Concomitant Gain of Function of Notch and Loss of p53 Signalling trigger an EMT Like Programme Driving Metastatic Intestinal Cancers

Size: px
Start display at page:

Download "Concomitant Gain of Function of Notch and Loss of p53 Signalling trigger an EMT Like Programme Driving Metastatic Intestinal Cancers"

Transcription

1 8 AVRIl Avril 2015 Concomitant Gain of Function of Notch and Loss of p53 Signalling trigger an EMT Like Programme Driving Metastatic Intestinal Cancers Daniel LOUVARD UMR 144 / CNRS - Institut Curie Laboratoire de Morphogénèse et Signalisation Cellulaires

2

3 Notch signaling in intestinal Cancers Somatic mutation APC, b-catenin ADN methylation K-ras DCC Src? p53 other alterations cmet, Src, Fascin? normal epithelium Hyperproliferative epithelium early adenoma intermediate adenoma late adenoma carcinoma metastasis APC Notch activation but no mutation unlike other tumors Images from Dr. C. Rosty, Institut Curie modified from Fearon and Vogelstein, 1990

4 A simplified view of the NOTCH signaling pathway Delta Jagged NOTCH RBP-Jk HES, HERT differentiation g-secretase proliferation apoptosis

5 Notch signaling in normal gut development Constitutive Activation of Notch, Nic (gain of fonction) Inhibition of Notch (loss of fonction) increased proliferation severe reduction of all three secretory types no proliferation the intestinal epithelium is almost exclusively composed of goblet cells Differentiation Gain of function Nic Loss of function Notch Fre et al, Nature, 2005 Proliferation Van Es et al, Nature, 2005

6 Construction of mouse models of intestinal cancers Inducible and tissue specific expression of transgene(s) in the proliferative compartment of the adult intestinal mucosa with the Villin gene promoter

7 Villin, an actin bundler in intestinal microvilli Villin Restricted cellular expression: Intestines, kidney proximal tubule Concentrated in the brush border Bundles, nucleates, caps and severs actin microfilaments Remains expressed during intestinal carcinogenesis Genomic structure and gene regulatory sequences identified 100µm

8 Inducible transgene expression in intestinal stem cells pvill/creer T2 /Rosa26 + TAM In absence of Tam Tam j + 5 Tam j + 60 pvill Cre X b-gal OFF Tamoxifen Cre pvill Cre b-gal ON b-gal Targeting to the stem cell compartment: b-gal staining maintained longer than 12 months

9 Crosstalks between major signaling pathways in CCR Notch Wnt Ras Nic/Apc +/1638N Apc +/1638N /K-ras V12G Fre et al. PNAS, 2009 Janssen et al Gastroenterology, 2006 These 2 models lead to tumor initiation but incomplete tumor progression, in particular no metastasis to distant organs

10 Can we built a mouse model of intestinal cancer with invasive properties? M.Chanrion et al Nature Comm We hypothesized that EMT is a prerequisite to initiate the onset of metastasis 2-We develop a system biology approach to reconstruct signalling networks allowing to predict the onset of an EMT-like phenotype. In collaboration with the SysBio team. Department of Bioinformatic, Institut Curie

11 Epithelial Mesenchymal Transition EMT is a process during development by which polarized epithelial cell acquire mesenchymal cell phenotype : enhanced migratory capacity, invasiveness, elevated resistance to apoptosis, increased production of ECM components EMT is involved in normal embryological processes: Gastrulation Neural crest formation Heart morphogenesis EMT-like is induced in adult pathological processes: Fibrosis Inflammation Cancer Kalluri et al., 2009

12 Building an Atlas of Cancer signaling networks D.Hannahan,R.Weinberg Assemble Formalize Visualize Exchange Analyze

13 NOTCH-p53-Wnt interactome etwork Notch-p53-Wnt map : 10 mirnas 13 phenotypes 77 RNAs 86 genes 122 proteins 397 reactions 406 species 135curated references

14 Main predictions from the System Biology analysis: In Notch activated mice, * activation of EMT-like program is prevented by p53 In p53 null mice, * activation of EMT-like program is partially prevented by p63. In Notch/p53 mice * activation of an EMT-like program is on EMT program is activated only when the 5 key EMT inducers (Snail1, Slug, Zeb1, Zeb2, and Twist1) are turned ON p53 loss of function and Notch gain of function have a synergistic effect on the onset of an EMT-like phenotype EMT inducers stimulate Wnt pathway through b-catenin activation

15

16 ?

17 Crosstalks between major signaling pathways in CCR Notch Wnt Ras Nic/Apc +/1638N NO Metastasis K-ras V12G /Apc +/1638N Fre et al. PNAS, 2009 Janssen et al Gastroenterology, 2006 Adenoma p53 p53 Invasion Adenocarcinoma Nic/p53 Metastasis

18 Construction of the inducible Nic/p53 mouse model pvill/creer T2 / Nic/ p53 -/- loxp pvill Cre + Tamoxifen loxp p53- IRES NOTCH p53 -/- NIC GFP Does it lead to an invasive phenotype : onset of EMT-like? El Marjou et al., 2004 Murtaugh et al., 2003 Jonkers et al., 2001 Chanrion et al 2014

19 Survival Curves 1 survival (%) 0,8 0,6 0,4 0,2 Np53 P53 N Time after Tamoxifen induction (month)

20 % animals w/tumors Tumor Intake 120 Tumor intake after Tam injection Np53 p53 N m 5-7m 7-9m 9-11m 11-13m 13-15m 15-18m + de 18m Time after Tam. injection (month)

21 Primary Tumors in the N/p53 -/- Mucosa Muscularis Mucosa Submucosa Muscularis Serosa

22 Ex Vivo analysis using two photons microscopy on slices of live tumor samples

23 H&E and GFP stainings on N/p53-/- tumors Invasive ADK 96% Lymph Node invasion 23% Liver metastasis 10% Peritoneum met. 50% Nuclear GFP staining allows tracking of epithelial tumor cell dissemination

24 Alteration of the Wnt pathway in N/p53 -/- Normal Gut Invasive ADK Lymph Node Liver Peritoneum Nuclear beta catenin staining

25 E-CAD Pan CK Vimentin SMA SNAIL SLUG TWIST ZEB1

26 Evidence for an EMT-like phenotype in desmoplasic tumor N/p53-/- ZEB1-GFP-ECAD--DAPI

27 Stroma Desmoplasic area Bulk Phenotypic changes induced in N/p53-/- primary tumors GFP DAPI ECAD ZEB Epithelial cell EMT-1 ph EMT-2 ph Mesenchymal cell

28

29 Characterization of Nic/p53 mouse model Induction of the EMT-like process in the NN;p53 Relevance for Human CCR

30 Notch activation and Zeb1 expression in the desmosplastic area of invasive human colon ADK Normal Bulk Desmoplastic area Nicd Zeb1

31

32 The activity scores computed for the Notch, p53 and Wnt pathways in human colon cancer samples from Tumour Cancer Genome Atlas data set.

33 Concluding remarks

34 SysBio team Emmanuel Barillot, Andrei Zynovyev Inna Kuperstein David Cohen Loredana Martignetti Curie Hospitals Daniel Louvard team Sylvie Robine Maia Chanrion Fatima El Marjou Cédric Barrière Lev Stimmer Jeanne Netter Silvina Dos Reis Tavares Silvia Fre Mathilde Huyghe Danijela Vignjevic Wulfran Cacheux Didier Meseure (Institut Curie-St Cloud) Yvan Bieche (Institut Curie-St Cloud) Animal Facility Virginie Dangles-Marie Stéphanie Boissel Isabelle Grandjean Imaging Facility Olivier Renaud Olivier Leroy Tristan Piolot Lucie Sengmanivong

Cancer Biology Course. Invasion and Metastasis

Cancer Biology Course. Invasion and Metastasis Cancer Biology Course Invasion and Metastasis 2016 Lu-Hai Wang NHRI Cancer metastasis Major problem: main reason for killing cancer patients, without it cancer can be cured or controlled. Challenging questions:

More information

Mechanotransductive Activation of the Tumorigenic b-catenin Pathway in Colon Cancer progression

Mechanotransductive Activation of the Tumorigenic b-catenin Pathway in Colon Cancer progression Mechanotransductive Activation of the Tumorigenic b-catenin Pathway in Colon Cancer progression Mechanosensitivity of the b-cat pathway in the mechanical induction of mesoendoderm specification of gastrulating

More information

Summary and Concluding Remarks

Summary and Concluding Remarks Summary and Concluding Remarks Chapter 6 The intestinal epithelium provides an excellent model system for investigating molecular mechanisms regulating cell lineage establishment, stem cell proliferation,

More information

Cancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz

Cancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz Cancer and Oncogenes Bioscience in the 21 st Century Linda Lowe-Krentz December 1, 2010 Just a Few Numbers Becoming Cancer Genetic Defects Drugs Our friends and family 25 More mutations as 20 you get older

More information

ROLE OF TGF-BETA SIGNALING IN PIK3CA-

ROLE OF TGF-BETA SIGNALING IN PIK3CA- ROLE OF TGF-BETA SIGNALING IN - DRIVEN HEAD AND NECK CANCER INVASION AND METASTASIS 1,2 Sophia Bornstein, 3 Jingping Shen, 3 Jacob Minor, 3 Frank Hall, 3 Fang Zhang, 4 Sherif Said, 4 Xiao-Jing Wang, 1

More information

Physiological and pathological properties of EMTassociated

Physiological and pathological properties of EMTassociated Physiological and pathological properties of EMTassociated plasticity Stéphane Ansieau Inserm UMR 1050, CNRS UMR 8256 Centre de Recherche en Cancérologie de Lyon, France EMT: a reversible phenotypic and

More information

Neoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath

Neoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath Neoplasia 18 lecture 8 Dr Heyam Awad MD, FRCPath ILOS 1. understand the angiogenic switch in tumors and factors that stimulate and inhibit angiogenesis. 2. list the steps important for tumor metastasis

More information

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the

More information

Mechanotransductive Activation of b-catenin: from Mesoderm Evolutionary Emergence to Cancer Progression

Mechanotransductive Activation of b-catenin: from Mesoderm Evolutionary Emergence to Cancer Progression Mechanotransductive Activation of b-catenin: from Mesoderm Evolutionary Emergence to Cancer Progression I- Evolutionary implication in mechanotransduction in mesoderm origins, 600 millions years ago II-

More information

Fundamental research on breast cancer in Belgium. Rosita Winkler

Fundamental research on breast cancer in Belgium. Rosita Winkler Fundamental research on breast cancer in Belgium Rosita Winkler Medline search for «breast cancer» and Belgium limits: english, posted in the last 5 years. Result: 484 papers - fundamental / clinical -

More information

From crypt stem cell to colorectal cancer

From crypt stem cell to colorectal cancer 19 3 2007 6 Chinese Bulletin of Life Sciences Vol. 19, No. 3 Jun., 2007 1004-0374(2007)03-0321-05 ( 510405) Wnt Notch BMP R735.35; R730.21 A From crypt stem cell to colorectal cancer WEN Bin*, CHEN Weiwen

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2610 Figure S1 FSMCs derived from MSLN CLN transgenic mice express smooth muscle-specific proteins. Beta-galactosidase is ubiquitously expressed within cultured FSMCs derived from MSLN

More information

Colorectal adenocarcinoma leading cancer in developed countries In US, annual deaths due to colorectal adenocarcinoma 57,000.

Colorectal adenocarcinoma leading cancer in developed countries In US, annual deaths due to colorectal adenocarcinoma 57,000. Colonic Neoplasia Remotti Colorectal adenocarcinoma leading cancer in developed countries In US, annual incidence of colorectal adenocarcinoma 150,000. In US, annual deaths due to colorectal adenocarcinoma

More information

CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent

CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION Stathmin in Prostate Cancer Development and Progression Androgen deprivation therapy is the most used treatment of de novo or recurrent metastatic PCa.

More information

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic

More information

VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer

VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer VIII Curso Internacional del PIRRECV Some molecular mechanisms of cancer Laboratorio de Comunicaciones Celulares, Centro FONDAP Estudios Moleculares de la Celula (CEMC), ICBM, Facultad de Medicina, Universidad

More information

Development of Carcinoma Pathways

Development of Carcinoma Pathways The Construction of Genetic Pathway to Colorectal Cancer Moriah Wright, MD Clinical Fellow in Colorectal Surgery Creighton University School of Medicine Management of Colon and Diseases February 23, 2019

More information

Targeting the cgmp Pathway to Treat Colorectal Cancer

Targeting the cgmp Pathway to Treat Colorectal Cancer Thomas Jefferson University Jefferson Digital Commons Department of Pharmacology and Experimental Therapeutics Faculty Papers Department of Pharmacology and Experimental Therapeutics 29 Targeting the cgmp

More information

Biochemistry of Carcinogenesis. Lecture # 35 Alexander N. Koval

Biochemistry of Carcinogenesis. Lecture # 35 Alexander N. Koval Biochemistry of Carcinogenesis Lecture # 35 Alexander N. Koval What is Cancer? The term "cancer" refers to a group of diseases in which cells grow and spread unrestrained throughout the body. It is difficult

More information

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize? 1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

Table S1. Reclassification of 5-year risk of all-cause mortality among colorectal cancer patients by continuous E-cadherin (n=188)

Table S1. Reclassification of 5-year risk of all-cause mortality among colorectal cancer patients by continuous E-cadherin (n=188) Diagnostic Accuracy and Prediction Increment of Markers of Epithelial-Mesenchymal Transition to Assess Cancer Cell Detachment from Primary Tumors BMC Cancer Evan L. Busch, Prabhani Kuruppumullage Don,

More information

Cell Polarity and Cancer

Cell Polarity and Cancer Cell Polarity and Cancer Pr Jean-Paul Borg Email: jean-paul.borg@inserm.fr Features of malignant cells Steps in Malignant Progression Cell polarity, cell adhesion, morphogenesis and tumorigenesis pathways

More information

EMT: Epithelial Mesenchimal Transition

EMT: Epithelial Mesenchimal Transition EMT: Epithelial Mesenchimal Transition A phenotypic change that is characteristic of some developing tissues and certain forms of cancer. This is a multistep, key process in embryonic development and metastasis

More information

number Done by Corrected by Doctor Maha Shomaf

number Done by Corrected by Doctor Maha Shomaf number 21 Done by Ahmad Rawajbeh Corrected by Omar Sami Doctor Maha Shomaf Ability to Invade and Metastasize The metastatic cascade can be subdivided into two phases: 1-invasion of ECM and vascular dissemination:

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Gastric Cancer Staging AJCC eighth edition. Duncan McLeod Westmead Hospital, NSW

Gastric Cancer Staging AJCC eighth edition. Duncan McLeod Westmead Hospital, NSW Gastric Cancer Staging AJCC eighth edition Duncan McLeod Westmead Hospital, NSW Summary of changes New clinical stage prognostic groups, ctnm Postneoadjuvant therapy pathologic stage groupings, yptnm -

More information

Characterization of Epithelial Cells

Characterization of Epithelial Cells EPITHELIAL BIOLOGY Characterization of Epithelial Cells Gabriela Rodrigues Dept. Animal Biology Faculty of Sciences University of Lisboa Centre for Environmental Biology 2-6 July 2007 Gulbenkian Institute

More information

Tumor microenvironment Interactions and Lung Cancer Invasiveness. Pulmonary Grand Rounds Philippe Montgrain, M.D.

Tumor microenvironment Interactions and Lung Cancer Invasiveness. Pulmonary Grand Rounds Philippe Montgrain, M.D. Tumor microenvironment Interactions and Lung Cancer Invasiveness Pulmonary Grand Rounds Philippe Montgrain, M.D. February 26, 2009 Objectives Review epithelial mesenchymal transition (EMT), and its implications

More information

The Hallmarks of Cancer

The Hallmarks of Cancer The Hallmarks of Cancer Theresa L. Hodin, Ph.D. Clinical Research Services Theresa.Hodin@RoswellPark.org Hippocrates Cancer surgery, circa 1689 Cancer Surgery Today 1971: Nixon declares War on Cancer

More information

Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and

Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast

More information

Inflammatory Cells and Metastasis

Inflammatory Cells and Metastasis Inflammatory Cells and Metastasis Experimentelle Krebsforschung SS 07 Gerhard Christofori Institute of Biochemistry and Genetics Department of Clinical-Biological Sciences Center of Biomedicine University

More information

Neoplasia 18 lecture 6. Dr Heyam Awad MD, FRCPath

Neoplasia 18 lecture 6. Dr Heyam Awad MD, FRCPath Neoplasia 18 lecture 6 Dr Heyam Awad MD, FRCPath ILOS 1. understand the role of TGF beta, contact inhibition and APC in tumorigenesis. 2. implement the above knowledge in understanding histopathology reports.

More information

The Effect of Inflammation on Stem Cell Mutagenesis and Carcinogenesis Induced by Azoxymethane in Wild type and Immune Compromised Mice

The Effect of Inflammation on Stem Cell Mutagenesis and Carcinogenesis Induced by Azoxymethane in Wild type and Immune Compromised Mice The Effect of Inflammation on Stem Cell Mutagenesis and Carcinogenesis Induced by Azoxymethane in Wild type and Immune Compromised Mice by Ryan Daniel Whetstone Chemistry B.A., West Virginia University,

More information

In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG)

In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) 1 Dr Saeb Aliwaini 13/11/2015 Migration in vivo Primary tumors are responsible for only about 10%

More information

Cancer Biology Dynamical Cell Systems

Cancer Biology Dynamical Cell Systems The Institute of Cancer Research PHD STUDENTSHIP PROJECT PROPOSAL PROJECT DETAILS Project Title: SUPERVISORY TEAM Primary Supervisor: The forces behind pancreatic cancer; and changing them as a therapeutic

More information

James C. Fleet, PhD Professor Dept of Nutrition Science Purdue University

James C. Fleet, PhD Professor Dept of Nutrition Science Purdue University James C. Fleet, PhD Professor Dept of Nutrition Science Purdue University Overview What are we trying to model? Vitamin D biology Cancer Is there in vivo proof of principle for vitamin D/cancer relationship?

More information

Cancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz October 11, 2013

Cancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz October 11, 2013 Cancer and Oncogenes Bioscience in the 21 st Century Linda Lowe-Krentz October 11, 2013 Just a Few Numbers Becoming Cancer Genetic Defects Drugs Our friends and family 200 180 160 140 120 100 80 60 40

More information

Histopathology of Endoscopic Resection Specimens from Barrett's Esophagus

Histopathology of Endoscopic Resection Specimens from Barrett's Esophagus Histopathology of Endoscopic Resection Specimens from Barrett's Esophagus Br J Surg 38 oct. 1950 Definition of Barrett's esophagus A change in the esophageal epithelium of any length that can be recognized

More information

The Beauty of the Skin

The Beauty of the Skin The Beauty of the Skin Rose-Anne Romano, Ph.D Assistant Professor Department of Oral Biology School of Dental Medicine State University of New York at Buffalo The Big Question How do approximately 50 trillion

More information

A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications

A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications Yasuo Urata CEO and President Oncolys BioPharma Inc. February 16, 2013 Telomere Length is a Limiting Factor for Cell Replication

More information

mirna Dr. S Hosseini-Asl

mirna Dr. S Hosseini-Asl mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region

More information

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA

More information

Supporting Information

Supporting Information Supporting Information Vaira et al. 10.1073/pnas.0907676107 0h 24h 48h PTEN pathway Expression 0h 24h 48h Time MAP Kinase Signaling Pathway Expression 0h 24h 48h Time Collagen Expression Fig. S1. Differential

More information

SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer.

SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Supplementary Figure 1 SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Scatter plots comparing expression profiles of matched pretreatment

More information

Enterprise Interest Nothing to declare

Enterprise Interest Nothing to declare Enterprise Interest Nothing to declare Update of mixed tumours of the GI tract, the pancreas and the liver Introduction to the concept of mixed tumours and clinical implication Jean-Yves SCOAZEC Surgical

More information

Foxm1 Transcription Factor is Required for Lung Fibrosis and Epithelial to Mesenchymal Transition.

Foxm1 Transcription Factor is Required for Lung Fibrosis and Epithelial to Mesenchymal Transition. Manuscript EMBO-2012-82682 Foxm1 Transcription Factor is Required for Lung Fibrosis and Epithelial to Mesenchymal Transition. David Balli, Vladimir Ustiyan, Yufang Zhang, I-Ching Wang, Alex J. Masino,

More information

Mitosis. Single Nano Micro Milli Macro. Primary. PCNA expression

Mitosis. Single Nano Micro Milli Macro. Primary. PCNA expression a b c DAPI YFP CC3 DAPI YFP PCNA DAPI YFP ph3 DAPI YFP KI67 e 6 Mitosis f 1 PCNA expression %ph3 + /YFP + n= 63 87 61 3 13 8 n= 15 3 9 1 5 %PCNA+/YFP+ 8 6 Supplementary Figure 1. Proliferation/apoptosis

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION b 350 300 250 200 150 100 50 0 E0 E10 E50 E0 E10 E50 E0 E10 E50 E0 E10 E50 Number of organoids per well 350 300 250 200 150 100 50 0 R0 R50 R100 R500 1st 2nd 3rd Noggin 100 ng/ml Noggin 10 ng/ml Noggin

More information

Interactions between cancer stem cells and their niche govern metastatic colonization

Interactions between cancer stem cells and their niche govern metastatic colonization Correction Interactions between cancer stem cells and their niche govern metastatic colonization Ilaria Malanchi, Albert Santamaria-Martínez, Evelyn Susanto, Hong Peng, Hans-Anton Lehr, Jean-Francois Delaloye

More information

3 rd course on BREAST CANCER: FROM CLINICS TO BIOLOGY June 19-23, 2017 Institut Curie - Training Unit - International Course

3 rd course on BREAST CANCER: FROM CLINICS TO BIOLOGY June 19-23, 2017 Institut Curie - Training Unit - International Course 08/03/2017 Monday, june 19 th : Clinical management Chair: Roman Rouzier 10:15 Training Unit Welcome: practical aspects & coffee 10:30 11:15 11:15 11:45 Anne Vincent-Salomon & Roman Rouzier Mathilde His

More information

ONCOLOGY. Csaba Bödör. Department of Pathology and Experimental Cancer Research november 19., ÁOK, III.

ONCOLOGY. Csaba Bödör. Department of Pathology and Experimental Cancer Research november 19., ÁOK, III. ONCOLOGY Csaba Bödör Department of Pathology and Experimental Cancer Research 2018. november 19., ÁOK, III. bodor.csaba1@med.semmelweis-univ.hu ONCOLOGY Characteristics of Benign and Malignant Neoplasms

More information

A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.

A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195. pstat3 75 Pan CK A A263 A352 A24 B Columns 1-6 Positive control A195 A22 A24 A183 Rectal Nodule STAT3 pstat3 STAT3 pstat3 Columns 7-12 Omentum Rectosigmoid Left Ovary Right Ovary Omentum Uterus Uterus

More information

Therapeutic implications of cancer stem cells. Cédric Blanpain, MD, PhD Laboratory of stem cells and cancer WELBIO, Université Libre de Bruxelles

Therapeutic implications of cancer stem cells. Cédric Blanpain, MD, PhD Laboratory of stem cells and cancer WELBIO, Université Libre de Bruxelles Therapeutic implications of cancer stem cells Cédric Blanpain, MD, PhD Laboratory of stem cells and cancer WELBIO, Université Libre de Bruxelles Stem cell properties Differentiation Self-renewal Tumor

More information

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AWARD NUMBER: W81XWH-13-1-0184 TITLE: In Vivo Tagging of Lung Epithelial Cells To Define the Early Steps of Tumor Cell Dissemination PRINCIPAL INVESTIGATOR: Hasmeena Kathuria, MD CONTRACTING ORGANIZATION:

More information

Carcinogenesis in IBD

Carcinogenesis in IBD Oxford Inflammatory Bowel Disease MasterClass Carcinogenesis in IBD Dr Simon Leedham, Oxford, UK Oxford Inflammatory Bowel Disease MasterClass Carcinogenesis in Inflammatory Bowel Disease Dr Simon Leedham

More information

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,

More information

Mathematics and Physics of Cancer: Questions. Robijn Bruinsma, UCLA KITP Colloquium May 6, ) Cancer statistics and the multi-stage model.

Mathematics and Physics of Cancer: Questions. Robijn Bruinsma, UCLA KITP Colloquium May 6, ) Cancer statistics and the multi-stage model. Mathematics and Physics of Cancer: Questions Robijn Bruinsma, UCLA KITP Colloquium May 6, 2009 1) Cancer statistics and the multi-stage model. 2) Cancer microevolution and clonal expansion. 3) Metastasis:

More information

Atlas of Cancer Signaling Networks (ACSN) and NaviCell are user- friendly web- based environments for integra)ve systems biology of cancer

Atlas of Cancer Signaling Networks (ACSN) and NaviCell are user- friendly web- based environments for integra)ve systems biology of cancer Atlas of Cancer Signaling Networks (ACSN) and NaviCell are user- friendly web- based environments for integra)ve systems biology of cancer Inna Kuperstein Computa)onal Systems Biology of Cancer U900 Ins)tut

More information

Supplemental Table S1

Supplemental Table S1 Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected

More information

Supplemental Figure 1: Lrig1-Apple expression in small intestine. Lrig1-Apple is observed at the crypt base and in insterstial cells of Cajal, but is

Supplemental Figure 1: Lrig1-Apple expression in small intestine. Lrig1-Apple is observed at the crypt base and in insterstial cells of Cajal, but is Supplemental Figure 1: Lrig1-Apple expression in small intestine. Lrig1-Apple is observed at the crypt base and in insterstial cells of Cajal, but is not co-expressed in DCLK1-positive tuft cells. Scale

More information

Neoplasia part I. Dr. Mohsen Dashti. Clinical Medicine & Pathology nd Lecture

Neoplasia part I. Dr. Mohsen Dashti. Clinical Medicine & Pathology nd Lecture Neoplasia part I By Dr. Mohsen Dashti Clinical Medicine & Pathology 316 2 nd Lecture Lecture outline Review of structure & function. Basic definitions. Classification of neoplasms. Morphologic features.

More information

يراهظلا( يئلاطلا جيسنلا

يراهظلا( يئلاطلا جيسنلا Epithelium النسيج الطالئي )الظهاري( Features of Epithelium Epithelium occurs in the body as a sheet of cells that covers a body surface, lines a cavity, or forms a gland. Coverings, linings, glands. Derived

More information

Microarray Analysis and Liver Diseases

Microarray Analysis and Liver Diseases Microarray Analysis and Liver Diseases Snorri S. Thorgeirsson M.D., Ph.D. Laboratory of Experimental Carcinogenesis Center for Cancer Research, NCI, NIH Application of Microarrays to Cancer Research Identifying

More information

Mario Giuliano Trieste Novembre 2015

Mario Giuliano Trieste Novembre 2015 Mario Giuliano Trieste 20-21 Novembre 2015 Metastatic Cascade Main Actors A small fraction of cells detaching from primary tumors end up forming metastatic lesions. 1 0 Tumor Circulating Tumor Cells (CTCs)

More information

Matrix metalloproteinase 1 and circulating tumor cells in early breast cancer.

Matrix metalloproteinase 1 and circulating tumor cells in early breast cancer. National Cancer Institute Slovakia Translational Research Unit Slovakia Matrix metalloproteinase 1 and circulating tumor cells in early breast cancer. Mego M 1, 2, Karaba M 2, Cierna Z 1, Janega P 1, Minarik

More information

University Journal of Pre and Para Clinical Sciences

University Journal of Pre and Para Clinical Sciences ISSN 2455 2879 Volume 2 Issue 1 2016 Metaplastic carcinoma breast a rare case report Abstract : Metaplastic carcinoma of the breast is a rare malignancy with two distinct cell lines described as a breast

More information

Is ALS a multistep process?

Is ALS a multistep process? Is ALS a multistep process? Neil Pearce, London School of Hygiene and Tropical Medicine Ammar Al-Chalabi, Institute of Psychiatry, King s College London Zoe Rutter-Locher, King s College London Is ALS

More information

Nature Methods: doi: /nmeth Supplementary Figure 1

Nature Methods: doi: /nmeth Supplementary Figure 1 Supplementary Figure 1 Finite-element analysis of cell cluster dynamics in different cluster trap architectures. (a) Cluster-Chip (b) Filter (c) A structure identical to the Cluster-Chip except that one

More information

Triple Negative Breast Cancer

Triple Negative Breast Cancer Triple Negative Breast Cancer Prof. Dr. Pornchai O-charoenrat Division of Head-Neck & Breast Surgery Department of Surgery Faculty of Medicine Siriraj Hospital Breast Cancer Classification Traditional

More information

malignant polyp Daily Challenges in Digestive Endoscopy for Endoscopists and Endoscopy Nurses BSGIE Annual Meeting 18/09/2014 Mechelen

malignant polyp Daily Challenges in Digestive Endoscopy for Endoscopists and Endoscopy Nurses BSGIE Annual Meeting 18/09/2014 Mechelen Plan Incidental finding of a malignant polyp 1. What is a polyp malignant? 2. Role of the pathologist and the endoscopist 3. Quantitative and qualitative risk assessment 4. How to decide what to do? Hubert

More information

Mody. AIS vs. Invasive Adenocarcinoma of the Cervix

Mody. AIS vs. Invasive Adenocarcinoma of the Cervix Common Problems in Gynecologic Pathology Michael T. Deavers, M.D. Houston Methodist Hospital, Houston, Texas Common Problems in Gynecologic Pathology Adenocarcinoma in-situ (AIS) of the Cervix vs. Invasive

More information

TMA-VARESE COHORT-1 TMA-BERN COHORT-2

TMA-VARESE COHORT-1 TMA-BERN COHORT-2 Supplementary Figure 1 TMA-VARESE COHORT-1 TOTAL SAMPLES #5 GLEASON SCORE Number Percentage 6 16 32% = 7 17 34% >7 17 34% TUMOR STAGE T2C 28 56% T3A- 21 42% T3C-T4 1 2% NODE STATUS N 42 84% N1 8 16% PSA

More information

Impact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice

Impact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice Impact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice Shinichi Hosokawa 1,3,Kenichiro Furuyama 1,3, Masashi Horiguchi 1,3,Yoshiki

More information

Contents 1 The Windows of Susceptibility to Breast Cancer 2 The So Called Pre-Neoplastic Lesions and Carcinoma In Situ

Contents 1 The Windows of Susceptibility to Breast Cancer 2 The So Called Pre-Neoplastic Lesions and Carcinoma In Situ Contents 1 The Windows of Susceptibility to Breast Cancer... 1 1.1 Introduction... 1 1.2 Risk Factor and Etiological Agents... 2 1.3 The Concept of the Windows of Susceptibility to Carcinogenesis... 5

More information

Supplementary Material

Supplementary Material Supplementary Material Fig. S1. Gpa33 -/- mice do not express Gpa33 mrna or GPA33 protein. (A) The Gpa33 null allele contains a premature translational stop codon (STOP) in exon 2, and almost all of the

More information

Characteristics of Cancer Stem Cells (CSCs)

Characteristics of Cancer Stem Cells (CSCs) GENReports: Market & Tech Analysis Characteristics of Cancer Stem Cells (CSCs) > Enal Razvi, Ph.D. Biotechnology Analyst, Managing Director Select Biosciences, Inc. enal@selectbio.us! Topic,IntroducEon,and,Scope!

More information

Update on staging colorectal carcinoma, the 8 th edition AJCC. General overview of staging. When is staging required? 11/1/2017

Update on staging colorectal carcinoma, the 8 th edition AJCC. General overview of staging. When is staging required? 11/1/2017 Update on staging colorectal carcinoma, the 8 th edition AJCC Dale C. Snover, MD November 3, 2017 General overview of staging Reason for uniform staging Requirements to use AJCC manual and/or CAP protocols

More information

Tumour Structure and Nomenclature. Paul Edwards. Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge

Tumour Structure and Nomenclature. Paul Edwards. Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge Tumour Structure and Nomenclature Paul Edwards Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge Malignant Metastasis Core idea of cancer Normal Cell Slightly

More information

Neoplasia 2018 Lecture 2. Dr Heyam Awad MD, FRCPath

Neoplasia 2018 Lecture 2. Dr Heyam Awad MD, FRCPath Neoplasia 2018 Lecture 2 Dr Heyam Awad MD, FRCPath ILOS 1. List the differences between benign and malignant tumors. 2. Recognize the histological features of malignancy. 3. Define dysplasia and understand

More information

Colonic polyps and colon cancer. Andrew Macpherson Director of Gastroentology University of Bern

Colonic polyps and colon cancer. Andrew Macpherson Director of Gastroentology University of Bern Colonic polyps and colon cancer Andrew Macpherson Director of Gastroentology University of Bern Improtance of the problem of colon cancers - Epidemiology Lifetime risk 5% Incidence/10 5 /annum (US Detroit

More information

Dynamic cohesin-mediated chromatin architecture controls epithelial mesenchymal plasticity in cancer

Dynamic cohesin-mediated chromatin architecture controls epithelial mesenchymal plasticity in cancer Article Dynamic cohesin-mediated chromatin architecture controls epithelial mesenchymal plasticity in cancer Jiyeon Yun,, Sang-Hyun Song, Hwang-Phill Kim, Sae-Won Han,, Eugene C Yi & Tae-You Kim,,, Abstract

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

Disorders of Cell Growth & Neoplasia. Histopathology Lab

Disorders of Cell Growth & Neoplasia. Histopathology Lab Disorders of Cell Growth & Neoplasia Histopathology Lab Paul Hanna April 2010 Case #84 Clinical History: 5 yr-old, West Highland White terrier. skin mass from axillary region. has been present for the

More information

Rath, N., and Olson, M. (2016) Regulation of pancreatic cancer aggressiveness by stromal stiffening. Nature Medicine, 22(5), pp. 462-463. There may be differences between this version and the published

More information

Liquid Biopsy: Implications for Cancer Staging & Therapy

Liquid Biopsy: Implications for Cancer Staging & Therapy Prof. Klaus Pantel, MD, PhD Institut für Tumorbiologie Liquid Biopsy: Implications for Cancer Staging & Therapy Tumor cell dissemination and cancer dormancy Primary tumor Local relapse Cancer cells disseminate

More information

The silence of the genes: clinical applications of (colorectal) cancer epigenetics

The silence of the genes: clinical applications of (colorectal) cancer epigenetics The silence of the genes: clinical applications of (colorectal) cancer epigenetics Manon van Engeland, PhD Dept. of Pathology GROW - School for Oncology & Developmental Biology Maastricht University Medical

More information

ANAT3231: lectures overview

ANAT3231: lectures overview ANAT3231: lectures overview Stem Cell Biology Stem Cell Technology Resources: http://php.med.unsw.edu.au/cell biology/ Essential Cell Biology 3 rd edition Alberts Dr Annemiek Beverdam School of Medical

More information

The Pathologist s Role in the Diagnosis and Management of Neoplasia in Barrett s Oesophagus Cian Muldoon, St. James s Hospital, Dublin

The Pathologist s Role in the Diagnosis and Management of Neoplasia in Barrett s Oesophagus Cian Muldoon, St. James s Hospital, Dublin The Pathologist s Role in the Diagnosis and Management of Neoplasia in Barrett s Oesophagus Cian Muldoon, St. James s Hospital, Dublin 24.06.15 Norman Barrett Smiles [A brief digression - Chair becoming

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Nature Biotechnology: doi: /nbt Supplementary Figure 1 Supplementary Figure 1 Overview of the transplant procedure and supplementary data to Figure 1. a. Under isofluorane anesthesia, the lumen of the colon is washed by a gentle PBS enema. b. Using a p200

More information

Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and

Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and exclude YAP from the nucleus. (a) Schematic diagram of an E10.5 mouse embryo. (b,c) Sections at B and C in (a)

More information

Wendy L Frankel. Chair and Distinguished Professor

Wendy L Frankel. Chair and Distinguished Professor 1 Wendy L Frankel Chair and Distinguished Professor Case 1 59 y/o woman Abdominal pain No personal or family history of cancer History of colon polyps Colonoscopy Polypoid rectosigmoid mass Biopsy 3 4

More information

Claudin-1 regulates cellular transformation and metastatic behavior in colon cancer

Claudin-1 regulates cellular transformation and metastatic behavior in colon cancer Research article Claudin-1 regulates cellular transformation and metastatic behavior in colon cancer Punita Dhawan, 1 Amar B. Singh, 2 Natasha G. Deane, 1,3 YiRan No, 1 Sheng-Ru Shiou, 1 Carl Schmidt,

More information

The Wnt/βcatenin signaling pathway

The Wnt/βcatenin signaling pathway Wnt signaling is crucial for functioning of the endometrium The Role of Wnt Signaling in Uterus Development (I) and in Homeostasis (II) and Malignancy (III) of the Uterine Endometrium Leen J Blok Erasmus

More information

A916: rectum: adenocarcinoma

A916: rectum: adenocarcinoma General facts of colorectal cancer The colon has cecum, ascending, transverse, descending and sigmoid colon sections. Cancer can start in any of the r sections or in the rectum. The wall of each of these

More information

Complex interplay between b-catenin signalling and Notch effectors in intestinal tumorigenesis

Complex interplay between b-catenin signalling and Notch effectors in intestinal tumorigenesis < Additional methods, figures and a table are published online only. To view these files please visit the journal online (http:// gut.bmj.com). 1 Department of Endocrinology, Metabolism and Cancer, Institut

More information

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

Islets of Langerhans consist mostly of insulin-producing β cells. They will appear to be densely labeled

Islets of Langerhans consist mostly of insulin-producing β cells. They will appear to be densely labeled Are adult pancreatic beta cells formed by self-duplication or stem cell differentiation? Introduction Researchers have long been interested in how tissues produce and maintain the correct number of cells

More information