.-J. Wei 1 1 Department of General Surgery, General Hospital of Beijing Military

More information

Epithelial membrane protein 1 expression in ovarian serous tumors

Epithelial membrane protein 1 expression in ovarian serous tumors 2140 Epithelial membrane protein 1 expression in ovarian serous tumors GUZIN GONULLU DEMIRAG 1, MEHMET KEFELI 2, YASEMIN KEMAL 1 and IDRIS YUCEL 1 Departments of 1 Medical Oncology and 2 Pathology, Faculty

More information

Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor

Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor Figures Part of introduction Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor supressor gene deletion in the induction of thyroid carcinoma. ( by James A Fagin, M.D.)

More information

Clinicopathological Factors Affecting Distant Metastasis Following Loco-Regional Recurrence of breast cancer. Cheol Min Kang 2018/04/05

Clinicopathological Factors Affecting Distant Metastasis Following Loco-Regional Recurrence of breast cancer. Cheol Min Kang 2018/04/05 Abstract No.: ABS-0075 Clinicopathological Factors Affecting Distant Metastasis Following Loco-Regional Recurrence of breast cancer 2018/04/05 Cheol Min Kang Department of surgery, University of Ulsan

More information

Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis

Supplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression

More information

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon

More information

ER-P Expression in Different Thyroid Carcinomas: Immunohistochemical Study

ER-P Expression in Different Thyroid Carcinomas: Immunohistochemical Study Med. J. Cairo Univ., Vol. 85, No. 6, September: 5-9, 17 www.medicaljournalofcairouniversity.net ER-P Expression in Different Thyroid Carcinomas: Immunohistochemical Study MIRAN A. EL-KORDY, M.Sc.; FAHIMA

More information

Discovery and Optimization of Inhibitors of STAT3 Activation for the Treatment of Squamous Cell Carcinoma of the Head and Neck

Discovery and Optimization of Inhibitors of STAT3 Activation for the Treatment of Squamous Cell Carcinoma of the Head and Neck Discovery and ptimization of Inhibitors of STAT3 Activation for the Treatment of Squamous Cell Carcinoma of the Head and Neck Feng Zhang Wipf Group Research Topic Seminar 02-09-2013 1 Feng Zhang @ Wipf

More information

Supplemental Figure S1. RANK expression on human lung cancer cells.

Supplemental Figure S1. RANK expression on human lung cancer cells. Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression

More information

The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells

The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells 1 SUPPLEMENTARY INFORMATION The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells Karin Loser 1,2,6, Thomas Vogl 2,3, Maik Voskort 1, Aloys

More information

C-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein. pigment isolated from Spirulina platensis. This water- soluble protein pigment is

C-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein. pigment isolated from Spirulina platensis. This water- soluble protein pigment is ' ^Summary C-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein pigment isolated from Spirulina platensis. This water- soluble protein pigment is of greater importance because of its various

More information