Original Article Molecular mechanism of HEIH and HULC in the proliferation and invasion of hepatoma cells
|
|
- Sophia Marshall
- 6 years ago
- Views:
Transcription
1 Int J Clin Exp Med 2015;8(8): /ISSN: /IJCEM Original Article Molecular mechanism of HEIH and HULC in the proliferation and invasion of hepatoma cells Yaqiong Zhang 1,2, Zhaoyun Li 1,2, Yuetao Zhang 2, Qianyi Zhong 2, Qi Chen 2, Liming Zhang 2 1 Wenzhou Medical University, Wenzhou, Zhejiang, P. R. China; 2 Taizhou Central Hospital, Taizhou , Zhejiang, P. R. China Received May 21, 2015; Accepted July 11, 2015; Epub August 15, 2015; Published August 30, 2015 Abstract: Objective: To study the expression and molecular mechanism of long noncoding RNAs (lncrna) including HEIH and HULC in proliferation and invasion of hepatoma cells. Methods: We detected the expression of HEIH and HULC in hepatocellular carcinoma cell line (MHCC97L and HepG2), as well as in human normal hepatocyte line (chl-7702) by real-time PCR. Using MTT and transwell, we investigated the effect of HEIH and HULC on proliferation and invasion of hepatoma cells with sirna and expression plasmid. To explore the molecular mechanism, we use western blot to reveal the role of HEIH and HULC in tumor invasion related gene expression. Results: The expression of HEIH and HULC in hepatocellular carcinoma cell line was significantly increased compared with human normal hepatocyte line (P<0.05). The expression of HULC in HepG2 was higher than that in MHCC97L. The over-expression of HULC could enhance proliferation of MHCC97L and HepG2, however, the over-expression of HEIH could not. The over-expression of HULC and HEIH could promote invasion of MHCC97L and HepG2. Invasion of MHCC97L and HepG2 did not have significant change after down-regulating of HEIH and HULC by sirna. Over-expression of HULC up-regulated the expression of Snail in HepG2. Conclusions: The expression of HEIH and HULC increased significantly in hepatocellular carcinoma cell line compared with that in human normal hepatocyte line. HULC could promote proliferation of hepatoma cells. HEIH and HULC play an important role in the invasion of hepatocellular carcinoma cell. Keywords: HEIH, HULC, hepatocellular carcinoma, proliferation, invasion Introduction Long non-coding RNA (lncrna) is a kind of noncoding RNA with more than 200 nucleotides, which is considered to be the noise of genome transcription without biological function for a long time. However, recent studies revealed that lncrna played an important role in dosage compensation effect, epigenetic regulation, cell cycle, differentiation, and some other cell life activities. Thereby lncrna are widely involved in physiological and pathological process [1, 2]. Evidence has shown that lncrna participates in development and metastasis of tumor [3, 4]. Highly up-regulated in liver cancer (HULC) is an lncrna of 1.6 kb whose gene locates in chromosome 6p24.3 and contains 1 intron and 2 exons. HULC is considered to be the first specially upregulated non-coding RNA in liver cancer tissues [5, 6]. HULC can not only be detected in liver cancer tissues, but also in circulation of patients with hepatocellular carcinoma. Therefore, this kind of lncrna with highly specific expression might be applied to clinic as potential markers of hepatocellular carcinoma [7]. Another lncrna named lncrna high expression in hepatocellular carcinoma (lncrna-heih) have been found to be highly expressed in the patients with hepatitis B virus associated primary hepatocellular carcinoma. Researchers found that HEIH could inhibit cell differentiation in G0/G1 and supposed that HEIH might be a cancer-promoting lncrna which accelerated the carcinogenesis of hepatitis B virus related hepatocellular carcinoma. However, the mechanism remains unknown [8, 9]. Further studies found that the width and depth of biological activity that lncrna involved in were beyond our anticipation. lncrna can regulate gene transcription by different mechanism, especially the gene close to it. Marten et al. revealed that some kind of lncrna blocked the combination of transcription factor and promoter to inhibit the expression of this gene [10]. In addition to inhibition of gene expression, the
2 Table 1. The primers used in Real-time PCR Gene Accesion NO. Primer (5-3 ) LncRNA-HEIH NR_ F: CCTCTTGTGCCCCTTTCTT R: ATGGCTTCTCGCATCCTAT LncRNA-HULC AY F: AACCTCCAGAACTGTGAT R: CATAATTCAGGGAGAAAG GAPDH NM_ F: GAAGGTGAAGGTCGGAGTC R: GAAGATGGTGATGGGATTTC uid nitrogen. Hepatocellular carcinoma cell line HepG2 and human normal hepatocyte line chl-7702 was purchased from the Typical Culture Preservation Commission Cell Bank in Chinese Academy of Sciences and preserved in liquid nitrogen. Reagents and instrument Table 2. The synthetic system of inverse transcription Components 5 iscript reaction mix iscript reverse transciptase RNA template Nuclease-free water Table 3. The synthetic system of PCR Components SsoAdvanced SYBR Green Super mix Forward primer (10 μm) Reverse primer (10 μm) cdna template Nuclease-free water transcriptional inhibited silence of lncrna was essential in transcription of Hox gene [11]. The mechanism of IncRNA is not only inhibition and promoting, but also a sophisticated biological process. lncrna-heih and lncrna-hulc are related to hepatocellular carcinoma and were found upregulated in hepatocellular carcinoma [8, 12]. This study detected the expression of HEIH and HULC in hepatocellular carcinoma cell line (MHCC97L and HepG2), as well as in human normal hepatocyte line (chl-7702) by real-time PCR. Using MTT and transwell, we investigated the effect of HEIH and HULC on proliferation and invasion of hepatoma cells with sirna and expression plasmid. We investigated the expression of HEIH and HULC and its relationship with cell cycle associated protein to reveal the molecular mechanism of HEIH and HULC in tumor invasion of hepatocellular carcinoma. Materials and methods Cell line Volume per Reaction 4 μl 1 μl 1 μg Up to 20 μl Volume per Reaction 5 μl μl ( nm) μl ( nm) 100 ng Up to 10 μl Hepatocellular carcinoma cell line MHCC97L was purchased from ATCC and preserved in liq- RNA extraction kit (TRIzol Plus RNA Purification Kit) was purchased from Ambion TaqMan MicroRNA Reverse Transcription Kit was purchased from Applied Biosystems SsoAdvanced SY- BR Green Supermix was purchased from Bio Rad Primers of HEIH, HULC and GAPDH were synthesized by Sangon Biotech (Shanghai, China). Over-expression plasmid of HEIH and HULC were synthesized by Sagene (Guangzhou, China). Escherichia coli DH5α was preserved in our laboratory. Lipofectamine 3000 Transfection Reagent was purchased from invitrogen- L Transwell was purchased from Corning Matrigel (5 mg/ ml): was purchased from BD. MTT Cell Proliferation and Cytotoxicity Assay Kit was purchased from Beyotime (China). HRP-labeled secondary antibody was purchased from life technologies. Chemiluminescent Substrate Reagent Kit was purchased from life technologies. Snail antibody was purchased from Santa Cruz Biotechnology. CO 2 constant temperature unit (SANYO); optical microscope (OLYMPUS, BX53); ultraviolet spectrophotometer (Bio-Rad Headquarters, USA); instrument for polymerase chain reaction (Bio- Rad CFX96 Touch). Cell culture Cell line MHCC97L, HepG2 and HL-7702 were preserved in liquid nitrogen and were recovered in DMEM medium (GIBIC) with 10% fetal bovine serum (GIBIC) in 37 C with 5% CO 2. Real-time PCR After washing with PBS and trypsin digestion, the cells were collected by centrifugation. RNA was isolated from the collected cells and was Int J Clin Exp Med 2015;8(8):
3 Figure 1. The expression levels of lnc-rna HEIH and lnc-rna HULC in different cells. A: lnc-rna HEIH; B: lnc-rna HULC. analyzed using ultraviolet spectrophotometer. Total RNA was reverse transcribed to cdna using TaqMan MicroRNA Reverse Transcription Kit. According to the gene sequence of HEIH and HULC, primers were designed and synthesized by Sangon Biotech (Shanghai, China). The primer sequences for real-time PCR were showed in Table 1. For real-time PCR, SsoAdvanced SYBR Green Supermix was used according to the manufacturer s instructions with a Bio-Rad CFX96 Real-Time System. There were 3 replicates for each sample. Experimental cycle threshold (CT) values were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) measured on the same plate, and the fold differences in gene expression were determined using the 2 -ΔΔCT method. The melting curves were observed from 72 C to 95 C Tables 2, 3. Plasmid construction and transfection pcdna3.1 plasmid was synthesized by Sagene (Guangzhou, China). sirna was designed and synthesized by Ribobio (Guangzhou, China). Cells were seeded in a 96-well plate (5000 cells/ml). After cell attachment, adjust cell density to 70%-80% when transfection. Transfection solution was prepared according to manufacturer s instructions and then added to the plate. After 4-6 h, transfection solution was replaced by DMEM medium with 10% FBS. Cell proliferative and invasive assay Cell proliferative assay was performed according to manufacturer s instructions of MTT Cell Proliferation and Cytotoxicity Assay Kit. Matrigel was diluted to 1 mg/ml with cold DMEM medium without FBS and then diluted matrigel (100 μl) was added to the upper chambers in transwell. Transwell was incubated at 37 C and DMEM medium (200 μl/well) were added to chambers. After trypsinization, cells were suspended with FBS-free medium and then inoculated to the upper chambers in transwell. DMEM medium with 10% FBS was added to the inferior chambers. Non-invading cells were removed by scrubbing gently using a cotton-tipped swab. Each insert was then fixed with 4% formaldehyde for 10 min and stained using 0.1% crystal violet. Micrographs were taken of 3 fields per sample using inverted microscope. The number of cells in each field were counted the passage number was statistical analysis (Mena ± SD). Western-blot Western blot was performed using a standard protocol. The lysates (20 μg) were separated in polyacrylamide sodium dodecyl sulfate gel, and transferred onto a PVDF membrane. The PVDF membranes were blocked at room temperature for 1 h with 5% powdered milk in TBST. Primary antibodies were diluted with TBST (1% powdered milk in TBST). Secondary antibodies were diluted with TBST (0.05% powdered milk in TBST). The membranes were incubated with primary antibodies at room temperature for 2 h followed by incubation with secondary antibodies (HRP-labeled, 1:10000) at room temperature for 1 h. There were 3 replicates for each sample. Blots were detected and then quantified using Quantity one v Int J Clin Exp Med 2015;8(8):
4 Figure 2. The expression levels of lnc-rna HEIH and lnc-rna HULC before and after sirna in different cells. A: HEIH in MHCC97L cells; B: HULC in HepG2 cells. Statistical analysis All data are expressed as means ± standard deviations (SDs). Statistical analyses were conducted using two-sample t test in SPSS (version 11.5). A value of P<0.05 was considered significant. Results Expression of HEIH and HULC in different cell line The expression of HEIH and HULC in hepatoma cell line MHCC97L and HepG2 and in the control normal human liver cell line HL-7702 was detected by real-time PCR with specific primers. The fold differences in gene expression were determined using the 2 -ΔΔCT method. We assumed the expression of HEIH and HULC in HL-7702 as 1. We found that the expression of HEIH and HULC notably upregulated in hepatoma cell line compared with that in control group (Figure 1A and 1B, P<0.05). And the expression of HULC in HepG2 cell line was higher than that in MHCC97L cell line (Figure 1B). Effect of HEIH and HULC on cell proliferation and invasion Figure 2 showed the expression of HEIH and HULC in different cell line after over-expressive plasmid and specific sirna transfection. The expression of HEIH and HULC obviously increased after over-expressive plasmid transfection compared with that of empty plasmid (Figure 2A and 2B). The expression of HEIH and HULC were obviously inhibited after specific sirna transfection compared with sirna of random sequence (Figure 2A and 2B). Overexpression of HULC promoted cell proliferation of MHCC97L and HepG2, however, over-expression of HEIH could not (Figure 3). Overexpression of HULC and HEIH significantly promoted cell invasion of MHCC97L and HepG2, however, inhibition the expression of these two lncrnas with sirna could not notably effect cell invasion of MHCC97L and HepG2 (Figure 4, P>0.05). The relationship between HULC and the expression of cell cycle associated protein Studies have showed that there was positive correlation between HULC and proliferation of hepatocellular carcinoma, and between HULC and invasion of hepatocellular carcinoma. Snail not only plays an essential role in EMT of cells, but also is an important protein in the process of EMT in cancer cells. By transfection of overexpression plasmid, HULC over-expressed in hepatocellular carcinoma cell. Over-expression of HULC led to upregulation of Snail. Discussion With the completion of the human genome project, scientists found that just a small part of DNA could encode protein, while a large portion of DNA could not. These DNA which could not encode protein might transcript into RNA which was not the so-called noise of transcription. Although these RNA could not participate in Int J Clin Exp Med 2015;8(8):
5 Figure 3. Cell proliferation determination results by MTT method. A: Over-expression of lnc-rna HULC in MHCC97L cells; B: Over-expression of lnc-rna HEIH in MHCC97L cells; C: Over-expression of lnc-rna HULC in HepG2 cells; D: Over-expression of lnc-rna HEIH in HepG2 cells. and some other cell life activities. Thereby, lncrna are widely involved in physiological and pathological process. Now, researches on lncrna became one of the most interesting research areas in molecular biology [14]. Figure 4. The effects of HULC on snail. gene encoding and protein synthesis directly, they are essential for posttranscriptional control, clipping, and modification. These RNA play an important role in a lot of biological activities and have close relation with generation, development, diagnosis and treatment of disease [13]. lncrna is a kind of non-coding RNA with more than 200 nucleotide, which is considered to be the noise of genome transcription without biological function for a long time. However, recent studies revealed that lncrna played an important role in dosage compensation effect, epigenetic regulation, cell cycle, differentiation, Hepatocellular carcinoma is the third common malignant tumor whose fatality rate only next to stomach carcinoma and esophageal cancer, and endangers the human health. Mechanism of carcinogenesis and development is the research focus in oncology. Long-term accumulation of many factors leads to carcinogenesis. Although the three steps of hepatocarcinogenesis (hepatitishepatic cirrhosis-hepatocellular carcinoma) are well known, the molecular mechanism of each process is not clear [15, 16]. Therefore, investigation of potential carcinogenic agent and the molecular mechanism is significant for diagnosis and treatment of hepatocellular carcinoma. Though the time to study lncrna is not long, Int J Clin Exp Med 2015;8(8):
6 lncrna has been confirmed to widely participate in biological activities, especially regulation of the expression of cell cycle related gene, modification of chromatin, dosage compensation effect, and so on. Some kinds of lncrna have been found abnormally expressed in one or many kinds of tumor. In hepatocellular carcinoma, some related lncrna has been found, such as HEIH, HULC, HOTAIR, MALAT and MEG3 [17-19]. The above researches suggest that lncrna might play an important role in the tumorigenesis and development of hepatocellular carcinoma. Our research detected the expression of HEIH and HULC in different hepatoma cell line by real-time PCR and found that the expression of HEIH and HULC notably upregulated in hepatoma cell line MHCC97L and HepG2 compared with that in human normal hepatocyte line chl We constructed over-expressive vector and specific sirna of lncrna-heih and lncrna- HULC and confirmed that sirna could inhibit the expression of target gene (lncrna-heih and lncrna-hulc). The fold differences in gene expression were determined using the 2 -ΔΔCT method and we assumed the expression of HEIH and HULC in HL-7702 as 1. The expression of these two kinds of lncrna significantly upregulated compared with the control group (P<0.05) and the expression of HULC in HepG2 cell line was higher than that in MHCC97L. This result was consistent with previous studies [20]. Further, the effect of lncrna on proliferation of hepatoma carcinoma cell was analyzed by MTT Cell Proliferation and Cytotoxicity Assay Kit. Results showed that over-expression of lnc- RNA HULC obviously promoted proliferation of MHCC97L and HepG2, while over-expression of HEIH could not. This result suggested that lnc- RNA HULC promoted proliferation of tumor cell by regulating tumor cell proliferation associated gene, especially cell cycle related gene to change cell cycle of tumor cell. Cell invasion assay with transwell showed that Overexpression of HULC and HEIH significantly promoted cell invasion of MHCC97L and HepG2, however, inhibition the expression of these two lncrnas with sirna could not notably effect cell invasion of MHCC97L and HepG2. Epithelial-Mesenchymal mesenchymal Transition transition (EMT) is a biological process that polar epithelial cells transformed to cells with interstitial phenotype through some program. EMT plays an important role in genesis and development of tumor, especially changes abilities of cell adhesion and migration to promote invasion and metastasis of tumor cells. Thus EMT also plays an important role in invasion and metastasis of ovarian cancer. Snail is very important in EMT process of tumor cells, and has become research focus in the field of tumor study [21]. Therefore, on the basis of the above results, we observed the effect of lnc- RNA HEIH and lnc-rna HULC on the expression of Snail in hepatoma carcinoma cell. The results showed that over-expression of lnc-rna HEIH or lnc-rna HULC increased the expression of Snail gene in HepG2 at different degree. Nevertheless, it was not clear that whether this upregulation of Snail gene was directly effectedaffected by lnc-rna HEIH and lnc-rna HULC. In the successive experiments, we will find proteins interacting with lnc-rna HEIH and lnc- RNA HULC and reveal the molecular mechanism in regulating cell cycle by RNA pull down experiment. Disclosure of conflict of interest None. Address correspondence to: Dr. Zhaoyun Li, Wenzhou Medical University, Wenzhou, Zhejiang, P. R. China; Taizhou Central Hospital, Taizhou , Zhejiang, P. R. China. Tel: ; Fax: ; zhaoyunli1@126.com References [1] Philippen LE, Dirkx E, da Costa-Martins PA and De Windt LJ. Non-coding RNA in control of gene regulatory programs in cardiac development and disease. J Mol Cell Cardiol 2015; [Epub ahead of print]. [2] Szafranski K, Abraham KJ and Mekhail K. Noncoding RNA in neural function, disease, and aging. Front Genet 2015; 6: 87. [3] You J, Zhang Y, Liu B, Li Y, Fang N, Zu L, Li X and Zhou Q. MicroRNA-449a inhibits cell growth in lung cancer and regulates long noncoding RNA nuclear enriched abundant transcript 1. Indian J Cancer 2014; 51 Suppl 3: e [4] McCarty G and Loeb DM. Hypoxia-Sensitive Epigenetic Regulation of an Antisense-Oriented lncrna Controls WT1 Expression in Myeloid Leukemia Cells. PLoS One 2015; 10: e [5] Panzitt K, Tschernatsch MM, Guelly C, Moustafa T, Stradner M, Strohmaier HM, Buck CR, Denk H, Schroeder R, Trauner M and Int J Clin Exp Med 2015;8(8):
7 Zatloukal K. Characterization of HULC, a novel gene with striking up-regulation in hepatocellular carcinoma, as noncoding RNA. Gastroenterology 2007; 132: [6] Wang J, Liu X, Wu H, Ni P, Gu Z, Qiao Y, Chen N, Sun F and Fan Q. CREB up-regulates long noncoding RNA, HULC expression through interaction with microrna-372 in liver cancer. Nucleic Acids Res 2010; 38: [7] Panzitt K, Tschernatsch MM, Guelly C, Moustafa T, Stradner M, Strohmaier HM, Buck CR, Denk H, Schroeder R, Trauner M and Zatloukal K. Characterization of HULC, a novel gene with striking up-regulation in hepatocellular carcinoma, as noncoding RNA. Gastroenterology 2007; 132: [8] Yang F, Zhang L, Huo XS, Yuan JH, Xu D, Yuan SX, Zhu N, Zhou WP, Yang GS, Wang YZ, Shang JL, Gao CF, Zhang FR, Wang F and Sun SH. Long noncoding RNA high expression in hepatocellular carcinoma facilitates tumor growth through enhancer of zeste homolog 2 in humans. Hepatology 2011; 54: [9] He Y, Meng XM, Huang C, Wu BM, Zhang L, Lv XW and Li J. Long noncoding RNAs: Novel insights into hepatocelluar carcinoma. Cancer Lett 2014; 344: [10] Martens JA, Laprade L and Winston F. Intergenic transcription is required to repress the Saccharomyces cerevisiae SER3 gene. Nature 2004; 429: [11] Hirota K, Miyoshi T, Kugou K, Hoffman CS, Shibata T and Ohta K. Stepwise chromatin remodelling by a cascade of transcription initiation of non-coding RNAs. Nature 2008; 456: [12] Cui M, Xiao Z, Wang Y, Zheng M, Song T, Cai X, Sun B, Ye L and Zhang X. Long Noncoding RNA HULC Modulates Abnormal Lipid Metabolism in Hepatoma Cells through an mir-9-mediated RXRA Signaling Pathway. Cancer Res 2015; 75: [13] Feng Y, Fan Y, Huiqing C, Zicai L, Quan D. The emerging landscape of long non-coding RNAs. Yi Chuan 2014; 36: [14] Guil S and Esteller M. RNA-RNA interactions in gene regulation: the coding and noncoding players. Trends Biochem Sci 2015; 40: [15] Michielsen P and Ho E. Viral hepatitis B and hepatocellular carcinoma. Acta Gastroenterol Belg 2011; 74: 4-8. [16] Yang P, Markowitz GJ and Wang XF. The hepatitis B virus-associated tumor microenvironment in hepatocellular carcinoma. Natl Sci Rev 2014; 1: [17] Panzitt K, Tschernatsch MM, Guelly C, Moustafa T, Stradner M, Strohmaier HM, Buck CR, Denk H, Schroeder R, Trauner M and Zatloukal K. Characterization of HULC, a novel gene with striking up-regulation in hepatocellular carcinoma, as noncoding RNA. Gastroenterology 2007; 132: [18] Yang Z, Zhou L, Wu LM, Lai MC, Xie HY, Zhang F and Zheng SS. Overexpression of long noncoding RNA HOTAIR predicts tumor recurrence in hepatocellular carcinoma patients following liver transplantation. Ann Surg Oncol 2011; 18: [19] Yang F, Zhang L, Huo XS, Yuan JH, Xu D, Yuan SX, Zhu N, Zhou WP, Yang GS, Wang YZ, Shang JL, Gao CF, Zhang FR, Wang F and Sun SH. Long noncoding RNA high expression in hepatocellular carcinoma facilitates tumor growth through enhancer of zeste homolog 2 in humans. Hepatology 2011; 54: [20] Matouk IJ, Abbasi I, Hochberg A, Galun E, Dweik H and Akkawi M. Highly upregulated in liver cancer noncoding RNA is overexpressed in hepatic colorectal metastasis. Eur J Gastroenterol Hepatol 2009; 21: [21] Acloque H, Thiery JP, Nieto MA. The physiology and pathology of the EMT. Meeting on the epithelial-mesenchymal transition. EMBO Rep 2008; 9: Int J Clin Exp Med 2015;8(8):
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationLncRNA LET function as a tumor suppressor in breast cancer development
European Review for Medical and Pharmacological Sciences 2018; 22: 6002-6007 LncRNA LET function as a tumor suppressor in breast cancer development C.-X. ZHOU, X. WANG, N. YANG, S.-K. XUE, W.-C. LI, P.-P.
More informationLong noncoding RNA CASC2 inhibits metastasis and epithelial to mesenchymal transition of lung adenocarcinoma via suppressing SOX4
European Review for Medical and Pharmacological Sciences 2017; 21: 4584-4590 Long noncoding RNA CASC2 inhibits metastasis and epithelial to mesenchymal transition of lung adenocarcinoma via suppressing
More informationOriginal Article Increased expression of lncrna HULC indicates a poor prognosis and promotes cell metastasis in osteosarcoma
Int J Clin Exp Pathol 2015;8(3):2994-3000 www.ijcep.com /ISSN:1936-2625/IJCEP0005023 Original Article Increased expression of lncrna HULC indicates a poor prognosis and promotes cell metastasis in osteosarcoma
More informationConstruction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation
Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation J. Du 1, Z.H. Tao 2, J. Li 2, Y.K. Liu 3 and L. Gan 2 1 Department of Chemistry,
More informationLong noncoding RNA linc-ubc1 promotes tumor invasion and metastasis by regulating EZH2 and repressing E-cadherin in esophageal squamous cell carcinoma
JBUON 2018; 23(1): 157-162 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE Long noncoding RNA linc-ubc1 promotes tumor invasion and metastasis
More informationPrognostic significance of overexpressed long non-coding RNA TUG1 in patients with clear cell renal cell carcinoma
European Review for Medical and Pharmacological Sciences 2017; 21: 82-86 Prognostic significance of overexpressed long non-coding RNA TUG1 in patients with clear cell renal cell carcinoma P.-Q. WANG, Y.-X.
More informationEffect of lncrna LET on proliferation and invasion of osteosarcoma cells
European Review for Medical and Pharmacological Sciences 2018; 22: 1609-1614 Effect of lncrna LET on proliferation and invasion of osteosarcoma cells G. KONG 1, X.-J. QI 2, J.-F. WANG 3 1 Department of
More informationOriginal Article Increased LincRNA ROR is association with poor prognosis for esophageal squamous cell carcinoma patients
Int J Clin Exp Pathol 2017;10(4):4654-4660 www.ijcep.com /ISSN:1936-2625/IJCEP0048142 Original Article Increased LincRNA ROR is association with poor prognosis for esophageal squamous cell carcinoma patients
More informationOncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
More informationLong noncoding RNA DARS-AS1 acts as an oncogene by targeting mir-532-3p in ovarian cancer
European Review for Medical and Pharmacological Sciences 2019; 23: 2353-2359 Long noncoding RNA DARS-AS1 acts as an oncogene by targeting mir-532-3p in ovarian cancer K. HUANG, W.-S. FAN, X.-Y. FU, Y.-L.
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay
Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis
More informationPUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells
PUMA gene transfection can enhance the sensitivity of epirubicin-induced apoptosis of MCF-7 breast cancer cells C.-G. Sun 1 *, J. Zhuang 1 *, W.-J. Teng 1, Z. Wang 2 and S.-S. Du 3 1 Department of Oncology,
More informationLncRNA RGMB-AS1 is activated by E2F1 and promotes cell proliferation and invasion in papillary thyroid carcinoma
European Review for Medical and Pharmacological Sciences 2018; 22: 1979-1986 LncRNA RGMB-AS1 is activated by E2F1 and promotes cell proliferation and invasion in papillary thyroid carcinoma Z. ZHANG 1,
More informationDownregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases
Brief Communication Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Qinghai Zeng 1 *, Cuihong Jin 2 *, Wenhang Chen 2, Fang Xia 3, Qi Wang 3, Fan Fan 4,
More informationAdvances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016)
7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) Expression of Beta-Adrenergic Receptor in Glioma LN229 Cells and Its Effect on Cell Proliferation Ping Wang1, Qingluan
More informationOriginal Article Long non-coding RNA PCAT-1 over-expression promotes proliferation and metastasis in non-small cell lung cancer cells
Int J Clin Exp Med 2015;8(10):18482-18487 www.ijcem.com /ISSN:1940-5901/IJCEM0012566 Original Article Long non-coding RNA PCAT-1 over-expression promotes proliferation and metastasis in non-small cell
More informationLncRNA NKILA suppresses colon cancer cell proliferation and migration by inactivating PI3K/Akt pathway
Original Article LncRNA NKILA suppresses colon cancer cell proliferation and migration by inactivating PIK/Akt pathway Jian Huang #, Lingfeng Zhao #, Wei Chen #, Jian Duan 4, Dibesh Shrestha, Ruize Zhou,
More informationThe lncrna MIR4435-2HG is upregulated in hepatocellular carcinoma and promotes cancer cell proliferation by upregulating mirna-487a
Kong et al. Cellular & Molecular Biology Letters (2019) 24:26 https://doi.org/10.1186/s11658-019-0148-y Cellular & Molecular Biology Letters RESEARCH LETTER Open Access The lncrna MIR4435-2HG is upregulated
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationResearch Article Plasma HULC as a Promising Novel Biomarker for the Detection of Hepatocellular Carcinoma
BioMed Research International Volume 213, Article ID 13616, 5 pages http://dx.doi.org/1.1155/213/13616 Research Article Plasma HULC as a Promising Novel Biomarker for the Detection of Hepatocellular Carcinoma
More informationResearch Article Expression and Clinical Significance of the Novel Long Noncoding RNA ZNF674-AS1 in Human Hepatocellular Carcinoma
BioMed Research International Volume 2016, Article ID 3608914, 5 pages http://dx.doi.org/10.1155/2016/3608914 Research Article Expression and Clinical Significance of the Novel Long Noncoding RNA ZNF674-AS1
More informationEffects of EZH2 gene on the growth and migration of hepatocellular carcinoma HepG2 cells
Original Article Effects of EZH2 gene on the growth and migration of hepatocellular carcinoma HepG2 cells Hongtao Zhao 1, Yiyao Xu 2, Yilei Mao 2, Yangde Zhang 1 1 Hepatobiliary and Intestinal Surgery
More informationOriginal Article Long non-coding RNA LINC00673 promotes hepatocellular carcinoma progression and metastasis through negatively regulating mir-205
Am J Cancer Res 2017;7(12):2536-2544 www.ajcr.us /ISSN:2156-6976/ajcr0058431 Original Article Long non-coding RNA LINC00673 promotes hepatocellular carcinoma progression and metastasis through negatively
More informationCircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer
European Review for Medical and Pharmacological Sciences 2018; 22: 3713-3718 CircHIPK3 is upregulated and predicts a poor prognosis in epithelial ovarian cancer N. LIU 1, J. ZHANG 1, L.-Y. ZHANG 1, L.
More informationDownregulation of long non-coding RNA LINC01133 is predictive of poor prognosis in colorectal cancer patients
European Review for Medical and Pharmacological Sciences 2017; 21: 2103-2107 Downregulation of long non-coding RNA LINC01133 is predictive of poor prognosis in colorectal cancer patients J.-H. ZHANG 1,
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationGLI-1 facilitates the EMT induced by TGF-β1 in gastric cancer
European Review for Medical and Pharmacological Sciences 2018; 22: 6809-6815 GLI-1 facilitates the EMT induced by TGF-β1 in gastric cancer M. LIANG 1, X.-C. LIU 1, T. LIU 2, W.-J. LI 3, J.-G. XIANG 1,
More informationOriginal Article Long non-coding RNA PANDAR overexpression serves as a poor prognostic biomarker in oral squamous cell carcinoma
Int J Clin Exp Pathol 2018;11(5):2728-2734 www.ijcep.com /ISSN:1936-2625/IJCEP0073509 Original Article Long non-coding RNA PANDAR overexpression serves as a poor prognostic biomarker in oral squamous cell
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationOverexpression of long-noncoding RNA ZFAS1 decreases survival in human NSCLC patients
European Review for Medical and Pharmacological Sciences 2016; 20: 5126-5131 Overexpression of long-noncoding RNA ZFAS1 decreases survival in human NSCLC patients F.-M. TIAN 1, F.-Q. MENG 2, X.-B. WANG
More informationExpression of lncrna TCONS_ in hepatocellular carcinoma and its influence on prognosis and survival
European Review for Medical and Pharmacological Sciences 2017; 21: 5655-5660 Expression of lncrna TCONS_00027978 in hepatocellular carcinoma and its influence on prognosis and survival Q. CHEN 1, G.-D.
More informationRNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
More informationLong non-coding RNA XLOC_ correlates with poor prognosis and promotes tumorigenesis of hepatocellular carcinoma
European Review for Medical and Pharmacological Sciences 2017; 21: 4867-4874 Long non-coding RNA XLOC_010235 correlates with poor prognosis and promotes tumorigenesis of hepatocellular carcinoma F. YANG,
More informationBerberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway
Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis
More informationOnline Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2
Online Data Supplement Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Yi Lin and Zhongjie Sun Department of physiology, college of
More informationLong noncoding RNA LINC01510 is highly expressed in colorectal cancer and predicts favorable prognosis
European Review for Medical and Pharmacological Sciences 2018; 22: 7710-7715 Long noncoding RNA LINC01510 is highly expressed in colorectal cancer and predicts favorable prognosis J.-F. ZHOU, H.-G. WANG,
More informationEffects of AFP gene silencing on Survivin mrna expression inhibition in HepG2 cells
mrna expression inhibition in HepG2 cells Z.L. Fang 1, N. Fang 2, X.N. Han 3, G. Huang 2, X.J. Fu 2, G.S. Xie 2, N.R. Wang 2 and J.P. Xiong 1 1 Department of Medical Oncology, The First Affiliated Hospital
More informationONCOLOGY LETTERS 15: , 2018
10098 MicroRNA 154 functions as a tumor suppressor in non small cell lung cancer through directly targeting B cell specific Moloney murine leukemia virus insertion site 1 SIDA LIU 1, YANG YANG 2, LU CHEN
More informationEffect of sirna targeting EZH2 on cell viability and apoptosis of bladder cancer T24 cells
Effect of sirna targeting EZH2 on cell viability and apoptosis of bladder cancer T24 cells H.F. Wang 1, H. Yang 2, L.B. Hu 2, Y.H. Lei 2, Y. Qin 2, J. Li 2, C.W. Bi 2, J.S. Wang 1 and Q. Huo 1 1 Department
More informationAn epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
More informationOriginal Article Effect of the long non-coding RNA AC on growth, invasion and migration for tongue squamous cell carcinoma
Int J Clin Exp Med 2016;9(3):5805-5812 www.ijcem.com /ISSN:1940-5901/IJCEM0020509 Original Article Effect of the long non-coding RNA AC007392.4 on growth, invasion and migration for tongue squamous cell
More informationhttp / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology A431 . Western aza-dC FUT4-siRNA
ISSN 1007-7626 CN 11-3870 / Q http / /cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2015 8 31 8 836 ~ 842 DOI 10 13865 /j cnki cjbmb 2015 08 09 FUT4-siRNA 5-aza-dC 1 3 * 1 1 3
More informationExpression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival
European Review for Medical and Pharmacological Sciences 2017; 21: 3397-3401 Expression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival W.-X. LI 1, R.-L.
More informationOriginal Article AF inhibits proliferation and migration of hepatocellular carcinoma cells by binding eef1a1 protein
Int J Clin Exp Med 2016;9(6):10766-10774 www.ijcem.com /ISSN:1940-5901/IJCEM0025027 Original Article AF113014 inhibits proliferation and migration of hepatocellular carcinoma cells by binding eef1a1 protein
More informationm 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
More informationUp-regulation of long non-coding RNA BCAR4 predicts a poor prognosis in patients with osteosarcoma, and promotes cell invasion and metastasis
European Review for Medical and Pharmacological Sciences 2016; 20: 4445-4451 Up-regulation of long non-coding RNA BCAR4 predicts a poor prognosis in patients with osteosarcoma, and promotes cell invasion
More informationInfluence of RNA Interference Targeting Rab5a on Proliferation and Invasion of Breast Cancer Cell Line MCF-7
The Open Breast Cancer Journal, 2011, 3, 1-5 1 Open Access Influence of RNA Interference Targeting Rab5a on Proliferation and Invasion of Breast Cancer Cell Line MCF-7 Nier Cha 1,2, Xinyue Gu 1, Fengyun
More informationReview Article Long Noncoding RNA H19 in Digestive System Cancers: A Meta-Analysis of Its Association with Pathological Features
BioMed Research International Volume 2016, Article ID 4863609, 8 pages http://dx.doi.org/10.1155/2016/4863609 Review Article Long Noncoding RNA H19 in Digestive System Cancers: A Meta-Analysis of Its Association
More informationClinical significance of up-regulated lncrna NEAT1 in prognosis of ovarian cancer
European Review for Medical and Pharmacological Sciences 2016; 20: 3373-3377 Clinical significance of up-regulated lncrna NEAT1 in prognosis of ovarian cancer Z.-J. CHEN, Z. ZHANG, B.-B. XIE, H.-Y. ZHANG
More informationOriginal Article The impact of lncrna MG3 on laryngeal cancer cell growth, cycle, and apoptosis related factors
Int J Clin Exp Pathol 2017;10(7):7475-7480 www.ijcep.com /ISSN:1936-2625/IJCEP0051407 Original Article The impact of lncrna MG3 on laryngeal cancer cell growth, cycle, and apoptosis related factors Yuan
More informationDecreased expression of mir-490-3p in osteosarcoma and its clinical significance
European Review for Medical and Pharmacological Sciences Decreased expression of mir-490-3p in osteosarcoma and its clinical significance B. TANG, C. LIU, Q.-M. ZHANG, M. NI Department of Orthopedics,
More informationLow levels of serum mir-99a is a predictor of poor prognosis in breast cancer
Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer J. Li 1, Z.J. Song 2, Y.Y. Wang 1, Y. Yin 1, Y. Liu 1 and X. Nan 1 1 Tumor Research Department, Shaanxi Provincial Tumor Hospital,
More informationMir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer
European Review for Medical and Pharmacological Sciences 2017; 21: 4278-4282 Mir-595 is a significant indicator of poor patient prognosis in epithelial ovarian cancer Q.-H. ZHOU 1, Y.-M. ZHAO 2, L.-L.
More informationBlocking the expression of the hepatitis B virus S gene in hepatocellular carcinoma cell lines with an anti-gene locked nucleic acid in vitro
Blocking the expression of the hepatitis B virus S gene in hepatocellular carcinoma cell lines with an anti-gene locked nucleic acid in vitro Y.-B. Deng, H.-J. Qin, Y.-H. Luo, Z.-R. Liang and J.-J. Zou
More informationOriginal Article LncRNA HOXD-AS1 promotes melanoma cell proliferation and invasion by suppressing RUNX3 expression
Am J Cancer Res 2017;7(12):2526-2535 www.ajcr.us /ISSN:2156-6976/ajcr0064925 Original Article LncRNA HOXD-AS1 promotes melanoma cell proliferation and invasion by suppressing RUNX3 expression Hailin Zhang,
More informationMicroRNA-132 inhibits migration, invasion and epithelial-mesenchymal transition by regulating TGFβ1/Smad2 in human non-small cell lung cancer
European Review for Medical and Pharmacological Sciences MicroRNA-132 inhibits migration, invasion and epithelial-mesenchymal transition by regulating TGFβ1/Smad2 in human non-small cell lung cancer J.-X.
More informationIncreased expression of the lncrna BANCR and its prognostic significance in human osteosarcoma
Increased expression of the lncrna BANCR and its prognostic significance in human osteosarcoma Z.Q. Peng 1, R.B. Lu 2, D.M. Xiao 3 and Z.M. Xiao 1 1 Department of Orthopedics, The First Affiliated Hospital
More informationOriginal Article Differential expression profile analysis of mirnas with HER-2 overexpression and intervention in breast cancer cells
Int J Clin Exp Pathol 2017;10(5):5039-5062 www.ijcep.com /ISSN:1936-2625/IJCEP0052419 Original Article Differential expression profile analysis of mirnas with HER-2 overexpression and intervention in breast
More informationXiangyang Yu, Guozhi Zhang, Peng Zhao, Mingxin Cui, Changyou Wang, Yanfang He
Int J Clin Exp Pathol 2016;9(3):3304-3312 www.ijcep.com /ISSN:1936-2625/IJCEP0020733 Original Article Downregulation of a long noncoding RNA BANCR contributes to proliferation and metastasis of hepatocellular
More informationEpstein-Barr virus driven promoter hypermethylated genes in gastric cancer
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer J Yu *, KF To, QY Liang K e y M e s s a g e s 1. Somatostatin receptor 1
More informationReview Article Elevated expression of long noncoding RNA UCA1 can predict a poor prognosis: a meta-analysis
Int J Clin Exp Med 2016;9(6):9656-9664 www.ijcem.com /ISSN:1940-5901/IJCEM0025465 Review Article Elevated expression of long noncoding RNA UCA1 can predict a poor prognosis: a meta-analysis Tao Chen 1*,
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More informationEffect of ABCE1-silencing gene, transfected by electrotransfer, on the proliferation, invasion, and migration of human thyroid carcinoma SW579 cells
Effect of ABCE1-silencing gene, transfected by electrotransfer, on the proliferation, invasion, and migration of human thyroid carcinoma SW579 cells X. Qu 1,2 and L. Zhang 1 1 ENT and Maxillofacial Oncology,
More informationCircMTO1 inhibits cell proliferation and invasion by regulating Wnt/β-catenin signaling pathway in colorectal cancer
European Review for Medical and Pharmacological Sciences 2018; 22: 8203-8209 CircMTO1 inhibits cell proliferation and invasion by regulating Wnt/β-catenin signaling pathway in colorectal cancer Z. GE,
More informationCHAPTER 4 RESULTS. showed that all three replicates had similar growth trends (Figure 4.1) (p<0.05; p=0.0000)
CHAPTER 4 RESULTS 4.1 Growth Characterization of C. vulgaris 4.1.1 Optical Density Growth study of Chlorella vulgaris based on optical density at 620 nm (OD 620 ) showed that all three replicates had similar
More informationMicroRNA-590-5p suppresses the proliferation and invasion of non-small cell lung cancer by regulating GAB1
European Review for Medical and Pharmacological Sciences 2018; 22: 5954-5963 MicroRNA-590-5p suppresses the proliferation and invasion of non-small cell lung cancer by regulating GAB1 B.-B. XU 1, Z.-F.
More informationFunctional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma CH Li, SC Chow, DL Yin,
More informationKDR gene silencing inhibits proliferation of A549cells and enhancestheir sensitivity to docetaxel
KDR gene silencing inhibits proliferation of A549cells and enhancestheir sensitivity to docetaxel R. Wei and J.-P. Zang Department of Respiratory Medicine, People s Hospital of Zhengzhou, Zhengzhou, China
More informationExpression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis
European Review for Medical and Pharmacological Sciences 2018; 22: 726-730 Expression of mir-146a-5p in patients with intracranial aneurysms and its association with prognosis H.-L. ZHANG 1, L. LI 2, C.-J.
More informationOriginal Article Tissue expression level of lncrna UCA1 is a prognostic biomarker for colorectal cancer
Int J Clin Exp Pathol 2016;9(4):4241-4246 www.ijcep.com /ISSN:1936-2625/IJCEP0012296 Original Article Tissue expression level of lncrna UCA1 is a prognostic biomarker for colorectal cancer Hong Jiang,
More informationRNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers
Xu et al. Molecular Cancer (2019) 18:8 https://doi.org/10.1186/s12943-018-0932-8 LETTER TO THE EDITOR RNA-Seq profiling of circular RNAs in human colorectal Cancer liver metastasis and the potential biomarkers
More informationmir-132 inhibits lung cancer cell migration and invasion by targeting SOX4
Original Article inhibits lung cancer cell migration and invasion by targeting SOX4 Yang Li, Lingling Zu, Yuli Wang, Min Wang, Peirui Chen, Qinghua Zhou Tianjin Key Laboratory of Lung Cancer Metastasis
More informationLncRNA FER1L4 suppressed cancer cell growth and invasion in esophageal squamous cell carcinoma
European Review for Medical and Pharmacological Sciences 2018; 22: 2638-2645 LncRNA FER1L4 suppressed cancer cell growth and invasion in esophageal squamous cell carcinoma W. MA 1, C.-Q. ZHANG 2, H.-L.
More informationSoft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
More informationThe role of noncoding RNA in hepatocellular carcinoma
Review Article The role of noncoding RNA in hepatocellular carcinoma Zhuolu Wang, Xinying Li Department of General Surgery, Xiangya Hospital, Central South University, Changsha 410008, People s Republic
More informationAnalysis of circulating long non-coding RNA UCA1 as potential biomarkers for diagnosis and prognosis of osteosarcoma
European Review for Medical and Pharmacological Sciences 2017; 21: 498-503 Analysis of circulating long non-coding RNA UCA1 as potential biomarkers for diagnosis and prognosis of osteosarcoma J.-J. WEN
More informationOriginal Article Notch1 regulates proliferation and invasion in gastric cancer cells via targeting Fascin1
Int J Clin Exp Med 2016;9(10):19204-19212 www.ijcem.com /ISSN:1940-5901/IJCEM0029671 Original Article Notch1 regulates proliferation and invasion in gastric cancer cells via targeting Fascin1 Zhimeng Shi,
More informationHIV-1 Virus-like Particle Budding Assay Nathan H Vande Burgt, Luis J Cocka * and Paul Bates
HIV-1 Virus-like Particle Budding Assay Nathan H Vande Burgt, Luis J Cocka * and Paul Bates Department of Microbiology, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, USA
More informationLong non-coding RNA HNF1A-AS1 promotes cell viability and migration in human bladder cancer
ONCOLOGY LETTERS 15: 4535-4540, 2018 Long non-coding RNA HNF1A-AS1 promotes cell viability and migration in human bladder cancer ZHIHONG FENG and BAOLONG WANG Urology Department, Tianjin Medical University
More informationMethylation regulation of liver-specific microrna-122 expression and its effects on the proliferation and apoptosis of hepatocellular carcinoma cells
Methylation regulation of liver-specific microrna-122 expression and its effects on the proliferation and apoptosis of hepatocellular carcinoma cells T.J. Xing, H.T. Xu, W.Q. Yu and D.F. Jiang Department
More informationRegulatory role of microrna184 in osteosarcoma cells
Regulatory role of microrna184 in osteosarcoma cells G.R. Yin 1,2, Q. Wang 3, X.B. Zhang 2 and S.J. Wang 1 1 Department of Joint Surgery, The Second Hospital of Shandong University, Jinan, China 2 Department
More informationPlasma Bmil mrna as a potential prognostic biomarker for distant metastasis in colorectal cancer patients
Title Plasma Bmil mrna as a potential prognostic biomarker for distant metastasis in colorectal cancer patients Author(s) Pun, JC; Chan, JY; Chun, BK; Ng, KW; Tsui, SY; Wan, TMH; Lo, OSH; Poon, TCJ; Ng,
More informationA Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
More informationOriginal Article MiR-130a regulates the proliferation and metastasis of HCC cells through targeting ZEB1/2
Int J Clin Exp Pathol 2017;10(3):2744-2753 www.ijcep.com /ISSN:1936-2625/IJCEP0046135 Original Article MiR-130a regulates the proliferation and metastasis of HCC cells through targeting ZEB1/2 Ting Wang
More informationOriginal Article High serum mir-203 predicts the poor prognosis in patients with pancreatic cancer
Int J Clin Exp Pathol 2017;10(4):4688-4693 www.ijcep.com /ISSN:1936-2625/IJCEP0047128 Original Article High serum mir-203 predicts the poor prognosis in patients with pancreatic cancer Jun Ma, Xiaokun
More informationSupplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
More informationEffects of methionine-containing dipeptides on α s1 casein expression in bovine mammary epithelial cells *
Journal of Animal and Feed Sciences, 16, Suppl. 2, 2007, 325 329 Effects of methionine-containing dipeptides on α s1 casein expression in bovine mammary epithelial cells * H.H. Wu 1, J.Y. Yang 1,2, K.
More informationMir-138-5p acts as a tumor suppressor by targeting pyruvate dehydrogenase kinase 1 in human retinoblastoma
European Review for Medical and Pharmacological Sciences 2017; 21: 5624-5629 Mir-138-5p acts as a tumor suppressor by targeting pyruvate dehydrogenase kinase 1 in human retinoblastoma Z. WANG 1, Y.-J.
More informationLong non-coding RNA TUSC7 expression is independently predictive of outcome in glioma
European Review for Medical and Pharmacological Sciences 2017; 21: 3605-3610 Long non-coding RNA TUSC7 expression is independently predictive of outcome in glioma X.-L. MA 1, W.-D. ZHU 2, L.-X. TIAN 2,
More informationLong non coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating mir 32 5p/PTEN axis
https://doi.org/10.1186/s13578-017-0192-0 Cell & Bioscience RESEARCH Open Access Long non coding RNA GAS5 suppresses pancreatic cancer metastasis through modulating mir 32 5p/PTEN axis Zhi Qiang Gao *,
More informationGraveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document
Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document Wet Lab: Sara Olson and Lijun Zhan Computational Lab: Xintao Wei and Michael Duff PI: Brenton Graveley
More informationUp-regulation of LINC00161 correlates with tumor migration and invasion and poor prognosis of patients with hepatocellular carcinoma
/, 2017, Vol. 8, (No. 34), pp: 56168-56173 Up-regulation of LINC00161 correlates with tumor migration and invasion and poor prognosis of patients with hepatocellular carcinoma Li-Chao Xu 1,*, Quan-Ning
More informationOriginal Article MicroRNA-27a acts as a novel biomarker in the diagnosis of patients with laryngeal squamous cell carcinoma
Int J Clin Exp Pathol 2016;9(2):2049-2053 www.ijcep.com /ISSN:1936-2625/IJCEP0014841 Original Article MicroRNA-27a acts as a novel biomarker in the diagnosis of patients with laryngeal squamous cell carcinoma
More informationDoctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,
Cyclooxygenase 2 facilitates dengue virus replication and serves as a potential target for developing antiviral agents Chun-Kuang Lin 1,2, Chin-Kai Tseng 3,4, Yu-Hsuan Wu 3,4, Chih-Chuang Liaw 1,5, Chun-
More informationFigure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h
Figure S1 Time-dependent down-modulation of HER3 by EZN-392 HE ER3 mrna A, %Contr rol 12 No Treatment EZN-392, 2 μm 1 8 6 4 2 2 8 24 Time, h Figure S2. Specific target down-modulation by HER3 (EZN-392)
More informationSupplementary Data. Supplementary Methods:
Supplementary Data Supplementary Methods: Cell viability assay. Cells were seeded overnight at a density of 2,000 cells per well in 96-well plates in RPMI with 10% FBS and then treated with the relevant
More informationEffects of metallothionein-3 and metallothionein-1e gene transfection on proliferation, cell cycle, and apoptosis of esophageal cancer cells
Effects of metallothionein-3 and metallothionein-1e gene transfection on proliferation, cell cycle, and apoptosis of esophageal cancer cells Z.Q. Tian 1, Y.Z. Xu 1, Y.F. Zhang 1, G.F. Ma 1, M. He 1 and
More information