Supplementary Information
|
|
- Gilbert Thompson
- 6 years ago
- Views:
Transcription
1 Supplementary Information Recruitment of Mesenchymal Stem Cells Into Prostate Tumours Promotes Metastasis Younghun Jung 1, Jin Koo Kim 1, Yusuke Shiozawa 1, Jingcheng Wang 1, Anjali Mishra 1, Jeena Joseph 1, Janice E. Berry 1, Samantha McGee 1, Eunsohl Lee 1, Hongli Sun 2, Jianhua Wang 3, Taocong Jin 4, Honglai Zhang 5, Jinlu Dai 5, Paul H. Krebsbach 2, Evan T. Keller 5, Kenneth J. Pienta 5, and Russell S. Taichman 1, 1 Department of Periodontics and Oral Medicine, University of Michigan School of Dentistry, Ann Arbor, MI 4819, USA. 2 Department of Biologic and Materials Sciences, University of Michigan School of Dentistry, Ann Arbor, MI 4819, USA. 3 Institute of Medical Sciences, Shanghai Jiao-Tong University School of Medicine, Shanghai 225, P.R. China. 4 Department of Cariology, Restorative Sciences and Endodontics, University of Michigan School of Dentistry, Ann Arbor, MI 4819, USA. 5 Departments of Urology and Internal Medicine, University of Michigan Medical School, Ann Arbor, MI 4819, USA. Supplementary Figures S1-S5 Supplementary Table S1 Supplementary Methods
2 a Undifferentiated MSC Alizarin Red S/Oil Red O/ Alcian Blue Alcian Blue c Prostate Tissue d CXCL16/DAPI CXCL16/DAPI CXCL16/DAPI CXCL16/DAPI f P <.1.5 g P < MC3T3-E1 s.c. PCa implantation () Tumour growth MSC cell recruitment to tumours (CXCR6 +/+ or CXCR6 -/- mice) k NMPE % MSC cells in marrow MCF-7 i Tramp MCF-1A MCF-7 2 RWPE-1 PC3 C4-2B CXCR16 CXCR6 (RWPE-1, PC3, C4-2B/ NMPE,, Tramp/ MCF-1A, MCF-7) MSC cell recruitment to tumours.4 CXCR6 +/+ CXCR6 -/- (SCID or CXCR6 +/+ mice) m P =.22 P = Orthotopic cancer cell implantation.12 l P <.1 P <.1 P <.1.2 j n.s..16 % MSC cells in tumour MCF-1A % MSC cells in tumour.5 C4-2B LNCaP DU145 PC3 mrna of cells 1 4 HOB RWPE mcxcl16 mrna hcxcl16 (ng ml -1 ).1 Gleason 8+9 Gleason 6+7 h hcxcl16 mrna Gleason 4+5 hcxcl16 mrna Normal prostate P <.1 P <.1.3 e Chondrogenic conditions Adipogenic conditions Oil Red O NMPE Tramp % MSC cells in tumour b Osteoblastic conditions Alizarin Red S P = MCF-1A MCF-7
3 n s.c.tumour CXCR6 +/+ CXCR6 -/ p s.c.tumour CXCR6 +/+ Control SCID SCID SCID C4-2B PC3 CXCR6 +/+ shcxcl16 q Orthotopic tumour (prostate) RWPE-1 r o Orthotopic tumour (prostate) NMPE Tramp Orthotopic tumour (fat pad) SCID MCF-1A SCID MCF-7 Supplementary Figure S1: Expression of CXCL16 by prostate cancers and breast cancers and MSC cell recruitment into tumours in orthotopic animal models. (a) Differentiation of murine MSCs into osteoblasts, adipocytes, and chondrocytes was confirmed by staining of Alizarin Red S, Oil Red O, and Alcian Blue, respectively. Scale bars, 5µm. (b) Immunohistochemistry (IHC) staining for the expression of CXCL16 (red, white arrows) in human prostate cancer tissue microarray is correlated with aggressive phenotype. Blue, DAPI nuclear stain. Scale bars, 1 µm. (c) CXCL16 mrna by human prostate cancer cell lines was determined by qrt-pcr. (d) CXCL16 mrna, and (e) CXCL16 secretion by human breast cancer cell lines were determined by qrt-pcr or ELISA. (f) CXCL16 mrna by murine prostate cancer cell lines was determined by qrt -PCR. (g) mrna levels for CXCR16 and CXCR6 by cells were determined by qrt-pcr. Data in (c-g) are representative of mean with s.d. for triplicates in each of three independent experiments (Student s t -test). (h) Experimental scheme of cell implantation to CXCR6 +/+ or CXCR6 -/- mice for examining tumour growth and MSC cell recruitment to tumours. (i) % MSC ( Lin - Sca-1+CD45 -) present in the bone marrow of CXCR6 +/+ or CXCR6 -/- mice (mean±s.d., n = 3 independent experiments, Student s t-test). n.s., not significant. (j) Experimental scheme of human and murine prostate cancer and human breast cancer cell orthotopic implantation to in the prostate or fat pad of SCID or C57BL/6 (CXCR6 +/+ ) mice for examining tumour growth and MSC cell recruitment to tumours. (k-m) % MSCs present in human and murine prostate tumours, and human breast tumours were grown in the prostate or fat pad of SCID or C57BL/6 (CXCR6 +/+) mice (error bars represent mean±s.d. for 3-5 animals/group, n = 1independent experiment, Student's t-test). (n-r) Tumours from various animal experiments (Supplementary Table S1) were stained by H&E. Scale bars, 1 µm.
4 b 16 Tramp f MSC P2 CXCR6 -/- h RAPA 2 g -1 (pg ml ) 4 IKKI P <.1 6 SB CXCL16 (1 ng ml -1) 1 m 8 SP H&E 1 µm P <.1 P <.1 U126 CXCR6 +/+ Gleason 4+5 e Prostate Tissue Benign (CXCR6 +/+ or CXCR6 -/- mice) NMPE CM: Tramp IKKI d 4 RAPA CAF formation in tumours 8 SP.1 CM: NMPE MSCP2 CXCR6-/MSCP () SB.3 s.c. PCa implantation U126 MSCP2 CXCR6-/MSCP2-1 (pg ml ).4 c P =.19 P =.7 P =.18 P =.37 Vimentin mrna a -SMA mrna a CXCL16 (1ng ml -1) MSC P2 U U126 IKKI U126+IKKI 1nM 5nM 1nM IKKI 25nM 5nM U126+IKKI CXCL16 (1ng ml -1 ) Supplementary Figure S2: Conditioned media by prostate cancer cells promote the generation of CAF and by CAFs was regulated through Erk and NF-kB signaling. MSCs isolated from CXCR6 +/+ or CXCR6-/- mice (P2 ) were exposed to murine prostate cancer cell conditioned media for 7 days. The expression of a-sma (a), and vimentin (b) mrna were evaluated. Data in (a,b) are representative of mean with s.d. for triplicates in each of three independent experiments (Student's t-test). (c) Experimental scheme of cells into CXCR6 +/+ or CXCR6-/- mice for examining CAF formation in tumours. (d) H&E staining for human prostate cancer tissue microarray in Fig. 2h. Scale bars, 1 µm. (e) Expression of (green, white arrows) from MSC cells or MSC CXCR6-/- cells were observed following exogenous CXCL16 treatment by IHC. Blue, DAPI nuclrea stain. Scale bars, 1 µm. (f) Erk and NFkB signaling are both required for induction of. production was stimulated by treating MSC cells with the presence or absence of CXCL16 in U126, SB2358 (SB), SP6125 (SP), IKK-2 inhibitor VI (IKKI), or rapamycin (RAPA). production was quantified by ELISA. (g) ELISA confirmed signaling by the inhibitors, U126, IKK-2 inhibitor VI (IKKI), and combination of U126 and IKK-2 inhibitor VI (IKKI). Data in (f,g) are representative of mean with s.d. for triplicates in each of three independent experiments (Student's t-test). (h) IHC staining confirmed (green, white arrows) by the inhibitors, U126, IKK-2 inhibitor VI (IKKI), and combination of U126 and IKK-2 inhibitor VI (IKKI). Scale bars, 1µm. implantation to (c) +/+ CXCR6 or
5 a b P =.16 a -SMA mrna Vimentin mrna P = Control CM: MSC.2.1 CM: shcxcl MSC Control MSC shcxcl16 MSC d c Tumour s.c. PCa implantation a-sma/dapi Vimentin CAF formation in tumours (CXCR6 +/+ mice) a -SMA a-sma/ / DAPI DAPI Control Vimentin/DAPI Tumour Vimentin shcxcl16 shcxcl16 Control a -SMA a -SMA a-sma/ a-sma/ / Vimentin/DAPI f Tumour a-sma/dapi a -SMA (Control or shcxcl16 ) e shcxcl16 Control Vimentin Vimentin Vimentin/ Vimentin/ / DAPI Vimentin/ / DAPI Supplementary Figure S3: knockdown of CXCL16 in prostate cancer cells reduces generation of CAF. MSCs isolated from CXCR6 +/+ mice (P 2) were exposed to Control or shcxcl16 cell conditioned media for 7 days. The a- SMA (a) and vimentin (b) mrna were evaluated. Data in (a,b) are representative of mean with s.d. for triplicates in each of three independent experiments (Student's t-test). (c) Experimental scheme of Control or shcxcl16 cell implantation to CXCR6 +/+ mice for examining CAF formation in tumors. (d) IHC of localization of a -SMA and vimentin positive cells within Control or shcxc L16 tumours grown in CXCR6 +/+ mice (red, a -SMA or vimentin, white arrows; blue, DAPI nuclear stain). Scale bars, 1µm. Colocalization of expression with α-sma (e) and vimentin (f) positive cells (white arrows) within Control or shcxcl16 tumours grown CXCR6 +/+ mice. DAPI nuclear stain. Scale bar, 1µm.
6 a b Prostate Tissue Benign Gleason 4+5 s.c. PCa implantation () H&E EMT formation in tumours (CXCR6 +/+ or CXCR6 -/- mice) c P <.1 P = P =.3.12 P = P <.1.16 E-Cadherin mrna CXCR4 mrna.5 CXCR4Ab AMD31 CXCR4Ab AMD31 WT EMT e P =.7.4 CXCR4Ab AMD31 CXCR4Ab AMD31 WT EMT P =.1 P =.6 2. N-Cadherin mrna d P <.1 P = CXCR4Ab AMD31 WT CXCR4Ab AMD31 EMT Supplementary Figure S4: EMT formation in prostate tumours and CXCR4 inhibitors reduce the induction of an EMT phenotype in vitro. (a) Experimental scheme of cell implantation to CXCR6 +/+ or CXCR6 -/- mice for examining EMT formation in tumours. (b) H&E staining for human prostate cancer tissue microarray in Fig. 4d. Scale bars, 1 µm. (c-e) mrna expression of CXCR4, E- cadherin, and N-cadherin in the WT and EMT cells following treatment with CXCR4 inhibitors in vitro. Data in (c-e) are representative of mean with s.d. for triplicates in each of three independent experiments (Student's t-test).
7 (pg ml ) -1 a IgG/DAPI Control RFP IgG/DAPI b Incubation of WT cells or EMT cells with, AMD31 in vitro i.c. injection WT cells or EMT cells RFP/DAPI RFP/DAPI Tumour metastasis 1 Days (CXCR6 +/+ or CXCR6 -/- mice) c Calvaria Mandible Spine Pelvis Humerus Femur Tibia Blood Supplementary Figure S5: Experimental scheme of prostate tumour metastasis and the levels of secretion in murine tissues. (a) Verification that RFP expression following lentiviral transduction. Expression of RFP protein was confirmed in cells. Scale bars, 1µm. (b) Experimental scheme of WT or EMT cell implantation to CXCR6 +/+ or CXCR6 -/- mice for examining tumour metastasis. (c) levels in murine tissues were identified by ELISA (n = 3 independent experiments).
8 Supplementary Table S1. Frequency of MSCs recruited into tumours. Exp. Cells Implantation Animal Tumour harvest % MSC cells Fold change P value (day) (mean + s.d.) 4 1 (1x1 ) s.c. CXCR6 +/+ (male) (n=7) (1x14) s.c. CXCR6 -/- (male) (n=7) Cotrol (1x1 4) s.c. CXCR6 +/+ (male) (n=5) shcxcl16 (1x14) s.c. CXCR6 +/+ (male) (n=5) RWPE-1(2x1 5) orthotopic SCID (male) (n=3) PC3 (2x15) orthotopic SCID (male) (n=4) C4-2B (2x15) orthotopic SCID (male) (n=3) NMPE (5x1 ) orthotopic (male) (n=5) (5x14) orthotopic (male) (n=3) Tramp (5x1 5) orthotopic (male) (n=3) MCF-1A (1x16) orthotopic SCID (female) (n=5) MCF-7 (1x16) orthotopic SCID (female) (n=5) Significance was determined using a Student's t-test. - -
9 Supplementary Methods RNA analysis and qrt-pcr. RNA was isolated using RNeasy Mini or Micro Kit (Qiagen, Valencia, CA). First-strand cdna synthesis and qrt-pcr were performed according to the directions of manufacturer (Applied Biosystems, Foster City, CA). Taqman predeveloped assay reagents were used for detection of CXCR6 (Mm472858_m1, Hs174843_m1), CXCL16 (Mm469712_m1, Hs222859_m1), CXCR4 (Mm _m1), E-cadherin (Mm _m1), N-cadherin (Mm483213_m1), α-sma (Mm _m1), vimentin (Mm133343_m1), and β-actin (Mm67939_s1, Hs _m1) (FAM/MGB probes, Applied Biosystems, Carlsbad, CA). Real-time detection of PCR products was performed using an ABI PRISM 77 sequence detector (Applied Biosystems). The qrt-pcr product and mrna expression were normalized to β-actin. RNA interference. Stable cell lines expressing pgipz lentiviral shrna constructs for scrambled and mouse CXCL16 were generated by the University of Michigan Vector Core, Ann Arbor, MI. Plasmids were co-transfected with pspax2 and pmd2.g into HEK-293T cells using CaPO 4. Supernatants were collected after 6 h and used to infect to the cells. Infected cells were selected for 7 days in RPMI medium containing supplemented with 1% FBS and 1 g ml -1 puromycin. qrt- PCR or ELISA analyzed silenced CXCL16. Fluorescence-activated cell sorting isolated the high levels of GFP expressing cells. ELISA. ELISAs were used to quantify and CXCL16 expression in conditioned media and isolated from the extracellular milieu from tumour masses (cat. DY35, DCX16, and DY54, R&D Systems, Minneapolis, MN). In some cases cells were serum-starved overnight, and 1 ng ml -1 CXCL16 or 2 ng ml -1 was added for 24 h either in the presence or absence of selective pathway inhibitors; MEK inhibitor U126 (cat. 6625, Calbiochem, La Jolla, CA), p38 inhibitor SB2358 (SB, cat , Calbiochem), JNK inhibitor SP6125 (SP, cat , Calbiochem), IKK-2 inhibitor VI (IKKI, cat , Calbiochem), and mtor inhibitor
10 rapamycin (RAPA, cat. 994, Cell Signaling, Danvers, MA). and CXCL16 levels were normalized to total protein (cat , BioRad, Hercules, CA). Coculture of Prostate cancer cells with MSCs. cells were cocultured with mouse bone marrow derived-mscs (P 2 ) from CXCR6 +/+ or CXCR6 -/- mice. MSCs (2x1 4 ) from CXCR6 +/+ or CXCR6 -/- mice were placed into the top chambers of 24-well Transwell plates (.4 m, polycarbonate, Corning Life Sciences, Lowell, MA). prostate cancer cells were plated at a final density of 2x1 4 /well in serum-free RPMI into the bottom chambers of the plates. Coculture systems were maintained for 3-7 days. Transwell chemotaxis assays. MSCs (P or P 2 ) from CXCR6 +/+ or CXCR6 -/- mice were resuspended in serum-free α-mem or DMEM and equilibrated for 1 min at 37 C. Cells were loaded into the top chambers of 5-8 μm Transwell microporous membrane 24-well plates (Costar Corp, Cambridge, MA). Mouse CXCL16 protein (-1 ng ml -1, cat. 53-CX, R&D system), (2 ng ml -1, cat. 35- NS, R&D system) or 1% serum were added into the bottom chamber. At 3h the number of cells, which had migrated, was determined by trypan blue. In some cases the cells were labeled with 2.5 μg ml -1 of the lipophilic dye carboxyfluorescein diacetate (CFDA, cat. V12883, Molecular Probes, Eugene, OR) to facilitate enumeration. AMD31, a selective CXCR4 antagonist (4 ng ml -1, cat. A562, Sigma, St. Louis, MO), anti-cxcr4 antibody (25 μg ml -1, cat. MAB21651, R&D Systems) or an IgG control antibody was included.
Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationTMA-VARESE COHORT-1 TMA-BERN COHORT-2
Supplementary Figure 1 TMA-VARESE COHORT-1 TOTAL SAMPLES #5 GLEASON SCORE Number Percentage 6 16 32% = 7 17 34% >7 17 34% TUMOR STAGE T2C 28 56% T3A- 21 42% T3C-T4 1 2% NODE STATUS N 42 84% N1 8 16% PSA
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationSupplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier
Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian
More informationwell for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationSupplementary Data. Supplementary Methods:
Supplementary Data Supplementary Methods: Cell viability assay. Cells were seeded overnight at a density of 2,000 cells per well in 96-well plates in RPMI with 10% FBS and then treated with the relevant
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
More informationSupplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast
More informationBmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas
Wang et al. Journal of Hematology & Oncology (2016) 9:90 DOI 10.1186/s13045-016-0323-9 RESEARCH Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Open Access Xiaofeng
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationSupplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationSupplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
More informationRNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
More informationhexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
More informationECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1
ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
More informationSupplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
More informationPathologic Stage. Lymph node Stage
ASC ASC a c Patient ID BMI Age Gleason score Non-obese PBMC 1 22.1 81 6 (3+3) PBMC 2 21.9 6 6 (3+3) PBMC 3 22 84 8 (4+4) PBMC 4 24.6 68 7 (3+4) PBMC 24. 6 (3+3) PBMC 6 24.7 73 7 (3+4) PBMC 7 23. 67 7 (3+4)
More informationErzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen,
Cell Stem Cell, Volume 7 Supplemental Information Adult SVZ Lineage Cells Home to and Leave the Vascular Niche via Differential Responses to SDF1/CXCR4 Signaling Erzsebet Kokovay, Susan Goderie, Yue Wang,
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
More informationImpact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS 3D culture and cell proliferation- MiaPaCa-2 cell culture in 3D was performed as described previously (1). Briefly, 8-well glass chamber slides were evenly coated with 50 µl/well
More informationSupplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
More informationThe toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells
1 SUPPLEMENTARY INFORMATION The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells Karin Loser 1,2,6, Thomas Vogl 2,3, Maik Voskort 1, Aloys
More informationSupplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation
Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,
More informationElectron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
More informationInfluenza virus exploits tunneling nanotubes for cell-to-cell spread
Supplementary Information Influenza virus exploits tunneling nanotubes for cell-to-cell spread Amrita Kumar 1, Jin Hyang Kim 1, Priya Ranjan 1, Maureen G. Metcalfe 2, Weiping Cao 1, Margarita Mishina 1,
More informationSREBP-2 promotes stem cell-like properties and metastasis by transcriptional activation of c-myc in prostate cancer
SREBP-2 promotes stem cell-like properties and metastasis by transcriptional activation of c-myc in prostate cancer Supplementary Material Supplementary Methods Supplementary References Supplementary Figure
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationCells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
More informationSupplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationSupplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
More informationAn epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
More informationEPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
More informationProtocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening
Protocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening Introduction: Vimentin (VIM) intermediate filament (IF) proteins are associated with EMT in lung cancer and its metastatic
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationTITLE: Crosstalk Between Cancer Cells and Bones Via the Hedgehog Pathway Determines Bone Metastasis of Breast Cancer
AD Award Number: W81XWH-07-1-0400 TITLE: Crosstalk Between Cancer Cells and Bones Via the Hedgehog Pathway Determines Bone Metastasis of Breast Cancer PRINCIPAL INVESTIGATOR: Dr. Lalita Shevde-Samantrese
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationNature Medicine: doi: /nm.3922
Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun
More informationSupplemental Material:
Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection
More informationS1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
More informationDepartment of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2
Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji
More informationMonoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis and castration resistance
Monoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis and castration resistance Tanaka H, Kono E, Tran CP, Miyazaki H, Yamashiro J, Shimomura T, Ladan F, Wada R, Huang
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationTbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
More informationSupplementary Table 1. Characterization of HNSCC PDX models established at MSKCC
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete
More informationSupplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION
Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny
More informationSupplementary information
Supplementary information Exosomes mediate the cell-to-cell transmission of interferon alpha-induced antiviral activity Jianhua Li, Kuancheng Liu, Yang Liu, Yan Xu, Fei Zhang, Huijuan Yang, Jiangxia Liu,
More informationSupplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±
More informationStem cells and Cancer. John Glod. December 2, 2009
Stem cells and Cancer John Glod Lehigh University Lehigh University December 2, 2009 The Tumor Microenvironment Littlepage et al Cancer Cell 2005 Cancer Stem Cells A small group of cells within the larger
More informationSupplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis
Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis (a) Immunohistochemical (IHC) analysis of tyrosine 705 phosphorylation status of STAT3 (P- STAT3) in tumors and stroma (all-time
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More informationSupplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the. mutated sequence.
Supplementary Figure 1. The mir-182 binding site of SMAD7 3 UTR and the mutated sequence. 1 Supplementary Figure 2. Expression of mir-182 and SMAD7 in various cell lines. (A) Basal levels of mir-182 expression
More informationTITLE: Inhibition of Prostate Cancer Skeletal Metastases by Targeting Cathepsin K
AD Award Number: W81XWH-07-1-0028 TITLE: Inhibition of Prostate Cancer Skeletal Metastases by Targeting Cathepsin K PRINCIPAL INVESTIGATOR: Jian Zhang, M.D., Ph.D. CONTRACTING ORGANIZATION: University
More informationMII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA
A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10
More informationSupplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationGFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!
Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain
More informationSupplemental figures
Supplemental figures Supplemental Figure 1. Impact of immunogenic-llc tumors (LLC-OVA) on peripheral OVA-specific CD8 T cells. Tetramer analysis showing percent OVA-specific CD8 T cells in peripheral blood
More informationTitle: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1
1 Supporting Information 2 3 4 Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene induction necessitates canonical NF-κB activation through TBK1 5 6 Authors: Abe et al. 7 8 9 Supporting
More informationSupplemental Tables and Figures. The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate,
Supplemental Tables and Figures The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate, tendon-specific protective mechanism against heterotopic ossification Timothy Mead et al Supplemental
More informationSupplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated
Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated with the H3K27me3 mark in chondrocytes (see Table S1,
More informationSupplemental information
Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental
More informationPeli1 negatively regulates T-cell activation and prevents autoimmunity
Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang
More informationGFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin
Supplementary Fig. 1 a CQ treatment ScrB OGX11 MG132 I II AZD5363 I II b GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin ctrl CQ GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin rapamycin rapamycincq
More informationThe Role of CD164 in Metastatic Cancer Aaron M. Havens J. Wang, Y-X. Sun, G. Heresi, R.S. Taichman Mentor: Russell Taichman
The Role of CD164 in Metastatic Cancer Aaron M. Havens J. Wang, Y-X. Sun, G. Heresi, R.S. Taichman Mentor: Russell Taichman The spread of tumors, a process called metastasis, is a dreaded complication
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationOncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
More informationSupplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
More informationFigure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h
Figure S1 Time-dependent down-modulation of HER3 by EZN-392 HE ER3 mrna A, %Contr rol 12 No Treatment EZN-392, 2 μm 1 8 6 4 2 2 8 24 Time, h Figure S2. Specific target down-modulation by HER3 (EZN-392)
More informationFigure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
More informationRAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
More informationSupplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationSupplementary Figure 1
Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
More informationSupplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing
More informationSupplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells
More informationOnline Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h)
Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) after feeding. A small slice (~5-1 mm 3 ) was taken
More informationSupplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More informationSupplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
More informationp = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
More informationSupplementary Figure 1
CD31 FN Supplementary Figure 1 a Multivariate Cox regression analysis of predicting factors for disease-free and overall survival in 435 HNSCC patients b FN staining in whole sections of HNSCC c FN expression
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis
More informationNature Immunology: doi: /ni.3866
Nature Immunology: doi:10.1038/ni.3866 Supplementary Figure 1 The effect of TIPE2 on chemotaxis. a, The expression of TIPE2 in dhl-60c, dhl-60t, TIPE2-expressing and 15/16Q-expressing dhl-60t neutrophils
More informationData Sheet. NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621
Data Sheet NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621 Background The nuclear factor of activator T cells (NFAT) family of transcription factors plays an important role in immune response. T
More informationSupplementary Figure 1.
Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass
More informationPKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65
SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer
More informationType of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
More information