Supplementary Figure 1
|
|
|
- Meredith Horn
- 6 years ago
- Views:
Transcription
1 Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity. Singlet cells were gated on the basis of forward and side scatter W and H parameters. Next, T cell subsets were identified on the basis
2 of CD3, CD4, and CD8 staining. T reg cells were identified as FOXP3 + CD4 + T cells. FOXP3 - CD4 + T cells were conventional T cells. (b) Ki67 expression in tumor infiltrating T cell subsets. Ki67 expression was detected in human ovarian cancer infiltrating FOXP3 + and FOXP3 - CD45 + CD3 + CD4 + cells. Ki67 expression was shown in CD4 + T cells from two representative ovarian cancer specimens (left panel) and in FOXP3 - and FOXP33 + CD4 + T cell subsets (right panel). mean ± s.d., n = 10, Student s t-test, * P < (c) Split Manders coefficient plot depicts the colocalization of FOXP3 (red) and cleaved CASP3 (green) in human ovarian cancer section. One representative of 10 is shown. (d,e) Effect of mouse tumor medium on T reg cell gene expression. Normal mouse GFP + T reg cells and GFP - conventional T cells were cultured with MC38-medium for 24 hours. Expression of pro-apoptotic (d) and anti-apoptotic (e) genes was quantified by real-time PCR. The level of each gene in T reg cells was normalized to that in conventional T cells. Data are shown as mean ± s.d., n = 5; Student's t-test, *P < 0.05.
3 Supplementary Figure 2 Suppressive activity of mouse live and apoptotic T reg cells. (a) Representative dot plots show T reg and T conv apoptosis induced by anti-fas mab Jo-1. Annexin V expression was analyzed by FACS at 30 minutes and 4 hours. (b,c) Mouse T reg apoptosis was induced by different conditions. T cell suppressive assay was
4 performed with these apoptotic T reg cells. T cell TNF (b) and IL-2 (c) were measured on day 3 by ELISA, n = 5, Student s t-test, *P < (d-f) Effect of live and apoptotic T reg cells on ID8-OVA tumor immunity. ID8-OVA-bearing mice were treated with live and apoptotic T reg cells. Tumor growth is shown as final bioluminescent signal quantification (d). Effector T cell cytokine expression (e, f) was detected in cancer ascites fluid. Data presented as mean ± s.d., n = 10 animals per group; ANOVA with Dunett post-hoc test, *P < (g) Scheme of pmel-specific B16-F10 model. B16-F10 tumor bearing RAG2 / mice received Pmel-specific T cells and intratumoral apoptotic Treg cell administration as indicated.
5 Supplementary Figure 3 Apoptotic T reg cells mediated immunosuppression via small and non-protein molecules. (a-c) Effect of CTLA-4 blockade on apoptotic Treg-mediated immunosuppression. T cell immunosuppressive assay was performed with apoptotic T reg cells in the presence of anti-ctla4 mab. TNF (a) and IFN- (b) were analyzed by FACS on day 3 and IL-2 (c) was
6 detected by ELISA on day 5 n = 5, ANOVA with Dunett s post-hoc test, *P < (d) Effect of apoptotic Treg supernatants on T cell IL- 2 production. Apoptotic Treg supernatants were collected at 6 hour time point and were added into T cell culture. T cell IL-2 was measured by ELISA. One of 3 experiments is shown. (e-m) Effect of the indicated cytokine blockade on apoptotic Treg cell-mediated immunosuppression. T cell immunosuppressive assay was performed with apoptotic T reg cells in the presence of anti-tgf-β (e-g), anti- EBI3 (h-j), and anti-il-10 (k-l) mabs. TNF (e, h, k) and IFN- (f, I, l) were analyzed by FACS on day 3. IL-2 (g, j, m) was detected by ELISA on day 5. n = 5, ANOVA with Dunett s post-hoc test, *P < 0.05.
7 Supplementary Figure 4 Adenosine production by apoptotic T reg cells. T reg cell apoptosis was induced with anti-fas mab. Adenosine was measured by mass spectrometry in supernatants collected at different time points. Based on the standard curve (a) and the extracted ion changed chromatogram (b), adenosine was detected at 0.5 and 6 hours after induction of apoptosis (c). One of 3 independent experiments is shown.
8 Supplementary Figure 5 The metabolic profile of T reg cells. (a,b) Purine (a) and pyrimidine (b) associated metabolism pathway in tumor associated T reg cells. GSEA analysis was performed in tumor associated T reg cells compared to conventional T cells at GSE55705 data set from GEO database. (c) Intracellular content of ATP in T reg cells and T conv. ATP level was measured in cell lysates with comparable amount of protein by colorimetric assay. Data shown as mean ± s.d., Student s t-test, n = 5, *P < (d) Effect of the pannexin-1 channel inhibitors on apoptotic T reg ATP release. Apoptosis was induced by anti-fas treatment in the presence or absence of inhibitors probenecid and carbenoxolone. ATP in the supernatants was measured by colorimetric assay. Data presented as mean ± s.d., Student s t-test, n = 5, *P < 0.05 in comparison with control. (e,f) Intracellular (e) and released (f) ATP in live (e) and apoptotic (f) wild-type or Nt5e / mouse T reg cells. ATP level in whole cells was normalized to total protein expression (e). ATP in apoptotic T reg cell supernatants was shown at 30 minutes (f). n = 5, paired Student s t- test, *P > (g) Adenosine production by wild-type and Nt5e / apoptotic T reg cells. T reg cell apoptosis was induced with anti-fas and the supernatants were collected at 30 minutes. After deproteinization, adenosine was measured by colorimetric assay. Data shown as mean ± s.d., n = 5, Student s t-test, *P < 0.05.
9 Supplementary Figure 6 The effect of tumor oxidative stress on T reg cells. (a,b) Effect of glucose restriction and 2-DG on conventional T cell (a) and Treg (b) apoptosis. Human T cell subsets were cultured with or without glucose or 2-DG for 24 hours. Annexin V + T cells were measured by flow cytometry. One-way ANOVA with Dunnet s posthoc test, *P < (c) Effect of human ovarian cancer ascites on Treg apoptosis. Mouse T reg cells and conventional T cells (Tconv) were co-cultured with 50% ascites from intraperitoneal ID8 ovarian cancer bearing animals or hydrogen peroxide for 24 hours. Additional cultures were treated with NAC as a free radical scavenger. Annexin V + T reg cells and Tconv were analyzed by flow cytometry. Data presented as mean ± s.d., n = 6, *P < (d) Superoxide level in human ascites. The concentration of superoxide was measured with colorimetric test. Water contains 2 M H 2 O 2 as a positive control. Data are shown as mean ± s.d., n = 3. (e) Mitochondrial load of mouse T reg cells. The cells were treated with fluorescent mitochondrial activity dye (Mitotracker) and analyzed by flow cytometry. One of 3 assays is shown. (f) Level of reactive oxygen species (ROS) in ovarian cancer infiltrating conventional T cells and T reg cells. The level of ROS was tested by CellROX Green and ROS content was shown as mean fluorescence intensity. Data shown as mean ± s.d., n = 5, Student s t-test, *P < (g,h) Expression of human Nrf2 and NRF2-associated genes and protiens in T reg cells. Nfe2l2 and NRF2-associated gene transcripts (g) and proteins (h) were determined in T cell subsets by real-time PCR and immunoblotting, respectively. Data presented as mean ± s.d., n = 5, paired Student s t-test, *P < 0.05
10 Supplementary Table 1. Enrichment of Gene Ontology Terms in T reg cells compared to conventional T cells in B16 melanoma tissues (data series GSE55705). Up-regulated genes GO term GO ID raw p-value adj. p-value electron transport chain GO: e apoptotic process GO: e generation of precursor metabolites and energy GO: e programmed cell death GO: e death GO: e cell death GO: e induction of apoptosis GO: regulation of apoptotic process GO: induction of programmed cell death GO: e organophosphate metabolic process GO: Down-regulated genes RNA metabolic process GO: e e-07 cellular macromolecule metabolic process GO: e e-07 nucleic acid metabolic process GO: e e-07 nucleobase-containing metabolic process GO: e e-07 gene expression GO: e e-06 cellular metabolic compound metabolic process GO: e e-06 heterocycle metabolic process GO: e e-06 RNA processing GO: e e-06 cellular nitrogen compound metabolic process GO: e e-06 organic cyclic compound metabolic process GO: e e-05 Note: Enrichment of Gene Ontology Terms for biological processes was analyzed for significantly up- and down-regulated genes on a background of Affymetrix Mouse 420a v. 2.0 platform (GPL8321). The table contains top 10 significantly enriched biological processes terms.
11 Supplementary Table 2. Enrichment of KEGG Pathways in T reg cells compared to conventional T cells in B16 melanoma tissues (data series GSE55705). Up-regulated pathways Pathway name raw p-value adj. p-value metabolic pathways 1.07e e-60 Huntington's disease 1.53e e-23 Alzheimer's disease 3.28e e-22 Parkinson's disease 2.31e e-19 oxidative phosphorylation 2.58e e-18 pathways in cancer 5.97e e-14 MAPK signaling pathway 8.74e e-12 cell cycle 8.97e e-12 proteasome 5.58e e-11 p53 signaling pathway 3.86e e-09 pyrimidine metabolism 6.14e e-09 purine metabolism 5.71e e-05 apoptosis 2.11e e-05 chemokine signaling pathway 4.59e e-11 pyruvate metabolism fatty acid metabolism Down-regulated pathways ribosome 3.18e e-07 ribosome biogenesis in eukarytes RNA transport spliceosome acute myleoid leukemia valine, leucine and isoleucine biosynthesis aldosterone-regulated sodium reabsorption RNA degradation colorectal cancer apoptosis Note: Enrichment of KEGG Pathways were analyzed for significantly up- and downregulated genes on a background of mouse genome. The table contains top 10
12 enriched pathways and some other statistically enriched pathways. Additionally, of the up-regulated pathways there are some significantly enriched pathways (below dashed line), but not in top 10.
13 Supplementary Table 3. Primers for real-time PCR analysis (5 3 ) Gene ID (GeneBank) Forward Human Reverse Bbc3 TGGGTGAGACCCAGTAAGGA CTCCCTGGGGCCACAAATCT BclxL AGACCCCCAGTGCCATCAAT CATCCAAACTGCTGCTGTGCG Bcl2 GGAGGCTGGGATGCCTTTGT AAAGCCAGCTTCCCCAATGA Bim GGTCTGCAGTTTGTTGGAGC ATGGAAGCCATTGCACTGAGA Bax TTTGCTTCAGGGTTTCATCCA CTGGAGACAGGGACATCAGT Casp3 GCTCTGGTTTTCGGTGGGTG ACCACGGCAGGCCTGAATAAT Casp8 AGCCCTGCTGAATTTGCTAGTC CAGGAGAATATAATCCGCTCCAC Casp9 CAGGCCCCATATGATCGAGG TCAAGAGCACCGACATCACC Fas CCCTGTCCTCCAGGTGAAAG AGACAAAGCCACCCCAAGTT Gapdh CTCCTCCTGTTCGACAGTCA TGCAGGAGGCATTGCTGATG Gclc ACCAGACCGGCAAAGAGAAG CCAGGACAGCCTAATCTGGG Gclm AAGCACTTTCTCGGCTACGA TCATGAAGCTCCTCGCTGTG Ggct CAGAGAGGATCCACCTCCGA TAACCCCTTCTTGCTCATCCAG Hmox1 GTGCCACCAAGTTCAAGCAG CACGCATGGCTCAAAAACCA Mcl1 GACTTTTGGCTACGGAGAAGGA AACTCCACAAACCCATCCCAG Nqo1 GCTGGTTTGAGCGAGTGTTC CTGCCTTCTTACTCCGGAAGG Nrf2 CGACCTTCGCAAACAACTCT TGTGGGCAACCTGGGAGTAG Gene ID (GeneBank) Forward Mouse Reverse Bbc3 CATAGAGCCACATGCGAGCG TGCTCTTCTTGTCTCCGCCG BclxL ACCTCCTCCCCGACCTATGA CTATCTCCGGCGACCAGCAA Bcl2 CAGCCTGAGAGCAACCCAAT TATAGTTCCACAAAGGCATCCCAG Bim CTGCGAGCTGTGTTCCACTT ATGGAAGCCATTGCACTGAGA Bax GAGCTGCAGAGGATGATTGC CTTGGATCCAGACAAGCAGC Casp3 GAGCTTGGAACGGTACGCTA GCGAGATGACATTCCAGTGC
14 Casp8 AGAAAGCGAAGCAGCCTATGG TAGAAGAGCTGTAACCTGTGGC Casp9 GCGCGACATGATCGAGGATA TGGTCTTTCTGCTCACCACC Fas TGCTTGCTGGCTCACAGTTA GTTCCATGTTCACACGAGGC Gapdh CCCTTAAGAGGGATGCTGCC TACGGCCAAATCCGTTCACA Gclc TTGGGTCGCAAGTAGGAAGC GTTAGAGTACCGAAGCGGGG Gclm TGGGCACAGGTAAAACCCAA CACCCTGATGCCTAAGCCAA Ggct CGCCTGCAGGACTTTAAGC AAGCCGATCGGATACAAGCA Hmox1 GAGCAGAACCAGCCTGAACT AAATCCTGGGGCATGCTGTC Mcl1 CAAAGAGGCTGGGATGGGTTT CCCTATTGCACTCACAAGGC Nqo1 CCGATTCAGAGTGGCATCCT GAGCAATTCCCTTCTGCCCT Nrf2 TTGCCCTAGCCTTTTCTCCG ATGTGGGCAACCTGGGAGTA
Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12
1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before
Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified
Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified for RFP-LC3 puncta (red dots) representing both autolysosomes
Supplemental Materials
Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo
Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs
Supplementary Table Clinicopathological characteristics of 35 patients with CRCs Characteristics Type-A CRC Type-B CRC P value Sex Male / Female 9 / / 8.5 Age (years) Median (range) 6. (9 86) 6.5 (9 76).95
Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods
Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary
Supplemental Table I.
Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Supplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded
Supplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded from TCGA and differentially expressed metabolic genes
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
ILC1 and ILC3 isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the ILC1, ILC2 and
Supplementary Methods and isolation and culture Following cell sorting, we confirmed that the recovered cells belonged to the, ILC2 and subsets. For this purpose we performed intracellular flow cytometry
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the cardiac glycoside target, ATP1A1. (a) The percentage
and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the
Supplementary Figure 1. LAG3 + Treg-mediated regulation of germinal center B cells and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the experimental protocol for the
Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
Table S1. New colony formation 7 days after stimulation with doxo and VCR in JURKAT cells
Table S1. New colony formation 7 days after stimulation with and in JURKAT cells drug co + number of colonies 7±14 4±7 48±11 JURKAT cells were stimulated and analyzed as in Table 1. Drug concentrations
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
Supplementary Figure 1
d f a IL7 b IL GATA RORγt h HDM IL IL7 PBS Ilra R7 PBS HDM Ilra R7 HDM Foxp Foxp Ilra R7 HDM HDM Ilra R7 HDM. 9..79. CD + FOXP + T reg cell CD + FOXP T conv cell PBS Ilra R7 PBS HDM Ilra R7 HDM CD + FOXP
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing
SUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.
Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.
1 Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. (a) Survival curves. WT Sham (n=5), WT CLP or WT CLP antibiotic
fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation
Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of
SUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
Nature Medicine: doi: /nm.3922
Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun
SUPPLEMENT Supplementary Figure 1: (A) (B)
SUPPLEMENT Supplementary Figure 1: CD4 + naïve effector T cells (CD4 effector) were labeled with CFSE, stimulated with α-cd2/cd3/cd28 coated beads (at 2 beads/cell) and cultured alone or cocultured with
Supplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance
Immunity, Volume 34 Supplemental Information D4 + D25 + + Regulatory T ells Promote Th17 ells In Vitro and Enhance Host Resistance in Mouse andida albicans Th17 ell Infection Model Pushpa Pandiyan, Heather
Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-
Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone
Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler
Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler DR CALUX Boys Girls Database Systemic lupus erythematosus 4.4 0.0021 6.7
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN
B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification
Nature Protocols: doi: /nprot Supplementary Figure 1
Supplementary Figure 1 Traditional electronic gating strategy for analysing cell death based on A5-FITC and 7-AAD. a, Flow cytometry analysis showing the traditional two-stage electronic gating strategy
Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder I Nakaya, Kousik
SUPPLEMENTARY FIGURES 1-19 T H 2 response to cysteine-proteases requires dendritic cell-basophil cooperation via ROS mediated signaling Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder
CD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas
a CD4 + T cells recovered in Rag2 / recipient ( 1 5 ) Heart Lung Pancreas.5 1 2 4 6 2 4 6 Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas b Heart Lung Pancreas Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas
L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow
A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells
Cigarette Smoke Exposure and HIV-Related Neurologic Disease Progression Basic Mechanisms and Clinical Consequences
Cigarette Smoke Exposure and HIV-Related Neurologic Disease Progression Basic Mechanisms and Clinical Consequences Walter Royal, III, MD Professor of Neurology University of Maryland School of Medicine
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast
Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
of whole cell cultures in U-bottomed wells of a 96-well plate are shown. 2
Supplementary online material Supplementary figure legends Supplementary Figure 1 Exposure to T reg cells causes loss of T resp cells in co-cultures. T resp cells were stimulated with CD3+CD28 alone or
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/8/352/352ra110/dc1 Supplementary Materials for Spatially selective depletion of tumor-associated regulatory T cells with near-infrared photoimmunotherapy
Nature Immunology: doi: /ni Supplementary Figure 1. Id2 and Id3 define polyclonal T H 1 and T FH cell subsets.
Supplementary Figure 1 Id2 and Id3 define polyclonal T H 1 and T FH cell subsets. Id2 YFP/+ (a) or Id3 GFP/+ (b) mice were analyzed 7 days after LCMV infection. T H 1 (SLAM + CXCR5 or CXCR5 PD-1 ), T FH
ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1
ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,
% of Cells A B C. Proliferation Index. T cell count (10 6 ) Division Index. % of Max CFSE. %Ki67+ cells. Supplementary Figure 1.
A B C T cell count (1 6 ) 3. 2. 1.. * % of Max CFSE ormoxia ypoxia o Stim. Proliferation Index 2.5 2. 1.5 1. * Division Index 2. 1.5 1..5. D E %Ki67+ cells 1 8 6 4 2 % of Cells 8 ormoxia 6 ypoxia 4 2 *
Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III
Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor
Supplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.
Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized
Krishnamoorthy et al.,
Krishnamoorthy et al., c d e ND ND Supplementary Figure 1 RSV-induces inflammation even in the asence of allergen. Tolerized pups were either infected with RSV or not. The mice were sacrificed a week following
Effector T Cells and
1 Effector T Cells and Cytokines Andrew Lichtman, MD PhD Brigham and Women's Hospital Harvard Medical School 2 Lecture outline Cytokines Subsets of CD4+ T cells: definitions, functions, development New
Supplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
Supplementary Table e-1. Flow cytometry reagents and staining combinations
Supplementary data Supplementary Table e-1. Flow cytometry reagents and staining combinations Reagents Antibody Fluorochrome Clone Source conjugation CD3 FITC UCHT1 BD Biosciences CD3 PerCP-Cy5.5 SK7 Biolegend
Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables
Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were
Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression.
Relative Serpin expression 25 2 15 1 5 Serpina3f 1 2 3 4 5 6 8 6 4 2 Serpina3g 1 2 3 4 5 6 C57BL/6 DBA/2 Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression. Splenocytes
Objectives. Abbas Chapter 11: Immunological Tolerance. Question 1. Question 2. Question 3. Definitions
Objectives Abbas Chapter 11: Immunological Tolerance Christina Ciaccio, MD Children s Mercy Hospitals and Clinics February 1, 2010 To introduce the concept of immunologic tolerance To understand what factors
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
pplementary Figur Supplementary Figure 1. a.
pplementary Figur Supplementary Figure 1. a. Quantification by RT-qPCR of YFV-17D and YFV-17D pol- (+) RNA in the supernatant of cultured Huh7.5 cells following viral RNA electroporation of respective
Supplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
Spleen. mlns. E Spleen 4.1. mlns. Spleen. mlns. Mock 17. Mock CD8 HIV-1 CD38 HLA-DR. Ki67. Spleen. Spleen. mlns. Cheng et al. Fig.
C D E F Mock 17 Mock 4.1 CD38 57 CD8 23.7 HLA-DR Ki67 G H I Cheng et al. Fig.S1 Supplementary Figure 1. persistent infection leads to human T cell depletion and hyper-immune activation. Humanized mice
Mechanistic Toxicology
SECOND EDITION Mechanistic Toxicology The Molecular Basis of How Chemicals Disrupt Biological Targets URS A. BOELSTERLI CRC Press Tavlor & France Croup CRC Press is an imp^t o* :H Taylor H Francn C'r,,jpi
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
HD1 (FLU) HD2 (EBV) HD2 (FLU)
ramer staining + anti-pe beads ramer staining a HD1 (FLU) HD2 (EBV) HD2 (FLU).73.11.56.46.24 1.12 b CD127 + c CD127 + d CD127 - e CD127 - PD1 - PD1 + PD1 + PD1-1 1 1 1 %CD127 + PD1-8 6 4 2 + anti-pe %CD127
Defective STAT1 activation associated with impaired IFN-g production in NK and T lymphocytes from metastatic melanoma patients treated with IL-2
Defective STAT1 activation associated with impaired IFN-g production in NK and T lymphocytes from metastatic melanoma patients treated with IL-2 SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1:
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr
Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±
Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).
Supplementary Figure 1 Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ). (b) Immunoblot analysis of TRIM29 in lung primary
Supplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
Supplemental Information. Checkpoint Blockade Immunotherapy. Induces Dynamic Changes. in PD-1 CD8 + Tumor-Infiltrating T Cells
Immunity, Volume 50 Supplemental Information Checkpoint Blockade Immunotherapy Induces Dynamic Changes in PD-1 CD8 + Tumor-Infiltrating T Cells Sema Kurtulus, Asaf Madi, Giulia Escobar, Max Klapholz, Jackson
Supplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
SUPPLEMENTARY FIGURE 1
SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF
CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong
Supplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
Supplementary Figure 1.
Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/3/114/ra23/dc1 Supplementary Materials for Regulation of Zap70 Expression During Thymocyte Development Enables Temporal Separation of CD4 and CD8 Repertoire Selection
Protein SD Units (P-value) Cluster order
SUPPLEMENTAL TABLE AND FIGURES Table S1. Signature Phosphoproteome of CD22 E12 Transgenic Mouse BPL Cells. T-test vs. Other Protein SD Units (P-value) Cluster order ATPase (Ab-16) 1.41 0.000880 1 mtor
SUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
Supplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated
1 Supplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated (U) EGFR TL mice (n=7), Kras mice (n=7), PD-1 blockade
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
Life Sciences METABOLISM. Transform Your Metabolic Research
METABOLISM Transform Your Metabolic Research COMPREHENSIVE TOOLS FOR ADVANCING YOUR METABOLIC RESEARCH Metabolism refers to a set of chemical reactions which are responsible for transforming carbohydrates,
Immunological Tolerance
Immunological Tolerance Introduction Definition: Unresponsiveness to an antigen that is induced by exposure to that antigen Tolerogen = tolerogenic antigen = antigen that induces tolerance Important for
Nature Medicine: doi: /nm.4078
Supplementary Figure 1. Cetuximab induces ER stress response in DiFi cells. (a) Scheme of SILAC proteome. (b) MS-base read out of SILAC experiment. The histogram of log 2 -transformed normalized H/L ratios
Supplemental Figures: Supplemental Figure 1
Supplemental Figures: Supplemental Figure 1 Suppl. Figure 1. BM-DC infection with H. pylori does not induce cytotoxicity and treatment of BM-DCs with H. pylori sonicate, but not heat-inactivated bacteria,
A. Generation and characterization of Ras-expressing autophagycompetent
Supplemental Material Supplemental Figure Legends Fig. S1 A. Generation and characterization of Ras-expressing autophagycompetent and -deficient cell lines. HA-tagged H-ras V12 was stably expressed in
Acute lung injury in children : from viral infection and mechanical ventilation to inflammation and apoptosis Bern, R.A.
UvA-DARE (Digital Academic Repository) Acute lung injury in children : from viral infection and mechanical ventilation to inflammation and apoptosis Bern, R.A. Link to publication Citation for published
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
TITLE: MODULATION OF T CELL TOLERANCE IN A MURINE MODEL FOR IMMUNOTHERAPY OF PROSTATIC ADENOCARCINOMA
AD Award Number: DAMD17-01-1-0085 TITLE: MODULATION OF T CELL TOLERANCE IN A MURINE MODEL FOR IMMUNOTHERAPY OF PROSTATIC ADENOCARCINOMA PRINCIPAL INVESTIGATOR: ARTHUR A HURWITZ, Ph.d. CONTRACTING ORGANIZATION:
MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice
Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice (a) CD11c.DOG transgenic mice (tg) were treated with 8 ng/g body weight (b.w.) diphtheria toxin (DT) i.p. on day -1 and every
Nature Immunology doi: /ni Supplementary Figure 1. Raf-1 inhibition does not affect TLR4-induced type I IFN responses.
Supplementary Figure 1 Raf-1 inhibition does not affect TLR4-induced type I IFN responses. Real-time PCR analyses of IFNB, ISG15, TRIM5, TRIM22 and APOBEC3G mrna in modcs 6 h after stimulation with TLR4
Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
Supplementary Information:
Supplementary Information: Follicular regulatory T cells with Bcl6 expression suppress germinal center reactions by Yeonseok Chung, Shinya Tanaka, Fuliang Chu, Roza Nurieva, Gustavo J. Martinez, Seema
Supplementary. presence of the. (c) mrna expression. Error. in naive or
Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated
Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to
Class II tetramer staining Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to PE were combined with dominant HIV epitopes (DRB1*0101-DRFYKTLRAEQASQEV, DRB1*0301- PEKEVLVWKFDSRLAFHH,
Nature Medicine: doi: /nm.2109
HIV 1 Infects Multipotent Progenitor Cells Causing Cell Death and Establishing Latent Cellular Reservoirs Christoph C. Carter, Adewunmi Onafuwa Nuga, Lucy A. M c Namara, James Riddell IV, Dale Bixby, Michael
T cell maturation. T-cell Maturation. What allows T cell maturation?
T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry