Helicobacter pylori colonizes the human stomach and. Clinical Relevance of the caga, vaca, and icea Status of Helicobacter pylori

Transcription

1 GASTROENTEROLOGY 1998;115:58 66 Clinical Relevance of the caga, vaca, and icea Status of Helicobacter pylori LEEN JAN VAN DOORN,* CÉU FIGUEIREDO,*, RICARDO SANNA,* ANTON PLAISIER, PETER SCHNEEBERGER, WINK DE BOER, and WIM QUINT* *Delft Diagnostic Laboratory, Delft, The Netherlands; IPATIMUP, University of Porto, Portugal; Department of Public Health, Medical Faculty, Erasmus University, Rotterdam, The Netherlands; and Departments of Microbiology and Internal Medicine, Sint Anna Hospital, Oss, The Netherlands Background & Aims: Clinical outcome of Helicobacter pylori infection may be associated with specific virulence-associated bacterial genotypes. The aim of this study was to assess the relationships between H. pylori caga, vaca, and icea status and severity of disease. Methods: Gastric biopsy specimens from 94 patients in The Netherlands were analyzed by polymerase chain reaction and reverse hybridization. Results: caga was present in 63 (67%) of 94 cases and was associated with peptic ulcer disease (P ). vaca genotypes s1a/m1, s1a/m2, s1b/m1, s1b/m2, and s2/m2 were found in 36.2%, 23.4%, 2.1%, 5.3%, and 20.2%, respectively. Ten isolates (10.6%) contained multiple vaca genotypes. The presence of peptic ulcers was associated with type s1 strains (P ) but not with the m type (P ). caga and vaca s1 were strongly associated (P 10 5 ). icea1 was found in 53 (56.4%) and icea2 in 25 (26.6%) of the 94 cases. In 14 isolates (14.9%), both icea alleles were found, and 2 (2.1%) were negative for both icea1 and icea2. icea1 was also associated with peptic ulcer disease (P ). The icea allelic type was independent of the caga and vaca status. Conclusions: vaca s1, caga, and icea1 are markers of H. pylori strains that are more likely to lead to ulcer disease. Helicobacter pylori colonizes the human stomach and establishes long-term infection of the gastric and duodenal mucosa. 1 H. pylori infection induces gastritis and peptic ulcers and is associated with gastric carcinoma. 2 The genetic variability of H. pylori is high, and extreme heterogeneity among isolates has been shown by multilocus enzyme analysis, DNA fingerprinting, and restriction fragment length polymorphism. 3 5 Most studies assessed the variability of the bacterial genome in general. However, there is also evidence for the existence of distinct genetic lineages. Several genes have been identified that may play a role in the pathogenicity of H. pylori. 6 8 vaca encodes a vacuolating toxin that is excreted by H. pylori and damages epithelial cells The gene is present in all H. pylori strains and comprises two variable parts. 12,13 The s region (encoding the signal peptide) is located at the 5 end of the gene and exists as an s1 or s2 allele. Within type s1, several subtypes (s1a, s1b, and s1c) can be distinguished. 14 The m-region (middle) occurs as an m1 or m2 allele. The mosaic combination of s- and m-region allelic types determines the production of the cytotoxin and is thereby associated with pathogenicity of the bacterium. vaca s1/m1 strains produce a large amount of toxin, s1/m2 strains produce moderate amounts, and s2/m2 strains produce very little or no toxin. 13 vaca type s1a strains appear to be more pathogenic than s1b or s2 strains and are found more frequently in ulcer disease. vaca m1 type strains are associated with greater gastric epithelial damage than m2 strains. 15 caga (cytotoxinassociated gene) is considered as a marker for the presence of the pathogenicity (cag) island of about 35 kilobase pairs. 16 Several genes of this cag island, such as picb, encode proteins that enhance the virulence of the strain, e.g., by increasing the production of interleukin 8 by gastric epithelial cells A novel gene has been discovered recently, designated icea (induced by contact with epithelium). There are two main allelic variants of the gene: icea1 and icea2. The function of icea1 is not yet clear, but there is significant homology to a type II restriction endonuclease. The expression of icea1 is up-regulated on contact between H. pylori and human epithelial cells and may be associated with peptic ulcer disease. 20 Because the H. pylori virulence-related genes have not yet been studied together, the present study aimed to analyze vaca, caga, and icea status directly in gastric biopsy specimens from 94 patients in relation to clinical data. Abbreviation used in this paper: PCR, polymerase chain reaction by the American Gastroenterological Association /98/$3.00

2 July 1998 caga, vaca, AND icea GENOTYPING OF H. PYLORI 59 Materials and Methods Patients A total of 94 patients (57 male and 37 female; age, years; range, years) with culture-proven H. pylori infection were recruited in a community hospital in Oss, The Netherlands, and underwent endoscopy before receiving anti-helicobacter treatment. These patients were in need of anti-helicobacter therapy, and because we normally do not treat all H. pylori infected individuals, ulcer patients are relatively common in this patient group. The presence of ulcers was based on visual examination of the stomach and the duodenum, and the patient s history was investigated for an earlier diagnosis of peptic ulcer. If neither the patient s documented history nor endoscopic examination showed peptic ulcer disease, the patient was considered to have nonulcer dyspepsia or gastritis only. The use of nonsteroidal anti-inflammatory drugs or acid-suppressing drugs was not systematically documented. During endoscopic examination, biopsy specimens were obtained from the corpus and antrum of the stomach. The specimens were examined for the presence of H. pylori by culture, CLOtest (Delta-West, Bentley, Australia), histology (modified Giemsa staining), and polymerase chain reaction (PCR). After each endoscopic examination, endoscopes were cleaned with a 30-minute cycle in an Olympus ETD-2 washing machine at 60 C. A new autoclaved biopsy forceps was used for each patient. DNA Isolation From Gastric Biopsy Specimens Gastric biopsy specimens were homogenized in 200 µl of proteinase K solution (10 mmol/l Tris-HCl [ph 8.0], 5 mmol/l ethylenediaminetetraacetic acid, 0.1% sodium dodecyl sulfate, and 0.1 mg/ml proteinase K) with a sterile micropestle and incubated at 55 C for 1 hour. DNA was isolated from the homogenate by extraction with phenol/chloroform and ethanol precipitation and dissolved in 25 µl of water. Amplification of vaca, caga, and icea by PCR PCR reactions were performed in a volume of 50 µl containing 10 mmol/l Tris-HCl (ph 8.3), 50 mmol/l KCl, mmol/l MgCl 2, 200 µmol/l deoxynucleoside triphophase, 0.25 U of AmpliTaq Gold, and 25 pmol of both forward and reverse primers (Table 1). Reactions were covered with mineral oil, and PCR was performed in a BioMed-60 thermocycler under the following conditions: 9-minute preincubation at 94 C, followed by 40 cycles of 30 seconds at 95 C, 45 seconds at 50 C, and 45 seconds at 72 C. Final extension was performed for 5 minutes at 72 C. PCR primers (containing 5 biotin) used in this study are listed in Table 1. For analysis of the vaca s region, primers VA1F and VA1XR generated a fragment of 176 base pairs (bp) for s1a/b/c and 203 bp for s2 variants. For analysis of the vaca m region, forward primers VAMF and reverse primer MR1 generated a fragment of 107 bp for m1 and a fragment of Table 1. PCR Primers for Amplification of vaca and caga Sequences Primer (polarity) Sequence (5 = 3 ) a Position vaca s-region VA1F ( ) VA1XR ( ) vaca m-region MF1.1 ( ) MF1.2 ( ) MF1.3 ( ) MF1.4 ( ) MR1 ( ) caga cagaf( ) cagar( ) icea1 icea1f ( ) icea1r ( ) icea2 icea2f ( ) icea2r ( ) ATGGAAATACAACAA- ACACAC CCTGARACCGTTCCT- ACAGC GTGGATGCCCATACG- GCTAA GTGGATGCTCATACA- GCTWA GTGGATGCCCATACG- ATCAA GCGAGCGCTCATACG- GTCAA RTGAGCTTGTTGATA- TTGAC TTGACCAACAACCAC- AAACCGAAG CTTCCCTTAATTGCG- AGATTCC GTGTTTTTAACCAAA- GTATC CTATAGCCASTYTCT- TTGCA GTTGGGTATATCACA- ATTTAT TTRCCCTATTTTCTA- GTAGGT 182 bp for m2 variants. For detection of caga, primers cagaf and cagar yielded a fragment of 183 bp. Allele-specific PCR assays were used for icea1 and icea2. For amplification of the icea1 allele, forward primer icea1f and reverse primer icea1r yielded a fragment of 246 bp. For icea2, primers icea2f and icea2r yielded a fragment of either 229 or 334 bp because some icea2 alleles contain a repeated sequence of 105 nucleotides encoding 35 amino acids. icea amplimers were examined by electrophoresis on 2% agarose gels according to standard procedures. 21 Reverse Hybridization 1 21 b,c c and d c and d c and d c and d c and d c and d e e f f a R GorA,Y CorT,W AorT,S G or C. All primers for vaca and caga contain biotin at the 5 end. b Data from Atherton et al., c Positions according to the vaca open reading frame of strain (Genbank accession number U05676). d Positions according to the vaca open reading frame of strain Tx30a (Genbank accession number U29401). e Positions according to the caga open reading frame in Genbank sequence L f Genbank sequence accession number U g No reference sequence available for icea2. PCR products from the vaca s and m regions as well as from caga were analyzed simultaneously by reverse hybridization on a line probe assay (LiPA). 22 This assay consists of a nitrocellulose strip that contains a number of oligonucleotide g g

3 60 VAN DOORN ET AL. GASTROENTEROLOGY Vol. 115, No. 1 Table 2. Allele-Specific Probes for vaca and caga Used for Reverse Hybridization Probe designation Probe sequence (5 = 3 ) a Positions Specificity vaca s-region P1S1 GGAGCRTTRGTCAGCATCAC b s1a P22S1a GCTTTAGTAGGAGCRTTRGTC b s1a P1S1b GGAGCGTTGATTAGYKCCAT s1b P2S1b GTTTTAGCAGGAGCGTTGA s1b P3s1 GGGYTATTGGTYAGCATCAC s1c P4s1 GCTTTAGTRGGGYTATTGGT s1c P1S2 GCTAAYACGCCAAAYGATCC c s2 P2S2 GATCCCATACACAGCGAGAG c s2 vaca m-region P1M1 TTGATACGGGTAATGGTGG b m1 P2M1 GGGTAATGGTGGTTTCAACA b m1 P1M2 ACGAATTTAAGAGTGAATGGC c m2a P2M2 AGAGCGATAACGGGCTAAACA c m2a caga cagapro1 GTTGATAACGCTGTCGCTTC d caga cagapro2 TAATCTTCARGTRGCTTTTCTT d caga a R GorA,Y CorT,K GorT. b Positions according to the vaca open reading frame of strain (Genbank accession number U05676). c Positions according to the vaca open reading frame of strain Tx30a (Genbank accession number U29401). d Positions according to the caga open reading frame in Genbank sequence L probes used for type-specific detection of H. pylori genotypes (Table 2), immobilized as parallel lines. For each strain, 10 µl of each of the three biotinylated PCR products (vaca s and m regions and caga) was placed in a plastic trough, and 30 µl of 400 mmol/l NaOH and 10 mmol/l ethylenediaminetetraacetic acid was added for denaturation of the DNA. After 5 minutes, 1 ml of preheated hybridization buffer (2 standard saline citrate; 50 mmol/l Tris-HCl, ph 7.5; 0.1% sodium dodecyl sulfate) was added, and an LiPA strip was submerged in the solution, followed by incubation in a shaking water bath at C for 1 hour. Strips were washed with 1 ml of 2 standard saline citrate and 0.1% sodium dodecyl sulfate for 30 minutes at 50 C. Subsequently, the strips were rinsed three times in phosphate buffer, and conjugate (streptavidin/alkaline phosphatase) was added. After incubation at room temperature for 30 minutes, strips were rinsed again, and 4-nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indoyllphosphate substrate was added. Hybrids are visible as purplecolored probe lines, and hybridization patterns were interpreted visually. Statistical Analyses Data were analyzed by SPSS (SPSS Inc., Chicago, IL) version The Pearson 2 test was used to assess the relationships between individual genotypes and peptic ulcer disease. Logistic regression analysis was used to relate the different combinations of vaca, caga, and icea genotypes of H. pylori to the presence of peptic ulcers. Selection of variables was based on a likelihood ratio test, using a significance level of 0.05 for inclusion or elimination. Results vaca, icea, and caga genotypes of H. pylori were analyzed in 94 patients living in The Netherlands. Thirty-four (36.2%) of these 94 patients had gastritis only and were classified as nonulcer cases. Sixty (63.8%) patients had proven peptic ulcer disease: 46 (48.9%) first or chronic duodenal ulcer disease, and 14 (14.9%) first or recurrent gastric ulcer. There was no significant difference between the mean age of patients with and without ulcers ( and years, respectively). DNA isolated from gastric antral biopsy specimens was used directly for PCR. vaca and caga genotypes were determined by reverse hybridization, and icea variants were investigated by allele-specific PCR. Genotyping results are shown in Table 3. vaca Genotyping A complete vaca s- and m-region genotype was obtained in 93 of 94 cases. One biopsy specimen repeatedly failed to yield a detectable PCR product for the s region but contained type m1 and was positive for caga. The majority (64 of 94; 68.1%) of isolates contained the s1 allele, and of these most (56 of 64; 87.5%) Table 3. vaca, caga, and icea Status of H. pylori Strains in Gastric Biopsy Specimens From 94 Patients Genotype status Gastric ulcer Clinical status Peptic ulcer a Duodenal ulcer Nonulcer or gastritis only b Total c vaca s1a/m1 7 (50%) 18 (39.1%) 9 (26.5%) 34 (36.2%) s1a/m2 5 (35.7%) 13 (28.3%) 4 (11.7%) 22 (23.4%) s1b/m1 0 (0%) 1 (2.2%) 1 (2.9%) 2 (2.1%) s1b/m2 0 (0%) 3 (6.5%) 2 (5.8%) 5 (5.3%) s1c/m1 0 (0%) 1 (2.2%) 0 (0.0%) 1 (1.1%) s2/m2 2 (14.3%) 4 (8.6%) 13 (38.4%) 19 (20.2%) Multiple d 0 (0%) 5 (10.9%) 5 (14.7%) 10 (10.6%) Incomplete 0 (0%) 1 (2.2%) 0 (0.0%) 1 (1.1%) icea icea1 8 (57.1%) 29 (63.1%) 16 (47.1%) 53 (56.4%) icea2 2 (14.3%) 7 (15.2%) 16 (47.1%) 25 (26.6%) icea 2 (14.3%) 0 (0%) 0 (0.0%) 2 (2.1%) icea icea2 2 (14.3%) 10 (21.7%) 2 (5.8%) 14 (14.9%) caga caga 10 (71.4%) 37 (80.4%) 16 (47.1%) 63 (67.0%) caga 4 (28.6%) 9 (19.6%) 18 (52.9%) 31 (33.0%) a Peptic ulcer observed during gastroscopy or a documented history of ulcer disease. Percentages are given as a fraction of the total number of patients with gastric (n 14) or duodenal (n 46) ulcers. b No peptic ulcer observed and no documented history of ulcer disease. Percentages in this column are given as a fraction of the total number of nonulcer patients (n 34). c Percentages in this column are given as a fraction of the total number of patients (n 94). d More than 1 vaca genotype detected, see also Table 5.

4 July 1998 caga, vaca, AND icea GENOTYPING OF H. PYLORI 61 were subtype s1a, whereas 7 of 64 (10.9%) were subtype s1b. One patient who was born in Taiwan had a distinct vaca subtype designated as s1c. The non toxin-producing vaca genotype s2/m2 was seen in 19 (20.2%) patients. Ten isolates (10.6%) had evidence of multiple vaca genotypes. Among the 83 cases containing a single vaca genotype, there was no difference between duodenal ulcers and gastric ulcers (P ). Therefore, patients with duodenal and gastric ulcers were considered a single group of ulcer patients compared with patients with nonulcer disease. There was a significant association between vaca type s1 strains and the presence of peptic ulcers (P ). However, the vaca m type was not associated with peptic ulcer disease (P ). Among the patients with type s1 strains, the mean age of patients when first diagnosed with peptic ulcer disease ( years) was not significantly different from the mean age of patients without peptic ulcer disease ( years; P 0.066). icea Genotyping icea1 was detected in 53 (56.4%) of 94 patients, and icea2 was found in 25 (26.6%). Fourteen isolates (14.9%) were positive for both icea1 and icea2, and 5 of these also contained multiple vaca genotypes, indicating the presence of multiple strains in these specimens. Two isolates (2.1%) did not yield any PCR product for icea. Among the 78 biopsy specimens with a single icea allelic type, there was a significant association between the presence of the icea1 allele and peptic ulcer disease (P ). Again, as for vaca there was no difference between patients with duodenal and gastric ulcers (P ). In patients without ulcers, the prevalence of icea1 and icea2 was about equal. The icea type is not associated with caga (P 0.73) or vaca (P 0.75) status. Among patients with type icea1 strains, the mean age of patients at first diagnosis of peptic ulcer disease ( years) was not significantly different from that of patients without peptic ulcers ( years; P ). Detection of caga Of the 94 cases, 63 (67%) were caga positive and 31 (33%) were caga negative. There was no difference between patients with duodenal ulcer and gastric ulcer disease (P ). cagapositive strains were significantly more prevalent among patients with peptic ulcers (P ). In patients without ulcers, the prevalence of caga-positive and caga-negative strains was approximately equal. There was a very strong association between the presence of caga and vaca type s1. Among the 72 patients with a single icea and vaca genotype, 45 of the 47 caga-positive patients also had vaca s1. In contrast, only 10 of the 25 caga-negative cases contained vaca s1 (P 10 5 ). Among the patients with caga-positive strains, the mean age of patients at diagnosis of peptic ulcer disease ( years) was not significantly different from the mean age of patients without ulcers ( years; P 0.159). Combined vaca, caga, and icea Genotypes Based on analysis of the vaca s-region type (s1 and s2), caga (positive and negative), and the icea allelic type (icea1 and icea2), eight different genotypic combinations can be recognized. The prevalence of each of these eight genotypes among the 72 patients with a single combined genotype is shown in Table 4. Among the 44 ulcer patients with a single genotype, 26 (59.1%) contained the vaca s1/caga /icea1 genotype and none (0%) contained vaca s1/caga /icea2. If we considered only vaca and caga genotypes, 34 (77%) of the 44 ulcer patients had genotype vaca s1/caga, and 4 (9.1%) had vaca s2/caga. If we consider only vaca and icea, 31 (70%) biopsy specimens contained genotype vaca s1/icea1 and Table 4. vaca, caga, and icea Genotype Distribution Among Ulcer and Nonulcer Patients With a Single Combined Genotype Genotype Gastric ulcer Peptic ulcer a Duodenal ulcer Nonulcer or gastritis only b Total c vaca s1/caga / icea1 6 (60.0%) 20 (58.8%) 6 (21.4%) 32 (44.4%) vaca s1/caga / icea2 2 (20.0%) 6 (17.7%) 5 (17.9%) 13 (18.1%) vaca s1/caga / icea1 1 (10.0%) 4 (11.8%) 2 (7.1%) 7 (9.7%) vaca s1/caga / icea2 0 (0%) 0 (0%) 3 (10.7%) 3 (4.2%) vaca s2/caga / icea1 0 (0%) 1 (2.9%) 1 (3.6%) 2 (2.8%) vaca s2/caga / icea2 0 (0%) 0 (0%) 0 (0%) 0 (0%) vaca s2/caga / icea1 1 (10.0%) 3 (8.8%) 5 (17.9%) 9 (12.5%) vaca s2/caga / icea2 0 (0%) 0 (0%) 6 (21.4%) 6 (8.3%) Total a Peptic ulcer observed during gastroscopy or a documented history of ulcer disease. Percentages are given as a fraction of the total number of patients with gastric (n 10) or duodenal (n 34) ulcers. b No peptic ulcer observed and no documented history of ulcer disease. Percentages in this column are given as a fraction of the total number of nonulcer patients (n 28). c Percentages in this column are given as a fraction of the total number of patients with a single genotype (n 72). Patients with multiple vaca (n 10) and/or icea (n 14) genotypes, as well as untypeable strains for vaca (n 1) or icea (n 2), were excluded from analysis.

5 62 VAN DOORN ET AL. GASTROENTEROLOGY Vol. 115, No. 1 none (0%) contained vaca s2/icea2. Conversely, genotype vaca s1/caga /icea1 strains were found in 32 (44%) of 72 cases, and 26 (76%) of these are associated with a clinical diagnosis of peptic ulcer disease. At the other end of the spectrum, strains with genotype vaca s2/caga /icea2 were found in 6 patients, and ulcer disease was absent in all of them. Strains with genotype vaca s2, caga, and icea2 were not identified. Multiple genotypes of either vaca or icea were seen in 19 (20.2%) of the 94 biopsy specimens, and 5 of these contained multiple genotypes for both vaca and icea, as shown in Table 5. Genotyping analysis of vaca or icea was incomplete in 1 and 2 cases, respectively. There were no significant differences in genotypes between patients with gastric ulcers (n 14) and those with duodenal ulcers (n 46). Therefore, patients with gastric and duodenal ulcers were analyzed as a single group compared with patients without ulcers. The association between the presence or absence of peptic ulcers and the patient s combination of H. pylori vaca, caga, and icea genotypes was analyzed by means of logistic regression. Inclusion of the variables age and sex did not lead to a significantly better fit in any of the equations tested. Furthermore, no association between the presence of ulcers and either of the vaca m alleles was found (P 0.05 for all comparisons). The remaining genotypic variations (vaca s region, caga, and icea) with significant associations to ulcer disease were analyzed further. Table 6 shows the odds ratios (ORs) for the three variables when included in two-parameter models (models 1 and 2) and in a three-parameter model (model 3). The results show that icea is a predictor variable in all three models (ORs Table 5. vaca, caga, and icea Genotypes in Biopsy Specimens Containing Multiple Strains Patient Ulcer vaca (s) vaca (m) caga icea 1 s1a m1 m2 A1 A2 2 s1a s2 m1 m2 A1 A2 3 s1a s2 m1 m2 A1 A2 4 s1a m2 A1 A2 5 s2 m2 A1 A2 6 s1b s2 m1 m2 A1 7 s1a s2 m1 m2 A1 A2 8 s1a m2 A1 A2 9 s1a m2 A1 A2 10 s1a m2 A1 A2 11 s1a s2 m1 m2 A2 12 s1b m1 A1 A2 13 s2 m2 A1 A2 14 s1a m1 A1 A2 15 s1a m1 m2 A1 16 s1a s1b s2 m2 A1 A2 17 s1a s2 m2 A2 18 s1a s2 m1 A1 19 s1a m1 A1 A2 Table 6. Estimated ORs for icea, caga, and vaca s-region Genotypes in Relation to the Presence of a Peptic Ulcer Genotype (coding) Model 1 Model 2 Model 3 icea (A1 0, A2 1) ( ) ( ) ( ) vaca s region 0.15 a 0.31 (s1 0, s2 1) ( ) ( ) caga a (neg 0, pos 1) ( ) ( ) NOTE. Data presented as OR (95% confidence interval). a Variable excluded from the logistic regression equation. significantly different from 1). vaca s type and caga are also predictor variables, but as a result of the close association between them, it is sufficient to include only one of them. Their ORs differ significantly from unity only in the two-parameter models. In conclusion, the presence of ulcers is associated with icea1 (OR 1), vaca s1 (OR 1), and caga (OR 1). Inclusion of interaction terms (e.g., vaca m type x age) did not change this conclusion. Considering only caga and icea, the percentages of ulcer and nonulcer patients with either of the four allelic combinations (caga /icea1, caga /icea2, caga /icea1, and caga /icea2) and the probabilities of having an ulcer, as calculated with model 2 (see Table 6), are shown in Figure 1. Most ulcer patients have an H. pylori strain of the caga /icea1 genotype. For this genotype, a 0.84 probablity of having an ulcer was calculated. No ulcer patients were found that carried H. pylori strains of the caga /icea2 genotype (a low probability of 0.16 was calculated by the model). Remarkably, the nonulcer patients are equally distributed over the four caga/icea genotypes. Figure 1. Frequency distribution of patients with ( ) or without ( ) peptic ulcers with respect to the combined caga/icea genotypes. Bars represent percentages of the total number of patients with (n 44) and without (n 28) ulcers with a single genotype (n 72). Cases containing multiple vaca (n 10) and/or icea (n 14) genotypes, as well as untypeable strains for vaca (n 1) or icea (n 2), were excluded from analysis. Probabilities for ulcer disease, as calculated from model 2 (see Table 6), are shown in parentheses below each of the four combinations of caga/icea genotypes as indicated on the horizontal axis.

6 July 1998 caga, vaca, AND icea GENOTYPING OF H. PYLORI 63 Discussion The presence of H. pylori in the gastric mucosa leads to chronic gastritis and eventually atrophic gastritis and is associated with diseases such as peptic ulcers, gastric carcinoma, and MALT lymphoma. 2,23 However, there is a clear discrepancy between the number of infected individuals and patients with clinical symptoms. Although host and environmental factors are considered important, there is also evidence for a role of specific H. pylori genotypes. Infection with certain H. pylori genotypes (e.g., caga-positive and vacuolating toxinproducing) is related to more severe morbidity, whereas other variants appear less pathogenic 7,8,15,27 34 The vaca genotype may also play a role in the efficacy of anti- Helicobacter therapy. 35 The present study described combined genotyping analysis of caga, vaca, and icea in a group of Dutch patients and confirmed several earlier findings in U.S. patients, 8,13,15,20,36 such as the significant association between the presence of caga and peptic ulcers. Similarly, strains containing vaca type s1 were found significantly more often in ulcer patients than type s2 strains, and there was a strong association between the presence of caga and vaca type s1. We also confirmed clinically relevant polymorphism in the recently discovered icea gene. icea1 strains are much more prevalent among patients with ulcers, and icea1 appears to be a marker for peptic ulcer disease, independent of caga and vaca. The combination of the distinct vaca, caga, and icea genotypes illustrates the mosaic composition of the H. pylori genome. At one end of the spectrum, strains that are typed as vaca s1/caga /icea1 can be considered the most pathogenic and are found predominantly in patients with ulcer disease. In contrast, strains typed as vaca s2m2/ caga /icea2 appear the least pathogenic and did not occur in peptic ulcer patients. Genotyping of icea and caga offers the most effective combination for identification of patients with peptic ulcers. However, because caga and the vaca s-region genotypes are so strongly associated, the combination of icea and vaca s type is almost as effective as the combination of icea and caga. The observed associations pose the question of whether a sound prognosis could be based on these observations. The calculated probabilities for the presence of an ulcer, as based on the combined caga and icea genotypes, confirm that for most patients with ulcers (61.4%), the logistic regression model indeed calculates a high probability of 0.84 (Figure 1). However, approximately 25% of non-ulcer patients also have caga /icea1 and have a high probability score. This underlines that the positive associations between H. pylori genotypes and peptic ulcer disease do not imply that patients without ulcer disease cannot be infected with high-risk H. pylori genotypes. One may speculate that patients infected with more pathogenic (vaca s1, caga,oricea1) genotypes who do not have peptic ulcer disease may be younger than ulcer patients with these strains and have not yet developed ulcer disease. However, no such relationship to age was found. It is assumed that most were infected during childhood. Therefore, our data suggest that the duration of H. pylori infection is not an important factor in the development of peptic ulcer disease. PCR analysis of DNA isolated from gastric biopsy specimens does not require tedious and time-consuming culturing of the strains from the biopsy and provides direct evidence for the presence of specific genotypes in the gastric mucosa. The PCR-LiPA method used in the present study is based on sequence analysis of the vaca s and m regions of approximately 90 H. pylori strains from multiple geographic locations. 14 icea allelic types were analyzed by allele-specific PCR. The limited sequence similarity between the two icea alleles does not permit amplification by a single universal primer set. The primers described in the present study are based on extensive sequence analysis of icea1 and icea2 alleles and permitted icea typing in more than 98% of a panel of 321 H. pylori strains from various geographic origins (data not shown). Two biopsy specimens did not show positive amplification for either of the two icea alleles; this may indicate limited sensitivity of icea PCR in gastric biopsy specimens or the existence of additional icea variants. Evidence for the presence of multiple strains, based on vaca and icea genotyping, was found in a considerable number of cases. The prevalence of infection with multiple strains, as reported earlier, 37,38 may still be underestimated, especially in areas with a high prevalence of H. pylori infection in the general population. Several recent studies failed to show a relationship between vaca and caga status and clinical symptoms in several patient populations The discrepancy between these reports and the results from the present study may have several causes. First, patient selection is extremely important, and the study group should be sufficiently large and diverse with respect to genotypes and clinical symptoms. A recent study by Ito et al. 41 did not comprise any vaca s2 or caga negative patients. Second, the typing methods used should be adequate to determine the vaca and caga genotypes. Antibodies to CagA are associated with the severity of disease. 31,42 However, antibodies to vaca are not likely to be relevant 43,44 because production of even minute amounts of cytotoxin may be sufficient to raise antibodies, and serological discrimination between the different vaca

7 64 VAN DOORN ET AL. GASTROENTEROLOGY Vol. 115, No. 1 genotypes is not yet possible. The genotyping method described by Atherton et al. 13 does not permit discrimination between subtypes s1a and s1c or typing of the m region in most East Asian strains. 45 Detection of the conserved part of vaca 46 detects only the presence of the gene and does not allow discrimination between the different genotypes. Third, the geographic origin of the patients may also play an important role. Recent studies suggest the existence of separate bacterial lineages in different parts of the world. 41,43,47 49 Analysis of more than 700 H. pylori strains from 24 countries showed that the vaca genotypes are not uniformly distributed over the world. Subtype s1a is predominant in Northern Europe and Australia, whereas subtype s1b is prevalent in South America. Subtype s1c appears to be the major subtype in East Asia but is extremely rare in Western Europe. 50 The unequal distribution of genotypes may contribute to the different prevalence of H. pylori associated diseases in different parts of the world. In the present study, the 1 patient carrying the vaca s1c subtype was born in 1952 in Taiwan and emigrated to Europe at age 26 years. Therefore, it is likely that this patient was infected early in life in Taiwan and still carries this strain from East Asia. Fourth, to determine the true relationship between the genotypes of H. pylori virulence genes and clinical symptoms, it is crucial to exclude patients carrying multiple strains. In studies reported earlier, it is unclear whether such cases were adequately excluded from statistical analysis. In the present study, not all patients in whom peptic ulcer disease was diagnosed were infected with virulent genotypes of H. pylori. Conversely, virulent genotypes were sometimes found in patients without peptic ulcer disease. Several important aspects should be taken into account. First, it is almost impossible to be completely certain of the clinical diagnosis. The presence of ulcers may occasionally be explained by the use of nonsteroidal anti-inflammatory drugs, with H. pylori as an innocent bystander. In addition, a definite diagnosis of nonulcer dyspepsia is difficult. Patients with only gastritis at endoscopy may develop ulcer disease later in life and therefore may have been misclassified in the present study. Patients using acid-suppressing drugs may present without peptic ulcers. Second, only a single biopsy specimen from the antrum of the stomach was used for genotyping analysis in each patient, and the influence of sampling errors cannot be excluded. Third, host factors, such as smoking, acid output, and HLA status, may also influence the clinical outcome of H. pylori infection and may interact with certain bacterial virulence factors. Fourth, additional bacterial virulence factors may play an important role. Binding to blood group antigens appears to depend on distinct polymorphism in the baba gene. 51 Despite the limitations of the present study, analysis of the vaca, caga, and icea virulence genes directly in gastric biopsy specimens permitted clinically relevant discrimination between H. pylori strains. Each of these individual genes, as well as certain combinations, is significantly associated with the presence of peptic ulcer disease. It is not possible or desirable to treat all H. pylori infected patients worldwide. In the future, combined analysis of vaca, caga, and icea genotypes may permit identification of high-risk patients who are infected by more pathogenic H. pylori strains. Eventually, patients infected with such strains could be selected for prophylactic anti-helicobacter treatment to prevent peptic ulcer disease later in life. References 1. Blaser MJ. Ecology of Helicobacter pylor in the human stomach. J Clin Invest 1997;100: Dunn BE, Cohen H, Blaser MJ. Helicobacter pylori. Clin Microbiol Rev 1997;10: Go MF, Kapur V, Graham DY, Musser JM. Population genetic analysis of Helicobacter pylori by multilocus enzyme electrophoresis: extensive allelic diversity and recombinational population structure. J Bacteriol 1996;178: Marshall DG, Coleman DC, Sullivan DJ, Xia H, O Morain CA, Smyth CJ. Genomic DNA fingerprinting of clinical isolates of Helicobacter pylori using short oligonucleotide probes containing repetitive sequences. J Appl Bacteriol 1996;81: van der Ende A, Rauws EA, Feller M, Mulder CJ, Tytgat GN, Dankert J. Heterogeneous Helicobacter pylor isolates from members of a family with a history of peptic ulcer disease. Gastroenterology 1996;111: Blaser MJ. Intrastrain differences in Helicobacter pylori: a key question in mucosal damage? Ann Med 1995;27: Mobley HL. Defining Helicobacter pylori as a pathogen: strain heterogeneity and virulence. Am J Med 1997;100:2S 11S. 8. Atherton JC. The clinical relevance of strain types of Helicobacter pylori. Gut 1997;40: Leunk RD, Johnson PT, David BS, Kraft WG, Morgan DR. Cytotoxic activity in broth culture filtrates of Campylobacter pylori. J Med Microbiol 1988;26: Telford JL, Ghiara P, Dell Orco M, Comanducci M, Burroni D, Bugnoli M, Tecce MF, Censini S, Covacci A, Xiang Z. Gene structure of the Helicobacter pylori cytotoxin and evidence of its key role in gastric disease. J Exp Med 1994;179: Cover TL. The vacuolating cytotoxin of Helicobacter pylori. Mol Microbiol 1996;20: Cover TL, Tummuru MK, Cao P, Thompson SA, Blaser MJ. Divergence of genetic sequences for the vacuolating cytotoxin among Helicobacter pylori strains. J Biol Chem 1994;269: Atherton JC, Cao P, Peek RMJ, Tummuru MK, Blaser MJ, Cover TL. Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori. Association of specific vaca types with cytotoxin production and peptic ulceration. J Biol Chem 1995;270: van Doorn LJ, Figueiredo C, Sanna R, Pena AS, Midolo P, Ng EK,

8 July 1998 caga, vaca, AND icea GENOTYPING OF H. PYLORI 65 Atherton JC, Blaser MJ, Quint W. Expanding allelic diversity of Helicobacter pylori vaca (submitted for publication). 15. Atherton JC, Peek RMJ, Tham KT, Cover TL, Blaser MJ. Clinical and pathological importance of heterogeneity in vaca, the vacuolating cytotoxin gene of Helicobacter pylori. Gastroenterology 1997;112: Censini S, Lange C, Xiang Z, Crabtree JE, Ghiara P, Borodovsky M, Rappuoli R, Covacci A. cag, a pathogenicity island of Helicobacter pylori, encodes type I specific and disease-associated virulence factors. Proc Natl Acad Sci USA 1996;93: Tummuru MK, Sharma SA, Blaser MJ. Helicobacter pylori picb, a homologue of the Bordetella pertussis toxin secretion protein, is required for induction of IL-8 in gastric epithelial cells. Mol Microbiol 1995;18: Shimoyama T, Crabtree JE. Mucosal chemokines in Helicobacter pylor infection. J Physiol Pharmacol 1997;48: Megraud F. Pathogenic diversity of Helicobacter pylori. J Gastroenterol 1997;32: Peek RMJ, Thompson SA, Atherton JC, Blaser MJ, Miller GG. Expression of a novel ulcer-associated H. pylori gene, icea, following adherence to gastric epithelial cells (abstr). Gastroenterology 1996;110(Suppl):A Sambrook J, Fritsch IF, Maniatis T. Molecular cloning, a laboratory manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, Stuyver L, Rossau R, Wyseur A, Duhamel M, Vandenborght B, van Heuverswyn H, Maertens G. Typing of HCV isolates and characterization of new (sub)types using a line probe assay. J Gen Virol 1993;74: Wotherspoon AC. Gastric MALT lymphoma and Helicobacter pylori. Yale J Biol Med 1997;69: Graham DY, Malaty HM, Go MF. Are there susceptible hosts to Helicobacter pylori infection? Scand J Gastroenterol Suppl 1994; 205: Malaty HM, Graham DY. Importance of childhood socioeconomic status on the current prevalence of Helicobacter pylori infection. Gut 1994;35: Malaty HM, Paykov V, Bykova O, Ross A, Graham DP, Anneger JF, Graham DY. Helicobacter pylori and socioeconomic factors in Russia. Helicobacter 1996;1: Covacci A, Censini S, Bugnoli M, Petracca R, Burroni D, Macchia G, Massone A, Papini E, Xiang Z, Figura N. Molecular characterization of the 128-kDa immunodominant antigen of Helicobacter pylori associated with cytotoxicity and duodenal ulcer. Proc Natl Acad Sci USA 1993;90: Xiang Z, Censini S, Bayeli PF, Telford JL, Figura N, Rappuoli R, Covacci A. Analysis of expression of caga and vaca virulence factors in 43 strains of Helicobacter pylori reveals that clinical isolates can be divided into two major types and that caga is not necessary for expression of the vacuolating cytotoxin. Infect Immun 1995;63: Labigne A, de Reuse H. Determinants of Helicobacter pylori pathogenicity. Infect Agents Dis 1996;5: Beales IL, Crabtree JE, Scunes D, Covacci A, Calam J. Antibodies to caga protein are associated with gastric atrophy in Helicobacter pylori infection. Eur J Gastroenterol Hepatol 1996;8: Cover TL, Glupczynski Y, Lage AP, Burette A, Tummuru MK, Perez-Perez GI, Blaser MJ. Serologic detection of infection with caga Helicobacter pylori strains. J Clin Microbiol 1995;33: Peek RMJ, Moss SF, Tham KT, Perez-Perez GI, Wang S, Miller GG, Atherton JC, Holt PR, Blaser MJ. Helicobacter pylori caga strains and dissociation of gastric epithelial cell proliferation from apoptosis. J Natl Cancer Inst 1997;89: Blaser MJ, Perez-Perez GI, Kleanthous H, Cover TL, Peek RM, Chyou PH, Stemmermann GN, Nomura A. Infection with Helicobacter pylori strains possessing caga is associated with an increased risk of developing adenocarcinoma of the stomach. Cancer Res 1995;55: Kuipers EJ, Perez-Perez GI, Meuwissen SG, Blaser MJ. Helicobacter pylori and atrophic gastritis: importance of the caga status. J Natl Cancer Inst 1995;87: van Doorn LJ, Quint WGV, Schneeberger PM, Tytgat GNJ, de Boer WA. Association between vaca and caga status of Helicobacter pylori and the efficacy of a 1-day quadruple therapy. Lancet 1997;350: Peek RMJ, Moss SF, Tham KT, Perez-Perez GI, Wang S, Miller GG, Atherton JC, Holt PR, Blaser MJ. Helicobacter pylori caga strains and dissociation of gastric epithelial cell proliferation from apoptosis. J Natl Cancer Inst 1997;89: Taylor NS, Fox JG, Akopyantz NS, Berg DE, Thompson N, Shames B, Yan L, Fontham E, Janney F, Hunter FM, Correa P. Long-term colonization with single and multiple strains of Helicobacter pylori assessed by DNA fingerprinting. J Clin Microbiol 1995;33: Jorgensen M, Daskalopoulos G, Warburton V, Mitchell HM, Hazell SL. Multiple strain colonization and metronidazole resistance in Helicobacter pylori infected patients: identification from sequential and multiple biopsy specimens. J Infect Dis 1996;174: Go MF, Graham DY. Presence of the caga gene in the majority of Helicobacter pylori strains is independent of whether the individual has duodenal ulcer or asymptomatic gastritis. Helicobacter 1996;1: Maeda S, Kanai F, Ogura K, Yoshida H, Ikenoue T, Takahashi M, Kawabe T, Shiratori Y, Omata M. High seropositivity of anti-caga antibody in Helicobacter pylori infected patients irrelevant to peptic ulcers and normal mucosa in Japan. Dig Dis Sci 1997;42: Ito Y, Azuma T, Ito S, Miyaji H, Hirai M, Yamazaki Y, Sato F, Kato T, Kohli Y, Kuriyama M. Analysis and typing of the vaca gene from caga-positive strains of Helicobacter pylori isolated in Japan. J Clin Microbiol 1997;35: Rudi J, Kolb C, Maiwald M, Zuna I, von Herbay A, Galle PR, Stremmel W. Serum antibodies against Helicobacter pylori proteins VacA and CagA are associated with increased risk for gastric adenocarcinoma. Dig Dis Sci 1997;42: Ogura K, Kanai F, Maeda S, Yoshida H, Ogura M, Lan KH, Hirota K, Kawabe T, Shiratori Y, Omata M. High prevalence of cytotoxin positive Helicobacter pylori in patients unrelated to the presence of peptic ulcers in Japan. Gut 1997;41: Donati M, Moreno S, Storni E, Tucci A, Poli L, Mazzoni C, Varoli O, Sambri V, Farencena A, Cevenini R. Detection of serum antibodies to CagA and VacA and of serum neutralizing activity for vacuolating cytotoxin in patients with Helicobacter pylori induced gastritis. Clin Diagn Lab Immunol 1997;4: Maeda S, Ogura K, Ishitobi M, Kanai F, Yoshida H, Ota S, Shiratory Y, Omata M. Diversity of Helicobacter pylori vaca gene in Japanese strains high activity type s1 is dominant in Japan (abstr). Gastroenterology 1996;100(Suppl):A Matsukura N, Onda M, Kato S, Hasegawa H, Okawa K, Shirakawa T, Tokunaga A, Yamashita K, Hayashi A. Cytotoxin genes of Helicobacter pylori in chronic gastritis, gastroduodenal ulcer and gastric cancer: an age and gender matched case-control study. Jpn J Cancer Res 1997;88:

9 66 VAN DOORN ET AL. GASTROENTEROLOGY Vol. 115, No Campbell S, Fraser A, Holliss B, Schmid J, O Toole PW. Evidence for ethnic tropism of Helicobacter pylori. Infect Immun 1997;65: Yang JC, Wang TH, Wang HJ, Kuo CH, Wang JT, Wang WC. Genetic analysis of the cytotoxin-associated gene and the vacuolating toxin gene in Helicobacter pylori strains isolated from Taiwanese patients. Am J Gastroenterol 1997;92: Genta RM, Gurer IE, Graham DY. Geographical pathology of Helicobacter pylori infection: is there more than one gastritis? Ann Med 1995;27: van Doorn LJ, Figueiredo C, Carneiro F, Sanna R, Peña AS, Midolo P, Blaser MJ, Quint WGV. Worldwide heterogeneity of the Helicobacter pylori vaca gene (abstr). Gut 1997;41(Suppl 1):A Ilver D, Arnqvist A, Ogren J, Frick IM, Kersulyte D, Incecik ET, Berg DE, Covacci A, Engstrand L, Boren T. Helicobacter pylori adhesion binding fucosylated histo-blood group antigens revealed by retagging. Science 1998;279: Received December 10, Accepted March 13, Address requests for reprints to: Leen-Jan van Doorn, Ph.D., Delft Diagnostic Laboratory, R. de Graafweg 7, 2625 AD, Delft, The Netherlands. L.J.van.Doorn@ddl.nl; fax: (31) Supported by PRAXIS XXI (to C.F.). The authors thank Dr. G. J. J. M. Borsboom for his helpful suggestions and C. L. A. M. van Hoek for preparation of the LiPA strips.