Genome mapping. Genome sequencing. Next Gen sequencing. Genome mapping. Genome sequencing Next Gen sequencing. YACs ~1 Mb.
|
|
|
- Diane May
- 6 years ago
- Views:
Transcription
1 Genome mapping 5-10 Mb Cytogene(c Band Genome sequencing Next Gen sequencing STS mapping fingerprint mapping YACs ~1 Mb BACs ~150 Kb Human Genome Gene9c Map Genome mapping Sequence- ready BAC map Genome sequencing Next Gen sequencing 1
2 F. Sanger, S. Nicklen, and A. R. Coulson, Proc Natl Acad Sci U S A. 1977; 74:
3 SCIENCE VOL OCTOBER 1996 SCIENCE VOL MARCH DECEMBER 1998 VOL 282 SCIENCE 3
4 1/26/15 15 February 2001 NATURE VOL FEBRUARY ,000 Mbp finished 3 GB dra_ sequence Detec(on of Fluorescently Tagged DNA 5 TTACGATGH! 5 TTACGATGCGH! 5 TTACGATGCGGH G T A C C C T G A T C A 5 TTACGATGCGGAATGH! 5 TTACGATGCGGAATGACGH! 5 TTACGAH! 5 TTACGATGCGGAH 5 TTACGATGCGGAAH! 5 TTACGATGCGGAATGAH! 5 TTACGATGCGGAATGACGAH! 5 TTACGATGCGGAATGACGAAH! 5 TTACGATH! ACTAGTCCCATGdd ACTAGTCCCATdd ACTAGTCCCAdd ACTAGTCCCdd ACTAGTCCdd ACTAGTCdd ACTAGTdd ACTAGdd ACTAdd ACTdd ACdd Add3 5 TTACGATGCGGaaTH! 5 TTACGATGCGGAATGACGAATH! 5 TTACGATGCH! 5 TTACGATGCGGAATGACH! Op(cal Detec(on System 5 TTACGATGCGGAATGACGAATCH F. Sanger, S. Nicklen, and A. R. Coulson, Proc Natl Acad Sci U S A. 1977; 74: Output to Computer Eric Green, NHGRI 4
5 Fluorescent DNA Sequencing Data Eric Green, NHGRI hdp://www3.appliedbiosystems.com quan9fying sequence accuracy hdp:// hdp:// analysis/tab- a- complete- trace.gif Ewing B et al. et Green P Genome Res : PMID: and 8: PMID:
6 >gnl ti 2 name:g10p69425rg9.t0! hdp:// analysis/tab- a- complete- trace.gif ! F. Sanger, S. Nicklen, and A. R. Coulson, Proc Natl Acad Sci U S A. 1977; 74: It is a great source of joy to me that the dideoxy method is s9ll the basic technique used. It was perhaps the climax of my career and makes me feel that all our previous studies on sequences with their successes and failures were not only enjoyable but also a worthwhile contribu(on to the future of medicine. Fred Sanger 2001 Nature Med. 7: Mb shotgun clones ~2 Kb or ~10 Kb sequence fragment Cytogene(c Band YACs ~1 Mb BACs ~150 Kb TTCAGCTGGAATCGAATTCATCGGT! ATTCATCGGTGTCGATGCTGATTAACTAGCTAGTTTACCCAA! AGTTTACCCAATACCCAATTCGATCGACCGATTCGAC! assemble con(gs finishing finished sequence 6
7 shotgun clones ~2 Kb or ~10 Kb fragment sequence TTCAGCTGGAATCGAATTCATCGGT! ATTCATCGGTGTCGATGCTGATTAACTAGCTAGTTTACCCAA! AGTTTACCCAATACCCAATTCGATCGACCGATTCGAC! assemble con(gs finishing finished sequence Problems with the shotgun approach T.A. Brown GENOMES 2 BIOS Scien(fic Publishers Ltd,
8 Problems with the shotgun approach whole-human genome shotgun assembly scaffold GATC GATC 10, 50 kb inserts T.A. Brown GENOMES 2 BIOS Scien(fic Publishers Ltd, 2002 Published by AAAS J. C. Venter et al., Science 291, (2001) perfect 2X coverage 50% of the assembed sequence lies in con9gs of length N50 or greater random 2X coverage Expecta9on for 7X WGS 30 kb HGP 7X WGS mouse assembly ~24 kb Waterston RH, Lander ES, Sulston JE (2002) On the sequencing of the human genome. PNAS 99: ; PNAS 100:
9 whole-human genome shotgun assembly chromosomes hybrid WGS and hierarchical sequencing N50 = ~3.6 MKb (2.3 Mb HGP) BACs 2, 10, 50 kb fragments 5.1X coverage N50 = ~86 Kb (82 Kb HGP) 2X shred of BACs Published by AAAS J. C. Venter et al., Science 291, (2001) Green ED (2001) Strategies for the Sequencing of Complex Genomes. Nature Reviews Gene2cs 2: 573 PMID: how many sequence reads do we need? P(k;λ) = (λ k e - λ ) k! k = # of events = # of (mes a given base is sequenced λ = mean # of events = average sequence coverage Example Average coverage (λ) = 5x Probability a given base is sequenced exactly 10 (k) 9mes is 5 10 e - 5 /10! = 0.018, or ~ 2% of bases will have exactly 10x coverage. If you sequence at 10x coverage how much of the genome will be sequenced at least 5 9mes? = 1 probability base is sequenced < 5 9mes = 1 [P(0,10) + P(1,10) + P(2,10) + P(3,10) + P(4,10)] = 0.97 P(k;λ) = (λ k e - λ ) k! Lander & Waterman GENOMICS 2, (1988) 9
10 Rela9onship of sequence coverage and con9g length (Θ = frac9on of clone overlap needed) hdp:// Large- scale genome sequence processing by M Kasahara & S Morishita whole-human genome shotgun assembly Genome mapping Genome sequencing Next Gen sequencing Published by AAAS J. C. Venter et al., Science 291, (2001) 10
Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University
Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these
Genomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.
Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences
Nature Biotechnology: doi: /nbt.1904
Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is
Phylogenomics. Antonis Rokas Department of Biological Sciences Vanderbilt University.
Phylogenomics Antonis Rokas Department of Biological Sciences Vanderbilt University http://as.vanderbilt.edu/rokaslab High-Throughput DNA Sequencing Technologies 454 / Roche 450 bp 1.5 Gbp / day Illumina
Challenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014
Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical
Supplementary note: Comparison of deletion variants identified in this study and four earlier studies
Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Here we compare the results of this study to potentially overlapping results from four earlier studies
SUPPLEMENTARY INFORMATION
doi: 1.138/nature8645 Physical coverage (x haploid genomes) 11 6.4 4.9 6.9 6.7 4.4 5.9 9.1 7.6 125 Neither end mapped One end mapped Chimaeras Correct Reads (million ns) 1 75 5 25 HCC1187 HCC1395 HCC1599
CNV Detection and Interpretation in Genomic Data
CNV Detection and Interpretation in Genomic Data Benjamin W. Darbro, M.D., Ph.D. Assistant Professor of Pediatrics Director of the Shivanand R. Patil Cytogenetics and Molecular Laboratory Overview What
RNA- seq Introduc1on. Promises and pi7alls
RNA- seq Introduc1on Promises and pi7alls DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different func1onal RNAs Which RNAs (and some1mes
Weird animal genomes and sex chromosome evolution
Weird animal genomes and sex chromosome evolution Genomes of distantly related mammals, other vertebrates Sex chromosome origins, evolution, fate Evolution of X and Y genes Jenny Graves La Trobe University,
Next generation sequencing of the Salix purpurea genome and transcriptome: Tools for the genetic improvement of willow biomass crops
Next generation sequencing of the Salix purpurea genome and transcriptome: Tools for the genetic improvement of willow biomass crops Larry Smart, Michelle Serapiglia, Fred Gouker Cornell University, NYS
Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
Gene duplication and loss Part II
Gene duplication and loss Part II Matthew Hahn Indiana University mwh@indiana.edu When genomes go bad When genomes go bad At least 113 genes entered the vertebrate (or pre-vertebrate) lineage by horizontal
Recombina*on of Linked Genes: Crossing Over. discovered that genes can be linked. the linkage was incomplete
Recombina*on of Linked Genes: Crossing Over Fig. 15-10 Testcross parents Gray body, normal wings (F 1 dihybrid) Black body, vestigial wings (double mutant) Morgan discovered that genes can be linked the
Global variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
FONS Nové sekvenační technologie vklinickédiagnostice?
FONS 2010 Nové sekvenační technologie vklinickédiagnostice? Sekvenování amplikonů Sequence capture Celogenomové sekvenování FONS 2010 Sekvenování amplikonů Amplicon sequencing - amplicon sequencing enables
Structural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
BIOL2005 WORKSHEET 2008
BIOL2005 WORKSHEET 2008 Answer all 6 questions in the space provided using additional sheets where necessary. Hand your completed answers in to the Biology office by 3 p.m. Friday 8th February. 1. Your
Assignment 5: Integrative epigenomics analysis
Assignment 5: Integrative epigenomics analysis Due date: Friday, 2/24 10am. Note: no late assignments will be accepted. Introduction CpG islands (CGIs) are important regulatory regions in the genome. What
AML Genomics 11/27/17. Normal neutrophil maturation. Acute Myeloid Leukemia (AML) = block in differentiation. Myelomonocy9c FAB M5
AML Genomics 1 Normal neutrophil maturation Acute Myeloid Leukemia (AML) = block in differentiation AML with minimal differen9a9on FAB M1 Promyelocy9c leukemia FAB M3 Myelomonocy9c FAB M5 2 1 Principle
Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials
Genome-Wide Localization of Protein-DNA Binding and Histone Modification by a Bayesian Change-Point Method with ChIP-seq Data
Genome-Wide Localization of Protein-DNA Binding and Histone Modification by a Bayesian Change-Point Method with ChIP-seq Data Haipeng Xing, Yifan Mo, Will Liao, Michael Q. Zhang Clayton Davis and Geoffrey
Comprehensive Chromosome Screening Is NextGen Likely to be the Final Best Platform and What are its Advantages and Quirks?
Comprehensive Chromosome Screening Is NextGen Likely to be the Final Best Platform and What are its Advantages and Quirks? Embryo 1 Embryo 2 combine samples for a single sequencing chip Barcode 1 CTAAGGTAAC
CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery
CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences
Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep
Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
Review: Genome assembly Reads
Assembly validation Review: Genome assembly Reads Contigs Scaffolds Chromosome Review: Mate pair data Overlap-Layout-Consensus AMOS project: A Modular Open Source assembler Importing data to an AMOS bank
Ambient temperature regulated flowering time
Ambient temperature regulated flowering time Applications of RNAseq RNA- seq course: The power of RNA-seq June 7 th, 2013; Richard Immink Overview Introduction: Biological research question/hypothesis
Chemical Biology, Option II Mechanism Based Proteomic Tagging Case History CH1
Proteome Wide Screening of Serine Protease Activity Proc Natl Acad Sci 1999, 97, 14694; Proteomics 2001, 1, 1067; Proc Natl Acad Sci 2002, 99, 10335; Biochemistry 2001, 40, 4005; J. Am. Chem. Soc., 2005,
Towards Personalized Medicine: An Improved De Novo Assembly Procedure for Early Detection of Drug Resistant HIV Minor Quasispecies in Patient Samples
www.bioinformation.net Volume 14(8) Software Model Towards Personalized Medicine: An Improved De Novo Assembly Procedure for Early Detection of Drug Resistant HIV Minor Quasispecies in Patient Samples
Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015
Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a
AZOOSPERMIA Chromosome Y
AZOOSPERMIA Chromosome Y M i c r o d e l e t i o n Ref.: PI EDP003024-40 testspi EDP002024 1. INTRODUCTION In 1976, Tiepolo and Zuffardi reported de novo, microscopically detectable deletions of the distal
DMD Genetics: complicated, complex and critical to understand
DMD Genetics: complicated, complex and critical to understand Stanley Nelson, MD Professor of Human Genetics, Pathology and Laboratory Medicine, and Psychiatry Co Director, Center for Duchenne Muscular
Transcript reconstruction
Transcript reconstruction Summary I Data types, file formats and utilities Annotation: Genomic regions Genes Peaks bedtools Alignment: Map reads BAM/SAM Samtools Aggregation: Summary files Wig (UCSC) TDF
Supplementary Figure 1. Using DNA barcode-labeled MHC multimers to generate TCR fingerprints
Supplementary Figure 1 Using DNA barcode-labeled MHC multimers to generate TCR fingerprints (a) Schematic overview of the workflow behind a TCR fingerprint. Each peptide position of the original peptide
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin
Deep-Sequencing of HIV-1
Deep-Sequencing of HIV-1 The quest for true variants Alexander Thielen, Martin Däumer 09.05.2015 Limitations of drug resistance testing by standard-sequencing Blood plasma RNA extraction RNA Reverse Transcription/
Nature Structural & Molecular Biology: doi: /nsmb.2419
Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb
arxiv: v2 [q-bio.pe] 21 Jan 2008
![arxiv: v2 [q-bio.pe] 21 Jan 2008](/thumbs/80/82143391.jpg "arxiv: v2 [q-bio.pe] 21 Jan 2008")
Viral population estimation using pyrosequencing Nicholas Eriksson 1,, Lior Pachter 2, Yumi Mitsuya 3, Soo-Yon Rhee 3, Chunlin Wang 3, Baback Gharizadeh 4, Mostafa Ronaghi 4, Robert W. Shafer 3, and Niko
Epigenetic drift in aging twins
Epigenetic drift in aging twins Qihua Tan, MD, PhD Kaare Christensen, MD, PhD Lene Christiansen, PhD Epidemiology, Biostatistics and Biodemography, Institute of Public Health Unit of Human Genetics, Institute
CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY
CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY More genetic information requires cutting-edge interpretation techniques Whole Exome Sequencing For certain patients the combination of symptoms does not allow
Human Inheritance. Use Target Reading Skills. Patterns of Human Inheritance. Modern Genetics Guided Reading and Study
Human Inheritance This section explains some patterns of inheritance in humans. It also describes the functions of the sex chromosomes and the relationship between genes and the environment. Use Target
BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space
Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate
genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY
CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY More genetic information requires cutting-edge interpretation techniques Whole Exome Sequencing For some patients, the combination of symptoms does not allow
Benefits and pitfalls of new genetic tests
Benefits and pitfalls of new genetic tests Amanda Krause Division of Human Genetics, NHLS and University of the Witwatersrand Definition of Genetic Testing the analysis of human DNA, RNA, chromosomes,
High coverage in planta RNA sequencing identifies Fusarium oxysporum effectors and Medicago truncatularesistancemechanisms
High coverage in planta RNA sequencing identifies Fusarium oxysporum effectors and Medicago truncatularesistancemechanisms Louise Thatcher Gagan Garg, Angela Williams, Judith Lichtenzveig and Karam Singh
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10643 Supplementary Table 1. Identification of hecw-1 coding polymorphisms at amino acid positions 322 and 325 in 162 strains of C. elegans. WWW.NATURE.COM/NATURE 1 Supplementary Figure
Sex Determination and Gonadal Sex Differentiation in Fish
Sex Determination and Gonadal Sex Differentiation in Fish Yoshitaka Nagahama Okazaki National Research Institutes, Japan This first slide shows the processes of gonadal sex differentiation and gametogenesis
An Overview of Cytogenetics. Bridget Herschap, M.D. 9/23/2013
An Overview of Cytogenetics Bridget Herschap, M.D. 9/23/2013 Objectives } History and Introduction of Cytogenetics } Overview of Current Techniques } Common cytogenetic tests and their clinical application
Figure S1. Molecular confirmation of the precise insertion of the AsMCRkh2 cargo into the kh w locus.
Supporting Information Appendix Table S1. Larval and adult phenotypes of G 2 progeny of lines 10.1 and 10.2 G 1 outcrosses to wild-type mosquitoes. Table S2. List of oligonucleotide primers. Table S3.
Code number given on the right hand side of the question paper should be written on the title page of the answerbook by the candidate.
Series ONS SET-3 Roll No. Candiates must write code on the title page of the answer book Please check that this question paper contains 11 printed pages. Code number given on the right hand side of the
Statistical analysis of RIM data (retroviral insertional mutagenesis) Bioinformatics and Statistics The Netherlands Cancer Institute Amsterdam
Statistical analysis of RIM data (retroviral insertional mutagenesis) Lodewyk Wessels Bioinformatics and Statistics The Netherlands Cancer Institute Amsterdam Viral integration Viral integration Viral
CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi
2 CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE Dr. Bahar Naghavi Assistant professor of Basic Science Department, Shahid Beheshti University of Medical Sciences, Tehran,Iran 3 Introduction Over 4000
Cancer Research: A Quest for a Cure
Western Oregon University Digital Commons@WOU Honors Senior Theses/Projects Student Scholarship 6-1-2014 Cancer Research: A Quest for a Cure Alyssa Palmer Western Oregon University, apalmer09@mail.wou.edu
sirna count per 50 kb small RNAs matching the direct strand Repeat length (bp) per 50 kb repeats in the chromosome
Qi et al. 26-3-2564C Qi et al., Figure S1 sirna count per 5 kb small RNAs matching the direct strand sirna count per 5 kb small RNAs matching the complementary strand Repeat length (bp) per 5 kb repeats
Proteins: Proteomics & Protein-Protein Interactions Part I
Proteins: Proteomics & Protein-Protein Interactions Part I Jesse Rinehart, PhD Department of Cellular & Molecular Physiology Systems Biology Institute DNA RNA PROTEIN DNA RNA PROTEIN Proteins: Proteomics
Human Genetics Notes:
Human Genetics Notes: Human Chromosomes Cell biologists analyze chromosomes by looking at. Cells are during mitosis. Scientists then cut out the chromosomes from the and group them together in pairs. A
Lecture 3-4. Identification of Positive Regulators downstream of SA
Lecture 3-4 Identification of Positive Regulators downstream of SA Positive regulators between SA and resistance/pr Systemic resistance PR gene expression? SA Local infection Necrosis SA What could they
MPS for translocations
MPS for translocations Filip Van Nieuwerburgh, Ph.D. Lab of Pharmaceutical Biotechnology NXTGNT massively parallel sequencing facility, Ghent University In collaboration with: Center for Medical Genetics,
Segment-specific and common nucleotide sequences in the
Proc. Nati. Acad. Sci. USA Vol. 84, pp. 2703-2707, May 1987 Biochemistry Segment-specific and common nucleotide sequences in the noncoding regions of influenza B virus genome RNAs (viral transcription/viral
Role of FISH in Hematological Cancers
Role of FISH in Hematological Cancers Thomas S.K. Wan PhD,FRCPath,FFSc(RCPA) Honorary Professor, Department of Pathology & Clinical Biochemistry, Queen Mary Hospital, University of Hong Kong. e-mail: wantsk@hku.hk
Transcriptome and isoform reconstruc1on with short reads. Tangled up in reads
Transcriptome and isoform reconstruc1on with short reads Tangled up in reads Topics of this lecture Mapping- based reconstruc1on methods Case study: The domes1c dog De- novo reconstruc1on method Trinity
NGS in tissue and liquid biopsy
NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name Choroideremia OMIM number for disease 303100 Disease alternative names please
Unit 8.1: Human Chromosomes and Genes
Unit 8.1: Human Chromosomes and Genes Biotechnology. Gene Therapy. Reality or fiction? During your lifetime, gene therapy may be mainstream medicine. Here we see a representation of the insertion of DNA
Algorithms for studying the structure and function of genomes
Algorithms for studying the structure and function of genomes Michael Schatz Feb 5, 2015 JHU Dept. of Biology Schatzlab Overview Human Genetics Role of mutations in disease Narzisi et al. (2014) Iossifov
Comprehensive Genome and Transcriptome Structural Analysis of a Breast Cancer Cell Line using PacBio Long Read Sequencing
Comprehensive Genome and Transcriptome Structural Analysis of a Breast Cancer Cell Line using PacBio Long Read Sequencing Maria Nattestad Schatz + McCombie + Hicks at Cold Spring Harbor Laboratory McPherson
Alpha thalassemia mental retardation X-linked. Acquired alpha-thalassemia myelodysplastic syndrome
Alpha thalassemia mental retardation X-linked Acquired alpha-thalassemia myelodysplastic syndrome (Alpha thalassemia mental retardation X-linked) Acquired alpha-thalassemia myelodysplastic syndrome Schematic
QIAsymphony DSP Circulating DNA Kit
QIAsymphony DSP Circulating DNA Kit February 2017 Performance Characteristics 937556 Sample to Insight Contents Performance Characteristics... 4 Basic performance... 4 Run precision... 6 Equivalent performance
RNA-seq Introduction
RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated
New and Developing Technologies for Genetic Diagnostics National Genetics Reference Laboratory (Wessex) Salisbury, UK - July 2010 BACs on Beads
New and Developing Technologies for Genetic Diagnostics National Genetics Reference Laboratory (Wessex) Salisbury, UK - July 2010 BACs on Beads Susan Gross, MD Division of Reproductive Genetics Professor
CHROMOSOMAL MICROARRAY (CGH+SNP)
Chromosome imbalances are a significant cause of developmental delay, mental retardation, autism spectrum disorders, dysmorphic features and/or birth defects. The imbalance of genetic material may be due
Trends in swine nutrition science
Trends in swine nutrition science Opening Nutreco SRC, September 19, 2013 Walter Gerrits, Animal Nutrition Group, Wageningen University What is driving pig research Money Curiosity, hypothesis driven Curiosity,
Supplementary Information. Preferential associations between co-regulated genes reveal a. transcriptional interactome in erythroid cells
Supplementary Information Preferential associations between co-regulated genes reveal a transcriptional interactome in erythroid cells Stefan Schoenfelder, * Tom Sexton, * Lyubomira Chakalova, * Nathan
SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A
SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A1-1011. This SALSA MLPA probemix is for basic research and intended for experienced MLPA users only! This probemix enables you to quantify genes
Supervised Learner for the Prediction of Hi-C Interaction Counts and Determination of Influential Features. Tyler Yue Lab
Supervised Learner for the Prediction of Hi-C Interaction Counts and Determination of Influential Features Tyler Derr @ Yue Lab tsd5037@psu.edu Background Hi-C is a chromosome conformation capture (3C)
Determination of Genomic Imbalances by Genome-wide Screening Approaches
Overview Determination of Genomic Imbalances by Genome-wide Screening Approaches Károly Szuhai Introduction/Methodologies Applications/Results Conclusion Approaches Introduction/Methodologies Chromosome
Protein SD Units (P-value) Cluster order
SUPPLEMENTAL TABLE AND FIGURES Table S1. Signature Phosphoproteome of CD22 E12 Transgenic Mouse BPL Cells. T-test vs. Other Protein SD Units (P-value) Cluster order ATPase (Ab-16) 1.41 0.000880 1 mtor
Cell Cycle and Mitosis
Ch 12 BIOL 221 Cell Cycle and Mitosis The Key Roles of Cell Division Cell division Cellular reproduc2on An ability of organisms that best dis2nguishes living things from nonliving ma:er Cell Division Unicellular
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and
Basket and Umbrella Trial Designs in Oncology
Basket and Umbrella Trial Designs in Oncology Eric Polley Biomedical Statistics and Informatics Mayo Clinic Polley.Eric@mayo.edu Dose Selection for Cancer Treatment Drugs Stanford Medicine May 2017 1 /
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
R2: web-based genomics analysis and visualization platform
R2: web-based genomics analysis and visualization platform Overview Jan Koster Department of Oncogenomics Academic Medical Center (AMC) UvA, the Netherlands jankoster@amc.uva.nl jankoster@amc.uva.nl 1
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean for a Laboratory to Use Such Technologies?"
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean for a Laboratory to Use Such Technologies?" Dr Joseph Hughes 11th OIE Seminar Saskatoon - 17th June 2015 Cost per raw Megabase
Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
Structural vs. nonstructural proteins
Why would you want to study proteins associated with viruses or virus infection? Receptors Mechanism of uncoating How is gene expression carried out, exclusively by viral enzymes? Gene expression phases?
iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers).
Supplementary Materials Supplementary Methods iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). IDH1 R132H and R132L Forward:
P450I I E 1 Gene : Dra I. Human Cytochrome Polymorphism and
Tohoku J. Exp. Med., 1992, 168, 113-117 Human Cytochrome Polymorphism and P450I I E 1 Gene : Dra I Susceptibility to Cancer FUMIYUKI VEMATSUHIDEAKI KIKUCHI*, MASAKICHI MOTOMIYA j', TATSUYA ABE j', CHIKASHI
cn.mops - Mixture of Poissons for CNV detection in NGS data Günter Klambauer Institute of Bioinformatics, Johannes Kepler University Linz
Software Manual Institute of Bioinformatics, Johannes Kepler University Linz cn.mops - Mixture of Poissons for CNV detection in NGS data Günter Klambauer Institute of Bioinformatics, Johannes Kepler University
Moore s law in information technology. exponential growth!
Moore s law in information technology exponential growth! ... and how it compares to developments in bio sciences Biology is driven by an avalanche of new information... DNA sequencing methods and throughput
Red clover (Trifolium pratense L.) draft genome provides a. platform for trait improvement
Red clover (Trifolium pratense L.) draft genome provides a platform for trait improvement Jose J. De Vega 1,2*, Sarah Ayling 1, Matthew Hegarty 2, Dave Kudrna 3, Jose L. Goicoechea 3, Åshild Ergon 4, Odd
Supplementary Figure 1
Supplementary Figure 1 Supplementary Fig. 1: Quality assessment of formalin-fixed paraffin-embedded (FFPE)-derived DNA and nuclei. (a) Multiplex PCR analysis of unrepaired and repaired bulk FFPE gdna from
Table S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples.
Supplementary files Table S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples. Table S3. Specificity of AGO1- and AGO4-preferred 24-nt
Inference of Isoforms from Short Sequence Reads
Inference of Isoforms from Short Sequence Reads Tao Jiang Department of Computer Science and Engineering University of California, Riverside Tsinghua University Joint work with Jianxing Feng and Wei Li
Anti-hTERT Antibody (SCD-A7)
Quality in Control Anti-hTERT Antibody (SCD-A7) htert_ab_pi_v1 Product Code: HCL025 Contents htert and Telomerase 2 Negative htert 3 Positive htert 4 Guidance and additional data 5 Case Study: RMH12-001
ChIP-seq data analysis
ChIP-seq data analysis Harri Lähdesmäki Department of Computer Science Aalto University November 24, 2017 Contents Background ChIP-seq protocol ChIP-seq data analysis Transcriptional regulation Transcriptional
Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different