Supplementary Information

Size: px
Start display at page:

Download "Supplementary Information"

Transcription

1 Supplementary Information Recruitment of Mesenchymal Stem Cells Into Prostate Tumours Promotes Metastasis Younghun Jung 1, Jin Koo Kim 1, Yusuke Shiozawa 1, Jingcheng Wang 1, Anjali Mishra 1, Jeena Joseph 1, Janice E. Berry 1, Samantha McGee 1, Eunsohl Lee 1, Hongli Sun 2, Jianhua Wang 3, Taocong Jin 4, Honglai Zhang 5, Jinlu Dai 5, Paul H. Krebsbach 2, Evan T. Keller 5, Kenneth J. Pienta 5, and Russell S. Taichman 1, 1 Department of Periodontics and Oral Medicine, University of Michigan School of Dentistry, Ann Arbor, MI 4819, USA. 2 Department of Biologic and Materials Sciences, University of Michigan School of Dentistry, Ann Arbor, MI 4819, USA. 3 Institute of Medical Sciences, Shanghai Jiao-Tong University School of Medicine, Shanghai 225, P.R. China. 4 Department of Cariology, Restorative Sciences and Endodontics, University of Michigan School of Dentistry, Ann Arbor, MI 4819, USA. 5 Departments of Urology and Internal Medicine, University of Michigan Medical School, Ann Arbor, MI 4819, USA. Supplementary Figures S1-S5 Supplementary Table S1 Supplementary Methods

2 a Undifferentiated MSC Alizarin Red S/Oil Red O/ Alcian Blue Alcian Blue c Prostate Tissue d CXCL16/DAPI CXCL16/DAPI CXCL16/DAPI CXCL16/DAPI f P <.1.5 g P < MC3T3-E1 s.c. PCa implantation () Tumour growth MSC cell recruitment to tumours (CXCR6 +/+ or CXCR6 -/- mice) k NMPE % MSC cells in marrow MCF-7 i Tramp MCF-1A MCF-7 2 RWPE-1 PC3 C4-2B CXCR16 CXCR6 (RWPE-1, PC3, C4-2B/ NMPE,, Tramp/ MCF-1A, MCF-7) MSC cell recruitment to tumours.4 CXCR6 +/+ CXCR6 -/- (SCID or CXCR6 +/+ mice) m P =.22 P = Orthotopic cancer cell implantation.12 l P <.1 P <.1 P <.1.2 j n.s..16 % MSC cells in tumour MCF-1A % MSC cells in tumour.5 C4-2B LNCaP DU145 PC3 mrna of cells 1 4 HOB RWPE mcxcl16 mrna hcxcl16 (ng ml -1 ).1 Gleason 8+9 Gleason 6+7 h hcxcl16 mrna Gleason 4+5 hcxcl16 mrna Normal prostate P <.1 P <.1.3 e Chondrogenic conditions Adipogenic conditions Oil Red O NMPE Tramp % MSC cells in tumour b Osteoblastic conditions Alizarin Red S P = MCF-1A MCF-7

3 n s.c.tumour CXCR6 +/+ CXCR6 -/ p s.c.tumour CXCR6 +/+ Control SCID SCID SCID C4-2B PC3 CXCR6 +/+ shcxcl16 q Orthotopic tumour (prostate) RWPE-1 r o Orthotopic tumour (prostate) NMPE Tramp Orthotopic tumour (fat pad) SCID MCF-1A SCID MCF-7 Supplementary Figure S1: Expression of CXCL16 by prostate cancers and breast cancers and MSC cell recruitment into tumours in orthotopic animal models. (a) Differentiation of murine MSCs into osteoblasts, adipocytes, and chondrocytes was confirmed by staining of Alizarin Red S, Oil Red O, and Alcian Blue, respectively. Scale bars, 5µm. (b) Immunohistochemistry (IHC) staining for the expression of CXCL16 (red, white arrows) in human prostate cancer tissue microarray is correlated with aggressive phenotype. Blue, DAPI nuclear stain. Scale bars, 1 µm. (c) CXCL16 mrna by human prostate cancer cell lines was determined by qrt-pcr. (d) CXCL16 mrna, and (e) CXCL16 secretion by human breast cancer cell lines were determined by qrt-pcr or ELISA. (f) CXCL16 mrna by murine prostate cancer cell lines was determined by qrt -PCR. (g) mrna levels for CXCR16 and CXCR6 by cells were determined by qrt-pcr. Data in (c-g) are representative of mean with s.d. for triplicates in each of three independent experiments (Student s t -test). (h) Experimental scheme of cell implantation to CXCR6 +/+ or CXCR6 -/- mice for examining tumour growth and MSC cell recruitment to tumours. (i) % MSC ( Lin - Sca-1+CD45 -) present in the bone marrow of CXCR6 +/+ or CXCR6 -/- mice (mean±s.d., n = 3 independent experiments, Student s t-test). n.s., not significant. (j) Experimental scheme of human and murine prostate cancer and human breast cancer cell orthotopic implantation to in the prostate or fat pad of SCID or C57BL/6 (CXCR6 +/+ ) mice for examining tumour growth and MSC cell recruitment to tumours. (k-m) % MSCs present in human and murine prostate tumours, and human breast tumours were grown in the prostate or fat pad of SCID or C57BL/6 (CXCR6 +/+) mice (error bars represent mean±s.d. for 3-5 animals/group, n = 1independent experiment, Student's t-test). (n-r) Tumours from various animal experiments (Supplementary Table S1) were stained by H&E. Scale bars, 1 µm.

4 b 16 Tramp f MSC P2 CXCR6 -/- h RAPA 2 g -1 (pg ml ) 4 IKKI P <.1 6 SB CXCL16 (1 ng ml -1) 1 m 8 SP H&E 1 µm P <.1 P <.1 U126 CXCR6 +/+ Gleason 4+5 e Prostate Tissue Benign (CXCR6 +/+ or CXCR6 -/- mice) NMPE CM: Tramp IKKI d 4 RAPA CAF formation in tumours 8 SP.1 CM: NMPE MSCP2 CXCR6-/MSCP () SB.3 s.c. PCa implantation U126 MSCP2 CXCR6-/MSCP2-1 (pg ml ).4 c P =.19 P =.7 P =.18 P =.37 Vimentin mrna a -SMA mrna a CXCL16 (1ng ml -1) MSC P2 U U126 IKKI U126+IKKI 1nM 5nM 1nM IKKI 25nM 5nM U126+IKKI CXCL16 (1ng ml -1 ) Supplementary Figure S2: Conditioned media by prostate cancer cells promote the generation of CAF and by CAFs was regulated through Erk and NF-kB signaling. MSCs isolated from CXCR6 +/+ or CXCR6-/- mice (P2 ) were exposed to murine prostate cancer cell conditioned media for 7 days. The expression of a-sma (a), and vimentin (b) mrna were evaluated. Data in (a,b) are representative of mean with s.d. for triplicates in each of three independent experiments (Student's t-test). (c) Experimental scheme of cells into CXCR6 +/+ or CXCR6-/- mice for examining CAF formation in tumours. (d) H&E staining for human prostate cancer tissue microarray in Fig. 2h. Scale bars, 1 µm. (e) Expression of (green, white arrows) from MSC cells or MSC CXCR6-/- cells were observed following exogenous CXCL16 treatment by IHC. Blue, DAPI nuclrea stain. Scale bars, 1 µm. (f) Erk and NFkB signaling are both required for induction of. production was stimulated by treating MSC cells with the presence or absence of CXCL16 in U126, SB2358 (SB), SP6125 (SP), IKK-2 inhibitor VI (IKKI), or rapamycin (RAPA). production was quantified by ELISA. (g) ELISA confirmed signaling by the inhibitors, U126, IKK-2 inhibitor VI (IKKI), and combination of U126 and IKK-2 inhibitor VI (IKKI). Data in (f,g) are representative of mean with s.d. for triplicates in each of three independent experiments (Student's t-test). (h) IHC staining confirmed (green, white arrows) by the inhibitors, U126, IKK-2 inhibitor VI (IKKI), and combination of U126 and IKK-2 inhibitor VI (IKKI). Scale bars, 1µm. implantation to (c) +/+ CXCR6 or

5 a b P =.16 a -SMA mrna Vimentin mrna P = Control CM: MSC.2.1 CM: shcxcl MSC Control MSC shcxcl16 MSC d c Tumour s.c. PCa implantation a-sma/dapi Vimentin CAF formation in tumours (CXCR6 +/+ mice) a -SMA a-sma/ / DAPI DAPI Control Vimentin/DAPI Tumour Vimentin shcxcl16 shcxcl16 Control a -SMA a -SMA a-sma/ a-sma/ / Vimentin/DAPI f Tumour a-sma/dapi a -SMA (Control or shcxcl16 ) e shcxcl16 Control Vimentin Vimentin Vimentin/ Vimentin/ / DAPI Vimentin/ / DAPI Supplementary Figure S3: knockdown of CXCL16 in prostate cancer cells reduces generation of CAF. MSCs isolated from CXCR6 +/+ mice (P 2) were exposed to Control or shcxcl16 cell conditioned media for 7 days. The a- SMA (a) and vimentin (b) mrna were evaluated. Data in (a,b) are representative of mean with s.d. for triplicates in each of three independent experiments (Student's t-test). (c) Experimental scheme of Control or shcxcl16 cell implantation to CXCR6 +/+ mice for examining CAF formation in tumors. (d) IHC of localization of a -SMA and vimentin positive cells within Control or shcxc L16 tumours grown in CXCR6 +/+ mice (red, a -SMA or vimentin, white arrows; blue, DAPI nuclear stain). Scale bars, 1µm. Colocalization of expression with α-sma (e) and vimentin (f) positive cells (white arrows) within Control or shcxcl16 tumours grown CXCR6 +/+ mice. DAPI nuclear stain. Scale bar, 1µm.

6 a b Prostate Tissue Benign Gleason 4+5 s.c. PCa implantation () H&E EMT formation in tumours (CXCR6 +/+ or CXCR6 -/- mice) c P <.1 P = P =.3.12 P = P <.1.16 E-Cadherin mrna CXCR4 mrna.5 CXCR4Ab AMD31 CXCR4Ab AMD31 WT EMT e P =.7.4 CXCR4Ab AMD31 CXCR4Ab AMD31 WT EMT P =.1 P =.6 2. N-Cadherin mrna d P <.1 P = CXCR4Ab AMD31 WT CXCR4Ab AMD31 EMT Supplementary Figure S4: EMT formation in prostate tumours and CXCR4 inhibitors reduce the induction of an EMT phenotype in vitro. (a) Experimental scheme of cell implantation to CXCR6 +/+ or CXCR6 -/- mice for examining EMT formation in tumours. (b) H&E staining for human prostate cancer tissue microarray in Fig. 4d. Scale bars, 1 µm. (c-e) mrna expression of CXCR4, E- cadherin, and N-cadherin in the WT and EMT cells following treatment with CXCR4 inhibitors in vitro. Data in (c-e) are representative of mean with s.d. for triplicates in each of three independent experiments (Student's t-test).

7 (pg ml ) -1 a IgG/DAPI Control RFP IgG/DAPI b Incubation of WT cells or EMT cells with, AMD31 in vitro i.c. injection WT cells or EMT cells RFP/DAPI RFP/DAPI Tumour metastasis 1 Days (CXCR6 +/+ or CXCR6 -/- mice) c Calvaria Mandible Spine Pelvis Humerus Femur Tibia Blood Supplementary Figure S5: Experimental scheme of prostate tumour metastasis and the levels of secretion in murine tissues. (a) Verification that RFP expression following lentiviral transduction. Expression of RFP protein was confirmed in cells. Scale bars, 1µm. (b) Experimental scheme of WT or EMT cell implantation to CXCR6 +/+ or CXCR6 -/- mice for examining tumour metastasis. (c) levels in murine tissues were identified by ELISA (n = 3 independent experiments).

8 Supplementary Table S1. Frequency of MSCs recruited into tumours. Exp. Cells Implantation Animal Tumour harvest % MSC cells Fold change P value (day) (mean + s.d.) 4 1 (1x1 ) s.c. CXCR6 +/+ (male) (n=7) (1x14) s.c. CXCR6 -/- (male) (n=7) Cotrol (1x1 4) s.c. CXCR6 +/+ (male) (n=5) shcxcl16 (1x14) s.c. CXCR6 +/+ (male) (n=5) RWPE-1(2x1 5) orthotopic SCID (male) (n=3) PC3 (2x15) orthotopic SCID (male) (n=4) C4-2B (2x15) orthotopic SCID (male) (n=3) NMPE (5x1 ) orthotopic (male) (n=5) (5x14) orthotopic (male) (n=3) Tramp (5x1 5) orthotopic (male) (n=3) MCF-1A (1x16) orthotopic SCID (female) (n=5) MCF-7 (1x16) orthotopic SCID (female) (n=5) Significance was determined using a Student's t-test. - -

9 Supplementary Methods RNA analysis and qrt-pcr. RNA was isolated using RNeasy Mini or Micro Kit (Qiagen, Valencia, CA). First-strand cdna synthesis and qrt-pcr were performed according to the directions of manufacturer (Applied Biosystems, Foster City, CA). Taqman predeveloped assay reagents were used for detection of CXCR6 (Mm472858_m1, Hs174843_m1), CXCL16 (Mm469712_m1, Hs222859_m1), CXCR4 (Mm _m1), E-cadherin (Mm _m1), N-cadherin (Mm483213_m1), α-sma (Mm _m1), vimentin (Mm133343_m1), and β-actin (Mm67939_s1, Hs _m1) (FAM/MGB probes, Applied Biosystems, Carlsbad, CA). Real-time detection of PCR products was performed using an ABI PRISM 77 sequence detector (Applied Biosystems). The qrt-pcr product and mrna expression were normalized to β-actin. RNA interference. Stable cell lines expressing pgipz lentiviral shrna constructs for scrambled and mouse CXCL16 were generated by the University of Michigan Vector Core, Ann Arbor, MI. Plasmids were co-transfected with pspax2 and pmd2.g into HEK-293T cells using CaPO 4. Supernatants were collected after 6 h and used to infect to the cells. Infected cells were selected for 7 days in RPMI medium containing supplemented with 1% FBS and 1 g ml -1 puromycin. qrt- PCR or ELISA analyzed silenced CXCL16. Fluorescence-activated cell sorting isolated the high levels of GFP expressing cells. ELISA. ELISAs were used to quantify and CXCL16 expression in conditioned media and isolated from the extracellular milieu from tumour masses (cat. DY35, DCX16, and DY54, R&D Systems, Minneapolis, MN). In some cases cells were serum-starved overnight, and 1 ng ml -1 CXCL16 or 2 ng ml -1 was added for 24 h either in the presence or absence of selective pathway inhibitors; MEK inhibitor U126 (cat. 6625, Calbiochem, La Jolla, CA), p38 inhibitor SB2358 (SB, cat , Calbiochem), JNK inhibitor SP6125 (SP, cat , Calbiochem), IKK-2 inhibitor VI (IKKI, cat , Calbiochem), and mtor inhibitor

10 rapamycin (RAPA, cat. 994, Cell Signaling, Danvers, MA). and CXCL16 levels were normalized to total protein (cat , BioRad, Hercules, CA). Coculture of Prostate cancer cells with MSCs. cells were cocultured with mouse bone marrow derived-mscs (P 2 ) from CXCR6 +/+ or CXCR6 -/- mice. MSCs (2x1 4 ) from CXCR6 +/+ or CXCR6 -/- mice were placed into the top chambers of 24-well Transwell plates (.4 m, polycarbonate, Corning Life Sciences, Lowell, MA). prostate cancer cells were plated at a final density of 2x1 4 /well in serum-free RPMI into the bottom chambers of the plates. Coculture systems were maintained for 3-7 days. Transwell chemotaxis assays. MSCs (P or P 2 ) from CXCR6 +/+ or CXCR6 -/- mice were resuspended in serum-free α-mem or DMEM and equilibrated for 1 min at 37 C. Cells were loaded into the top chambers of 5-8 μm Transwell microporous membrane 24-well plates (Costar Corp, Cambridge, MA). Mouse CXCL16 protein (-1 ng ml -1, cat. 53-CX, R&D system), (2 ng ml -1, cat. 35- NS, R&D system) or 1% serum were added into the bottom chamber. At 3h the number of cells, which had migrated, was determined by trypan blue. In some cases the cells were labeled with 2.5 μg ml -1 of the lipophilic dye carboxyfluorescein diacetate (CFDA, cat. V12883, Molecular Probes, Eugene, OR) to facilitate enumeration. AMD31, a selective CXCR4 antagonist (4 ng ml -1, cat. A562, Sigma, St. Louis, MO), anti-cxcr4 antibody (25 μg ml -1, cat. MAB21651, R&D Systems) or an IgG control antibody was included.

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

TMA-VARESE COHORT-1 TMA-BERN COHORT-2

TMA-VARESE COHORT-1 TMA-BERN COHORT-2 Supplementary Figure 1 TMA-VARESE COHORT-1 TOTAL SAMPLES #5 GLEASON SCORE Number Percentage 6 16 32% = 7 17 34% >7 17 34% TUMOR STAGE T2C 28 56% T3A- 21 42% T3C-T4 1 2% NODE STATUS N 42 84% N1 8 16% PSA

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian

More information

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ± Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Supplementary Data. Supplementary Methods:

Supplementary Data. Supplementary Methods: Supplementary Data Supplementary Methods: Cell viability assay. Cells were seeded overnight at a density of 2,000 cells per well in 96-well plates in RPMI with 10% FBS and then treated with the relevant

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplementary data Supplementary Figure 1 Supplementary Figure 2 Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by

More information

Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and

Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast

More information

Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas

Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Wang et al. Journal of Hematology & Oncology (2016) 9:90 DOI 10.1186/s13045-016-0323-9 RESEARCH Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Open Access Xiaofeng

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

More information

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

Supplementary Data Table of Contents:

Supplementary Data Table of Contents: Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary

More information

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.

More information

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed

More information

ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1

ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor

More information

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette

More information

Pathologic Stage. Lymph node Stage

Pathologic Stage. Lymph node Stage ASC ASC a c Patient ID BMI Age Gleason score Non-obese PBMC 1 22.1 81 6 (3+3) PBMC 2 21.9 6 6 (3+3) PBMC 3 22 84 8 (4+4) PBMC 4 24.6 68 7 (3+4) PBMC 24. 6 (3+3) PBMC 6 24.7 73 7 (3+4) PBMC 7 23. 67 7 (3+4)

More information

Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen,

Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen, Cell Stem Cell, Volume 7 Supplemental Information Adult SVZ Lineage Cells Home to and Leave the Vascular Niche via Differential Responses to SDF1/CXCR4 Signaling Erzsebet Kokovay, Susan Goderie, Yue Wang,

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed

More information

Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS

Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS 3D culture and cell proliferation- MiaPaCa-2 cell culture in 3D was performed as described previously (1). Briefly, 8-well glass chamber slides were evenly coated with 50 µl/well

More information

Supplemental Table S1

Supplemental Table S1 Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected

More information

The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells

The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells 1 SUPPLEMENTARY INFORMATION The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells Karin Loser 1,2,6, Thomas Vogl 2,3, Maik Voskort 1, Aloys

More information

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,

More information

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine 1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from

More information

Influenza virus exploits tunneling nanotubes for cell-to-cell spread

Influenza virus exploits tunneling nanotubes for cell-to-cell spread Supplementary Information Influenza virus exploits tunneling nanotubes for cell-to-cell spread Amrita Kumar 1, Jin Hyang Kim 1, Priya Ranjan 1, Maureen G. Metcalfe 2, Weiping Cao 1, Margarita Mishina 1,

More information

SREBP-2 promotes stem cell-like properties and metastasis by transcriptional activation of c-myc in prostate cancer

SREBP-2 promotes stem cell-like properties and metastasis by transcriptional activation of c-myc in prostate cancer SREBP-2 promotes stem cell-like properties and metastasis by transcriptional activation of c-myc in prostate cancer Supplementary Material Supplementary Methods Supplementary References Supplementary Figure

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained

More information

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2

More information

Protocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening

Protocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening Protocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening Introduction: Vimentin (VIM) intermediate filament (IF) proteins are associated with EMT in lung cancer and its metastatic

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

TITLE: Crosstalk Between Cancer Cells and Bones Via the Hedgehog Pathway Determines Bone Metastasis of Breast Cancer

TITLE: Crosstalk Between Cancer Cells and Bones Via the Hedgehog Pathway Determines Bone Metastasis of Breast Cancer AD Award Number: W81XWH-07-1-0400 TITLE: Crosstalk Between Cancer Cells and Bones Via the Hedgehog Pathway Determines Bone Metastasis of Breast Cancer PRINCIPAL INVESTIGATOR: Dr. Lalita Shevde-Samantrese

More information

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,

More information

Nature Medicine: doi: /nm.3922

Nature Medicine: doi: /nm.3922 Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun

More information

Supplemental Material:

Supplemental Material: Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection

More information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances

More information

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2

Department of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2 Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji

More information

Monoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis and castration resistance

Monoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis and castration resistance Monoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis and castration resistance Tanaka H, Kono E, Tran CP, Miyazaki H, Yamashiro J, Shimomura T, Ladan F, Wada R, Huang

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete

More information

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny

More information

Supplementary information

Supplementary information Supplementary information Exosomes mediate the cell-to-cell transmission of interferon alpha-induced antiviral activity Jianhua Li, Kuancheng Liu, Yang Liu, Yan Xu, Fei Zhang, Huijuan Yang, Jiangxia Liu,

More information

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as

Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC

More information

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±

More information

Stem cells and Cancer. John Glod. December 2, 2009

Stem cells and Cancer. John Glod. December 2, 2009 Stem cells and Cancer John Glod Lehigh University Lehigh University December 2, 2009 The Tumor Microenvironment Littlepage et al Cancer Cell 2005 Cancer Stem Cells A small group of cells within the larger

More information

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time

More information

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY FIGURES AND TABLE SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).

More information

Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.

Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence. Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the mutated sequence. 1 Supplementary Figure 2. Expression of mir-182 and SMAD7 in various cell lines. (A) Basal levels of mir-182 expression

More information

TITLE: Inhibition of Prostate Cancer Skeletal Metastases by Targeting Cathepsin K

TITLE: Inhibition of Prostate Cancer Skeletal Metastases by Targeting Cathepsin K AD Award Number: W81XWH-07-1-0028 TITLE: Inhibition of Prostate Cancer Skeletal Metastases by Targeting Cathepsin K PRINCIPAL INVESTIGATOR: Jian Zhang, M.D., Ph.D. CONTRACTING ORGANIZATION: University

More information

MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA

MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10

More information

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!

GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9! Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain

More information

Supplemental figures

Supplemental figures Supplemental figures Supplemental Figure 1. Impact of immunogenic-llc tumors (LLC-OVA) on peripheral OVA-specific CD8 T cells. Tetramer analysis showing percent OVA-specific CD8 T cells in peripheral blood

More information

Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1

Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1 1 Supporting Information 2 3 4 Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene induction necessitates canonical NF-κB activation through TBK1 5 6 Authors: Abe et al. 7 8 9 Supporting

More information

Supplemental Tables and Figures. The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate,

Supplemental Tables and Figures. The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate, Supplemental Tables and Figures The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate, tendon-specific protective mechanism against heterotopic ossification Timothy Mead et al Supplemental

More information

Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated

Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated with the H3K27me3 mark in chondrocytes (see Table S1,

More information

Supplemental information

Supplemental information Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental

More information

Peli1 negatively regulates T-cell activation and prevents autoimmunity

Peli1 negatively regulates T-cell activation and prevents autoimmunity Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang

More information

GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin

GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin Supplementary Fig. 1 a CQ treatment ScrB OGX11 MG132 I II AZD5363 I II b GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin ctrl CQ GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin rapamycin rapamycincq

More information

The Role of CD164 in Metastatic Cancer Aaron M. Havens J. Wang, Y-X. Sun, G. Heresi, R.S. Taichman Mentor: Russell Taichman

The Role of CD164 in Metastatic Cancer Aaron M. Havens J. Wang, Y-X. Sun, G. Heresi, R.S. Taichman Mentor: Russell Taichman The Role of CD164 in Metastatic Cancer Aaron M. Havens J. Wang, Y-X. Sun, G. Heresi, R.S. Taichman Mentor: Russell Taichman The spread of tumors, a process called metastasis, is a dreaded complication

More information

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding

More information

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong

More information

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,

Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, 1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed

More information

Figure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h

Figure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h Figure S1 Time-dependent down-modulation of HER3 by EZN-392 HE ER3 mrna A, %Contr rol 12 No Treatment EZN-392, 2 μm 1 8 6 4 2 2 8 24 Time, h Figure S2. Specific target down-modulation by HER3 (EZN-392)

More information

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6. Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,

More information

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- 1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,

More information

Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs

Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing

More information

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells

More information

Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h)

Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) after feeding. A small slice (~5-1 mm 3 ) was taken

More information

Supplementary Figure 1

Supplementary Figure 1 A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73

More information

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade

More information

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4

More information

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG

p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:

More information

Supplementary Figure 1

Supplementary Figure 1 CD31 FN Supplementary Figure 1 a Multivariate Cox regression analysis of predicting factors for disease-free and overall survival in 435 HNSCC patients b FN staining in whole sections of HNSCC c FN expression

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis

More information

Nature Immunology: doi: /ni.3866

Nature Immunology: doi: /ni.3866 Nature Immunology: doi:10.1038/ni.3866 Supplementary Figure 1 The effect of TIPE2 on chemotaxis. a, The expression of TIPE2 in dhl-60c, dhl-60t, TIPE2-expressing and 15/16Q-expressing dhl-60t neutrophils

More information

Data Sheet. NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621

Data Sheet. NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621 Data Sheet NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621 Background The nuclear factor of activator T cells (NFAT) family of transcription factors plays an important role in immune response. T

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass

More information

PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65

PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer

More information

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic

More information