Chapter 4 Cellular Oncogenes ~ 4.6 -
|
|
|
- Marcia Ella Barrett
- 6 years ago
- Views:
Transcription
1 Chapter 4 Cellular Oncogenes ~ 4.6 -
2 Many retroviruses carrying oncogenes have been found in chickens and mice
3 However, attempts undertaken during the 1970s to isolate viruses from most types of human tumors were unsuccessful. Even reverse transcriptase-containing virus particles are difficult to find in human tumor samples.
4
5 4.2 Transfection of DNA provides a strategy for detecting nonviral oncogenes (NIH3T3 cells) transformed by 3-methycholanthrene Sidebar 4.2 Figure 4.2 (part 1 of 2) The Biology of Cancer ( Garland Science 2007)
6 DNA from tumor cells (NIH3T3 cells) The DNA from chemical-transformed tumor cells was able to convert non-tumorigenic NIH3T3 fibroblasts into tumorigenic cells. Figure 4.2 (part 2 of 2) The Biology of Cancer ( Garland Science 2007)
7 DNA from human cancers also cause focus formation focus formation cells in the focus surrounding untransformed monolayer cells Transfection of DNA from T24 human bladder carcinoma cell line into NIH3T3 cells Figure 4.3 The Biology of Cancer ( Garland Science 2007)
8 4.3 Oncogenes discovered in human tumor cell lines are related to those carried by transforming retroviruses Southern blotting (DNA) Northern blotting (RNA)
9 nitrocellulose paper ( 32P-DNA) Figure 4.4 (part 2) The Biology of Cancer ( Garland Science 2007)
10 Figure 4.4 (part 3) The Biology of Cancer ( Garland Science 2007)
11 Homology between transfected oncogenes and retroviral oncogenes probe used: H-ras oncogene present in Harvey rat sarcoma virus 11 (a ~ k) NIH3T3 cell lines transfected with DNA extracted from a human bladder carcinoma cell line Figure 4.5 The Biology of Cancer ( Garland Science 2007) untransfected NIH3T3
12 TK : tyrosine kinase Table 4.1 The Biology of Cancer ( Garland Science 2007)
13 Amplification of the erbb2/her2/neu oncogene in breast cancers Kaplan-Meier plot Figure 4.6a The Biology of Cancer ( Garland Science 2007)
14 erbb2/her2/neu oncogene can be amplified or overexpressed in human breast carcinoma cells erbb2/neu oncogene is amplified erbb2/neu mrna is overexpressed increased level of erbb2/neu-encoded protein Figure 4.6c The Biology of Cancer ( Garland Science 2007)
15 Cloning of transfected human oncogenes Alu sequence present in about 106 copies scattered throughout human genome Figure 4.8 The Biology of Cancer ( Garland Science 2007)
16 Localization of the mutation responsible for oncogene activity cloned DNA of a human bladder carcinoma oncogene Figure 4.9 The Biology of Cancer ( Garland Science 2007)
17 A point mutation is responsible for H-ras oncogene activation Figure 4.10 The Biology of Cancer ( Garland Science 2007)
18 4.4 Proto-oncogenes can be activated by genetic changes affecting either protein expression or structure
19 4.5 The myc oncogene can arise via at least three distinct mechanisms homogeneous staining regions (HSR) The N-myc gene amplification is found in 30% of human childhood neuroblastoma. Astrocytoma, retinoblastoma and small-cell lung carcinomas (neuroendocrinal traits) also often exhibit amplified N-myc genes. * N-myc is a close relative of c-myc. Figure 4.11a The Biology of Cancer ( Garland Science 2007)
20 event - free survival Kaplan-Meier plot of childhood neuroblastoma
21 Table 4.3 The Biology of Cancer ( Garland Science 2007)
22 Activation of the myc protooncogenes 1. Gene amplification 10 ~ 30 copies or 100 ~ 150 copies shown as homogeneously staining regions (HSR) or double minutes (DM) 2. Provirus integration - insertional mutagenesis constitutive expression by insertion of retroviruses 3. Chromosomal translocation
23 Insertional mutagenesis transcription of myc gene is controlled by viral promoters excessive myc protein Figure 3.23b The Biology of Cancer ( Garland Science 2007)
24 Burkitt s lymphoma in Africa (Aedes simpsoni) Malarial infection Figure 4.12 The Biology of Cancer ( Garland Science 2007) Epstein-Barr virus (EBV) genome in Burkitt s lymphoma cells
25 Chromosome translocations in Burkitt s lymphoma The expression of c-myc gene is placed under control of the trancriptioncontrolling enhancer sequences of an immunoglobulin heavy chain (IgH) gene. Figure 4.13a The Biology of Cancer ( Garland Science 2007)
26 Genetic map of the translocation event of c-myc gene The c-myc gene is translocated into chromosome 8, under the control of the immunoglobulin heavy-chain (IgH) sequences present on human chromosome 14 Figure 4.13b The Biology of Cancer ( Garland Science 2007)
27 Table 4.4 The Biology of Cancer ( Garland Science 2007)
28 4.6 A diverse array of structural changes in proteins can also lead to oncogene activation (GF) Figure 4.14 The Biology of Cancer ( Garland Science 2007)
29 The great majority (> 95 %) of chronic myelogenous leukemia (CML) has t(9; 22) (q34; q11) translocation Philadelphia chromosome (Ph1) Figure 2.23a The Biology of Cancer ( Garland Science 2007)
30 Formation of the bcr-abl oncogene after t(9; 22) (q34; q11) translocation (Abelson murine leukemia virus) (breakpoint cluster region) Figure 4.15a The Biology of Cancer ( Garland Science 2007)
31 Different breakpoints in bcr results in different types of human leukemia a b c a. acute lymphocytic leukemia b. chronic myelogenous leukemia c. Bcr Abl Bcr-Abl fusion protein Figure 4.15b The Biology of Cancer ( Garland Science 2007) chronic neutrophilic leukemia
32 Table 4.5 The Biology of Cancer ( Garland Science 2007)
33 Notations used for proto-oncogenes and oncogenes Non-human (chicken, mouse, etc.) Human gene protein src, myc Src, Myc SRC, MYC SRC, MYC
Origin of oncogenes? Oncogenes and Proto-oncogenes. Jekyll and Hyde. Oncogene hypothesis. Retroviral oncogenes and cell proto-oncogenes
Oncogenes and Proto-oncogenes Jekyll and Hyde A double edged sword Origin of oncogenes? Oncogene hypothesis Retroviral oncogenes and cell proto-oncogenes (v-onc) (c-onc) The role of c-onc in cancer How
What causes cancer? Physical factors (radiation, ionization) Chemical factors (carcinogens) Biological factors (virus, bacteria, parasite)
Oncogenes What causes cancer? Chemical factors (carcinogens) Physical factors (radiation, ionization) Biological factors (virus, bacteria, parasite) DNA Mutation or damage Oncogenes Tumor suppressor genes
Activation of cellular proto-oncogenes to oncogenes. How was active Ras identified?
Dominant Acting Oncogenes Eugene E. Marcantonio, M.D. Ph.D. Oncogenes are altered forms of normal cellular genes called proto-oncogenes that are involved in pathways regulating cell growth, differentiation,
Molecular Cell Biology. Prof. D. Karunagaran. Department of Biotechnology. Indian Institute of Technology Madras
Molecular Cell Biology Prof. D. Karunagaran Department of Biotechnology Indian Institute of Technology Madras Module 9 Molecular Basis of Cancer, Oncogenes and Tumor Suppressor Genes Lecture 2 Genes Associated
Oncogenes. Dr. S Hosseini-Asl
Oncogenes Dr. S Hosseini-Asl An oncogene is a mutated form of a normal cellular gene called a proto-oncogene that contributes to the development of a cancer. Proto-oncogenes typically regulate cell growth
oncogenes-and- tumour-suppressor-genes)
Special topics in tumor biochemistry oncogenes-and- tumour-suppressor-genes) Speaker: Prof. Jiunn-Jye Chuu E-Mail: jjchuu@mail.stust.edu.tw Genetic Basis of Cancer Cancer-causing mutations Disease of aging
Cancer Genetics. What is Cancer? Cancer Classification. Medical Genetics. Uncontrolled growth of cells. Not all tumors are cancerous
Session8 Medical Genetics Cancer Genetics J avad Jamshidi F a s a U n i v e r s i t y o f M e d i c a l S c i e n c e s, N o v e m b e r 2 0 1 7 What is Cancer? Uncontrolled growth of cells Not all tumors
1. Basic principles 2. 6 hallmark features 3. Abnormal cell proliferation: mechanisms 4. Carcinogens: examples. Major Principles:
Carcinogenesis 1. Basic principles 2. 6 hallmark features 3. Abnormal cell proliferation: mechanisms 4. Carcinogens: examples Carcinogenesis Major Principles: 1. Nonlethal genetic damage is central to
Karyotype analysis reveals transloction of chromosome 22 to 9 in CML chronic myelogenous leukemia has fusion protein Bcr-Abl
Chapt. 18 Cancer Molecular Biology of Cancer Student Learning Outcomes: Describe cancer diseases in which cells no longer respond Describe how cancers come from genomic mutations (inherited or somatic)
VIRUSES AND CANCER Michael Lea
VIRUSES AND CANCER 2010 Michael Lea VIRAL ONCOLOGY - LECTURE OUTLINE 1. Historical Review 2. Viruses Associated with Cancer 3. RNA Tumor Viruses 4. DNA Tumor Viruses HISTORICAL REVIEW Historical Review
Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
Howard Temin. Predicted RSV converted its genome into DNA to become part of host chromosome; later discovered reverse transciptase.
Howard Temin Predicted RSV converted its genome into DNA to become part of host chromosome; later discovered reverse transciptase Nobel prize 1975 Figure 3.6 The Biology of Cancer ( Garland Science 2007)
Deregulation of signal transduction and cell cycle in Cancer
Deregulation of signal transduction and cell cycle in Cancer Tuangporn Suthiphongchai, Ph.D. Department of Biochemistry Faculty of Science, Mahidol University Email: tuangporn.sut@mahidol.ac.th Room Pr324
CANCER. Inherited Cancer Syndromes. Affects 25% of US population. Kills 19% of US population (2nd largest killer after heart disease)
CANCER Affects 25% of US population Kills 19% of US population (2nd largest killer after heart disease) NOT one disease but 200-300 different defects Etiologic Factors In Cancer: Relative contributions
Section D: The Molecular Biology of Cancer
CHAPTER 19 THE ORGANIZATION AND CONTROL OF EUKARYOTIC GENOMES Section D: The Molecular Biology of Cancer 1. Cancer results from genetic changes that affect the cell cycle 2. Oncogene proteins and faulty
Cell Cycle and Cancer
142 8. Cell Cycle and Cancer NOTES CELL CYCLE G 0 state o Resting cells may re-enter the cell cycle Nondividing cells (skeletal and cardiac muscle, neurons) o Have left the cell cycle and cannot undergo
Carcinogenesis. Carcinogenesis. 1. Basic principles 2. 6 hallmark features 3. Abnormal cell proliferation: mechanisms 4. Carcinogens: examples
Carcinogenesis 1. Basic principles 2. 6 hallmark features 3. Abnormal cell proliferation: mechanisms 4. Carcinogens: examples Major Principles (cont d) 4. Principle targets of genetic damage: 4 classes
Viruses Tomasz Kordula, Ph.D.
Viruses Tomasz Kordula, Ph.D. Resources: Alberts et al., Molecular Biology of the Cell, pp. 295, 1330, 1431 1433; Lehninger CD Movie A0002201. Learning Objectives: 1. Understand parasitic life cycle of
ONCOGENES. Michael Lea
ONCOGENES 2011 Michael Lea ONCOGENES - Lecture Outline I. Introduction 2. Identification of oncogenic genes in retroviruses 3. Homologous sequences in transformed and untransformed cells 4. Methods of
Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
Retroviral oncogenesis. Human retroviruses
Retroviral oncogenesis Two major mechanisms identified in animals Retroviral Transduction mediated by the acutely-transforming retroviruses Abelson Murine Leukemia Virus (A-MuLV) Rous Sarcoma Virus (RSV)
Name Section Problem Set 6
Name Section 7.012 Problem Set 6 Question 1 The viral family Orthomyxoviridae contains the influenza A, B and C viruses. These viruses have a (-)ss RNA genome surrounded by a capsid composed of lipids
Determination Differentiation. determinated precursor specialized cell
Biology of Cancer -Developmental Biology: Determination and Differentiation -Cell Cycle Regulation -Tumor genes: Proto-Oncogenes, Tumor supressor genes -Tumor-Progression -Example for Tumor-Progression:
Fayth K. Yoshimura, Ph.D. September 7, of 7 RETROVIRUSES. 2. HTLV-II causes hairy T-cell leukemia
1 of 7 I. Diseases Caused by Retroviruses RETROVIRUSES A. Human retroviruses that cause cancers 1. HTLV-I causes adult T-cell leukemia and tropical spastic paraparesis 2. HTLV-II causes hairy T-cell leukemia
7.012 Problem Set 6 Solutions
Name Section 7.012 Problem Set 6 Solutions Question 1 The viral family Orthomyxoviridae contains the influenza A, B and C viruses. These viruses have a (-)ss RNA genome surrounded by a capsid composed
Oncogenes and tumour suppressor genes
Cancer mutations disrupt cellular homeostasis Oncogenes and tumour suppressor genes Oncogenes: Gain of function mutations Proto-oncogene Tumour suppressor genes: loss of function mutations Normal cell
The Discovery of Transmissible Cancer Genes
Chapter 2 Oncogenes What Is An Oncogene? An oncogene is a mutated form of a normal cellular gene called a proto-oncogene that contributes to the development of a cancer. Proto-oncogenes typically regulate
Variations in Chromosome Structure & Function. Ch. 8
Variations in Chromosome Structure & Function Ch. 8 1 INTRODUCTION! Genetic variation refers to differences between members of the same species or those of different species Allelic variations are due
Genome of Hepatitis B Virus. VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department
Genome of Hepatitis B Virus VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department Proto Oncogen and Oncogen Oncogen Proteins that possess the ability to cause
Introduction. Cancer Biology. Tumor-suppressor genes. Proto-oncogenes. DNA stability genes. Mechanisms of carcinogenesis.
Cancer Biology Chapter 18 Eric J. Hall., Amato Giaccia, Radiobiology for the Radiologist Introduction Tissue homeostasis depends on the regulated cell division and self-elimination (programmed cell death)
BIT 120. Copy of Cancer/HIV Lecture
BIT 120 Copy of Cancer/HIV Lecture Cancer DEFINITION Any abnormal growth of cells that has malignant potential i.e.. Leukemia Uncontrolled mitosis in WBC Genetic disease caused by an accumulation of mutations
Section D. Genes whose Mutation can lead to Initiation
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
number Done by Corrected by Doctor Maha Shomaf
number 19 Done by Waseem Abo-Obeida Corrected by Abdullah Zreiqat Doctor Maha Shomaf Carcinogenesis: the molecular basis of cancer. Non-lethal genetic damage lies at the heart of carcinogenesis and leads
Search for the cause of cancer
ONCOGENES I and II Terminology Viruses and Cancer RNA tumour viruses DNA tumour viruses Genetics and Cancer Activation of proto-oncogenes Function of proteins encoded by oncogenes 1 Hanahan and Weinberg
Oncogenes. Introduction. Viral-induced Tumours. Secondary article. Retroviruses. Amanda R Perry, Institute of Cancer Research, Sutton, Surrey, UK
Amanda R Perry, Institute of Cancer Research, Sutton, Surrey, UK Oncogenes are the activated forms of normal cellular genes whose protein products are involved in key signalling pathways governing cell
RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.
۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,
Molecular Diagnosis. Nucleic acid based testing in Oncology
Molecular Diagnosis Nucleic acid based testing in Oncology Objectives Describe uses of NAT in Oncology Diagnosis, Prediction, monitoring. Genetics Screening, presymptomatic testing, diagnostic testing,
Oncogenes and Tumor. supressors
Oncogenes and Tumor supressors From history to therapeutics Serge ROCHE Neoplastic transformation TUMOR SURESSOR ONCOGENE ONCOGENES History 1911 1960 1980 2001 Transforming retrovirus RSV v-src is an oncogene
Nucleic Acid Testing - Oncology. Molecular Diagnosis. Gain/Loss of Nucleic Acid. Objectives. MYCN and Neuroblastoma. Molecular Diagnosis
Nucleic Acid Testing - Oncology Molecular Diagnosis Nucleic acid based testing in Oncology Gross alterations in DNA content of tumors (ploidy) Gain/Loss of nucleic acids Markers of Clonality Oncogene/Tumor
Chapter 18- Oncogenes, tumor suppressors & Cancer
Chapter 18- Oncogenes, tumor suppressors & Cancer - Previously we have talked about cancer which is an uncontrolled cell proliferation and we have discussed about the definition of benign, malignant, metastasis
JAK2 V617F analysis. Indication: monitoring of therapy
JAK2 V617F analysis BCR-ABL genotyping The exact chromosomal defect in Philadelphia chromosome is a translocation. Parts of two chromosomes, 9 and 22, switch places. The result is a fusion gene, created
VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer
VIII Curso Internacional del PIRRECV Some molecular mechanisms of cancer Laboratorio de Comunicaciones Celulares, Centro FONDAP Estudios Moleculares de la Celula (CEMC), ICBM, Facultad de Medicina, Universidad
Cancer genetics
Cancer genetics General information about tumorogenesis. Cancer induced by viruses. The role of somatic mutations in cancer production. Oncogenes and Tumor Suppressor Genes (TSG). Hereditary cancer. 1
Cancer. Questions about cancer. What is cancer? What causes unregulated cell growth? What regulates cell growth? What causes DNA damage?
Questions about cancer What is cancer? Cancer Gil McVean, Department of Statistics, Oxford What causes unregulated cell growth? What regulates cell growth? What causes DNA damage? What are the steps in
MPL W515L K mutation
MPL W515L K mutation BCR-ABL genotyping The exact chromosomal defect in Philadelphia chromosome is a translocation. Parts of two chromosomes, 9 and 22, switch places. The result is a fusion gene, created
Cancer and Gene Alterations - 1
Cancer and Gene Alterations - 1 Cancer and Gene Alteration As we know, cancer is a disease of unregulated cell growth. Although we looked at some of the features of cancer when we discussed mitosis checkpoints,
Myeloproliferative Disorders - D Savage - 9 Jan 2002
Disease Usual phenotype acute leukemia precursor chronic leukemia low grade lymphoma myeloma differentiated Total WBC > 60 leukemoid reaction acute leukemia Blast Pro Myel Meta Band Seg Lymph 0 0 0 2
VIRUSES. 1. Describe the structure of a virus by completing the following chart.
AP BIOLOGY MOLECULAR GENETICS ACTIVITY #3 NAME DATE HOUR VIRUSES 1. Describe the structure of a virus by completing the following chart. Viral Part Description of Part 2. Some viruses have an envelope
Lecture 8 Neoplasia II. Dr. Nabila Hamdi MD, PhD
Lecture 8 Neoplasia II Dr. Nabila Hamdi MD, PhD ILOs Understand the definition of neoplasia. List the classification of neoplasia. Describe the general characters of benign tumors. Understand the nomenclature
Bihong Zhao, M.D, Ph.D Department of Pathology
Bihong Zhao, M.D, Ph.D Department of Pathology 04-28-2009 Is tumor self or non-self? How are tumor antigens generated? What are they? How does immune system respond? Introduction Tumor Antigens/Categories
Oncogenes and Tumor Suppressors MCB 5068 November 12, 2013 Jason Weber
Oncogenes and Tumor Suppressors MCB 5068 November 12, 2013 Jason Weber jweber@dom.wustl.edu Oncogenes & Cancer DNA Tumor Viruses Simian Virus 40 p300 prb p53 Large T Antigen Human Adenovirus p300 E1A
MOLECULAR BASIS OF ONCOGENESIS
MOLECULAR BASIS OF ONCOGENESIS MUDr. Jiří Vachtenheim, CSc. 1 Cell processes which result also in cell cycle effects. Differentiation. Differentiated cells are usually in the G0 phase of the cell cycle.
Cancer. Death Rates for the Main Causes of Death in the U.S. Leading Sites of New Cases & Deaths (2015 estimates in the U.S.)
11/25/17 Learning Goals for This Lecture Cancer - To recognize that cancer largely is a preventable disease. - To recognize that cancer is a disease of our own genes. Weimin Zhong, Ph.D. weimin.zhong@yale.edu
CELL CYCLE MOLECULAR BASIS OF ONCOGENESIS
CELL CYCLE MOLECULAR BASIS OF ONCOGENESIS Summary of the regulation of cyclin/cdk complexes during celll cycle Cell cycle phase Cyclin-cdk complex inhibitor activation Substrate(s) G1 Cyclin D/cdk 4,6
Chapter 9, Part 1: Biology of Cancer and Tumor Spread
PATHOPHYSIOLOGY Name Chapter 9, Part 1: Biology of Cancer and Tumor Spread I. Cancer Characteristics and Terminology Neoplasm new growth, involves the overgrowth of tissue to form a neoplastic mass (tumor).
Mohammed El-Khateeb. Tumor Genetics. MGL-12 May 13 th Chapter 22 slide 1 台大農藝系遺傳學
Mohammed El-Khateeb Tumor Genetics MGL-12 May 13 th 2014 台大農藝系遺傳學 601 20000 Chapter 22 slide 1 Cancer Genetics Types of Genetic Alterations in Cancer Evidence that Mutations Cause Cancer Multistage Model
Do Viruses Play a Role in Childhood Leukaemia?
CHILDREN with LEUKAEMIA, 6 September 2004 Do Viruses Play a Role in Childhood Leukaemia? Robin A. Weiss Natural Bioweapons of Mass Destruction A Richter Scale of Viruses and Global Mortality HIV HBV +
Molecular Hematopathology Leukemias I. January 14, 2005
Molecular Hematopathology Leukemias I January 14, 2005 Chronic Myelogenous Leukemia Diagnosis requires presence of Philadelphia chromosome t(9;22)(q34;q11) translocation BCR-ABL is the result BCR on chr
Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015
Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a
Molecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC
Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing
Grassroots Academy New Delhi NET JRF TEST 10.
Grassroots Academy New Delhi NET JRF TEST 10 www.grassrootsacademy.in TEST-10 Cancer: Genetic rearrangements in progenitor cells, oncogenes, tumor suppressor genes, Cancer and the cell cycle, virus-induced
Tumor viruses and human malignancy
Tumor viruses and human malignancy About 20% of human cancer results from tumor virus infection Study of RNA and DNA tumor viruses has revolutionized modern concept of cancer development *Cancer is a disease
Application. Application of molecular biology methods in hematology and oncology. Oncogenes are involved in:
Application Application of molecular biology methods in hematology and oncology Research on the etiology of cancer Diagnostics / Differential diagnostics Stratifying for treatment Prognosing the outcome
Wnt signaling. Ramray Bhat.
Wnt signaling Ramray Bhat ramray@mrdg.iisc.ernet.in Starting with animal biology and viral infections The discovery of certain laboratory murine strains that were highly susceptible to mammary gland cancer.
Retroviruses. ---The name retrovirus comes from the enzyme, reverse transcriptase.
Retroviruses ---The name retrovirus comes from the enzyme, reverse transcriptase. ---Reverse transcriptase (RT) converts the RNA genome present in the virus particle into DNA. ---RT discovered in 1970.
Neoplasia 2018 lecture 4. Dr Heyam Awad MD, FRCPath
Neoplasia 2018 lecture 4 Dr Heyam Awad MD, FRCPath ILOS To understand the concept of the hallmarks of cancer and that they are phenotypic changes needed in all cancer cells. To list the tumor enablers
CELL BIOLOGY - CLUTCH CH CANCER.
!! www.clutchprep.com CONCEPT: OVERVIEW OF CANCER Cancer is a disease which is primarily caused from misregulated cell division, which form There are two types of tumors - Benign tumors remain confined
Test Bank for Robbins and Cotran Pathologic Basis of Disease 9th Edition by Kumar
Link full download:https://getbooksolutions.com/download/test-bank-for-robbinsand-cotran-pathologic-basis-of-disease-9th-edition-by-kumar Test Bank for Robbins and Cotran Pathologic Basis of Disease 9th
Targeting Oncogenic Drivers
Targeting Oncogenic Drivers Yujie Zhao Alex A. Adjei Department of Medicine, Roswell Park Cancer Institute, Buffalo, N.Y., USA Abstract Cancer is a genetic disease caused by a series of somatic and/or
Recombinant Protein Expression Retroviral system
Recombinant Protein Expression Retroviral system Viruses Contains genome DNA or RNA Genome encased in a protein coat or capsid. Some viruses have membrane covering protein coat enveloped virus Ø Essential
- A cancer is an uncontrolled, independent proliferation of robust, healthy cells.
1 Cancer A. What is it? - A cancer is an uncontrolled, independent proliferation of robust, healthy cells. * In some the rate is fast; in others, slow; but in all cancers the cells never stop dividing.
Screening for Complex Phenotypes
Screening for Complex Phenotypes Michael Hemann hemann@mit.edu Screening for cancer phenotypes in mice How do we typically model cancer in mice? Tumor Suppressor KO Oncogene transgenesis Problems with
What is DNA? DNA is a double helix formed by base pairs attached to a sugar-phosphate backbone.
What is DNA? DNA, or deoxyribonucleic acid, is the hereditary material in humans and almost all other organisms. Nearly every cell in a person s body has the same DNA. Most DNA is located in the cell nucleus
Cell Cycle Control by Oncogenes and Tumor Suppressors: Driving the Transformation of Normal Cells into Cancerous Cells
Cell Cycle Control by Oncogenes and Tumor Suppressors: Driving the Transformation of Normal Cells into Cancerous Cells By: Amy Y. Chow, Ph.D. (Division of Tumor Cell Biology, Beckman Research Institute,
EBV infection B cells and lymphomagenesis. Sridhar Chaganti
EBV infection B cells and lymphomagenesis Sridhar Chaganti How EBV infects B-cells How viral genes influence the infected B cell Differences and similarities between in vitro and in vivo infection How
Bacteriophage Reproduction
Bacteriophage Reproduction Lytic and Lysogenic Cycles The following information is taken from: http://student.ccbcmd.edu/courses/bio141/lecguide/unit3/index.html#charvir Bacteriophage Structure More complex
Test Bank for Robbins and Cotran Pathologic Basis of Disease 9th Edition by Kumar
Link full download: http://testbankair.com/download/test-bank-for-robbins-cotran-pathologic-basis-of-disease-9th-edition-bykumar-abbas-and-aster Test Bank for Robbins and Cotran Pathologic Basis of Disease
Objectives. Morphology and IHC. Flow and Cyto FISH. Testing for Heme Malignancies 3/20/2013
Molecular Markers in Hematologic Malignancy: Ways to locate the needle in the haystack. Objectives Review the types of testing for hematologic malignancies Understand rationale for molecular testing Marcie
Viruses. Rotavirus (causes stomach flu) HIV virus
Viruses Rotavirus (causes stomach flu) HIV virus What is a virus? A virus is a microscopic, infectious agent that may infect any type of living cell. Viruses must infect living cells in order to make more
Chapter 16 Mutations. Practice Questions:
Biology 234 J. G. Doheny Chapter 16 Mutations Practice Questions: Answer the following questions with one or two sentences. 1. List the name of one test that can be used to identify mutagens. 2. What is
Dr Rodney Itaki Lecturer Anatomical Pathology Discipline. University of Papua New Guinea School of Medicine & Health Sciences Division of Pathology
Neoplasia Dr Rodney Itaki Lecturer Anatomical Pathology Discipline University of Papua New Guinea School of Medicine & Health Sciences Division of Pathology General Considerations Overview: Neoplasia uncontrolled,
LESSON 4.6 WORKBOOK. Designing an antiviral drug The challenge of HIV
LESSON 4.6 WORKBOOK Designing an antiviral drug The challenge of HIV In the last two lessons we discussed the how the viral life cycle causes host cell damage. But is there anything we can do to prevent
Cell cycle, signaling to cell cycle, and molecular basis of oncogenesis
Cell cycle, signaling to cell cycle, and molecular basis of oncogenesis MUDr. Jiří Vachtenheim, CSc. CELL CYCLE - SUMMARY Basic terminology: Cyclins conserved proteins with homologous regions; their cellular
BioSci 145A Lecture 15 - Oncogenes and Cancer
BioSci 145A Lecture 15 - Oncogenes and Cancer Topics we will cover today Introduction to normal and cancer cells Characteristics of cells in culture Cancerous changes in cells Viruses can harbor transforming
Emerging" hallmarks of cancer, a. Reprogramming of energy metabolism b. Evasion of the immune system, Enabling characteristics, a.
HALLMARKS OF CANCER - Together dictate the malignant phenotype. 1. Self-sufficiency in growth signals 2. Insensitivity to growth inhibitory signals 3. Evasion of cell death 4. Limitless replicative potential
19/06/2013. Viruses are not organisms (do not belong to any kingdom). Viruses are not made of cells, have no cytoplasm, and no membranes.
VIRUSES Many diseases of plants and animals are caused by bacteria or viruses that invade the body. Bacteria and viruses are NOT similar kinds of micro-organisms. Bacteria are classified as living organisms,
Julianne Edwards. Retroviruses. Spring 2010
Retroviruses Spring 2010 A retrovirus can simply be referred to as an infectious particle which replicates backwards even though there are many different types of retroviruses. More specifically, a retrovirus
1. Virus 2. Capsid 3. Envelope
VIRUSES BIOLOGY II VOCABULARY- VIRUSES (22 Words) 1. Virus 2. Capsid 3. Envelope 4. Provirus 5. Retrovirus 6. Reverse transcriptase 7. Bacteriophage 8. Lytic Cycle 9. Virulent 10. Lysis 11. Lysogenic Cycle
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the author to give readers additional information about his work. Supplement to: Croce CM. Oncogenes and cancer. N Engl J Med 2008;358:502-11.
7.012 Quiz 3 Answers
MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel Friday 11/12/04 7.012 Quiz 3 Answers A > 85 B 72-84
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
Cancer and Tyrosine Kinase Inhibition
Cancer and Tyrosine Kinase Inhibition 1 Motivation (1) In first world countries cancer is the second most common cause of death after cardiovascular diseases. For most tumors, treatment is limited to surgery,
Chapter 18. Viral Genetics. AP Biology
Chapter 18. Viral Genetics 2003-2004 1 A sense of size Comparing eukaryote bacterium virus 2 What is a virus? Is it alive? DNA or RNA enclosed in a protein coat Viruses are not cells Extremely tiny electron
Herpesviruses. Virion. Genome. Genes and proteins. Viruses and hosts. Diseases. Distinctive characteristics
Herpesviruses Virion Genome Genes and proteins Viruses and hosts Diseases Distinctive characteristics Virion Enveloped icosahedral capsid (T=16), diameter 125 nm Diameter of enveloped virion 200 nm Capsid
UC Berkeley Berkeley Scientific Journal
UC Berkeley Berkeley Scientific Journal Title Can A Virus Cause Cancer: A Look Into The History And Significance Of Oncoviruses Permalink https://escholarship.org/uc/item/6c57612p Journal Berkeley Scientific
Prof. R. V. Skibbens
Prof. R. V. Skibbens December 2, 2011 BIOS 10: BioScience in the 21 st Century Cell Cycle, Cell Division and Cancer (Part 2) Directionality The Cell Cycle clock goes in only one direction S-phase cells
Genetics and Cancer Ch 20
Genetics and Cancer Ch 20 Cancer is genetic Hereditary cancers Predisposition genes Ex. some forms of colon cancer Sporadic cancers ~90% of cancers Descendants of cancerous cells all cancerous (clonal)
SECTION 25-1 REVIEW STRUCTURE. 1. The diameter of viruses ranges from about a. 1 to 2 nm. b. 20 to 250 nm. c. 1 to 2 µm. d. 20 to 250 µm.
SECTION 25-1 REVIEW STRUCTURE VOCABULARY REVIEW Define the following terms. 1. virus 2. capsid 3. retrovirus 4. viroid 5. prion MULTIPLE CHOICE Write the correct letter in the blank. 1. The diameter of